A protein inducing plant immune function and its encoding gene, expression vector and application

Abstract

The present invention discloses a protein that induces plant immune function, its encoding gene, expression vector and application. The present invention has discovered a protein derived from Pythium ultimum ( The last Pythium ) can trigger plant hypersensitive response (HR) and reactive oxygen species (ROS) accumulation, which can stimulate HR and promote ROS accumulation, and was named PyEli17. Objective evaluation using the Agrobacterium-mediated transient expression system found that it can significantly increase the expression of PTI-related pathway genes, proving that it can effectively activate plant immunity and disease resistance. It is helpful for the research and development of plant immune inducers. The powerful function of this gene can be used as a candidate gene for the development of plant immune inducers, and can also be used to directly introduce genes into plants using transgenic technology to develop and cultivate disease-resistant varieties.

Description

Technical Field

[0001] The invention relates to, in particular to, a protein inducing plant immune function and its encoding gene, expression vector and application. Background Art

[0002] Pythium Pythium ) is a highly adaptable fungus. It mostly attacks the leaves, flowers, fruits and other parts of plants. Due to the strong adaptability of Pythium, Pythium wilt is not limited to high temperature seasons. Even if the temperature is low, but the high humidity continues, it can also occur seriously in May or September. Pythium is found all over the world and can be saprophytic, parasitic or facultatively parasitic, and can be aquatic, terrestrial or amphibious. Many species are important soil-borne plant pathogens, often causing fruit rot, root rot, stem base rot and seedling damping-off. So far, there are more than 80 important plant pathogenic Pythium species, which are very harmful to crops. Under suitable conditions, the oospores of Pythium germinate to produce zoosporangia and zoospores. After the zoospores form resting spores, they germinate to produce germ tubes and infectious hyphae and invade the plant body. In dry or adverse environments without host plants, sexual reproduction can be carried out, forming oospores and anthers and fertilizing to produce oospores. Oospores have thick walls, can remain dormant, and can survive in the soil for a long time. Compared with other soil pathogens, the hyphae of Pythium grow fast.

[0003] Although there are no specific immune cells in plants, every cell in the plant body has receptors that recognize pathogens and enable the plant to make appropriate immune responses. Plant cells have two major types of immune receptors, namely pattern recognition receptors (PRRs) located on the surface of plant cells and nucleotide-binding leucine-rich repeat receptors (NLRs) in the cell. NLRs are the proteins encoded by most disease-resistant genes R.

[0004] PRRs can recognize conserved pathogen / damage / microbe / herbivore-associated molecular patterns and activate pattern-triggered immunity (PTI), thereby limiting pathogenicity. There are many types of PAMPs, such as bacterial flagellin, bacterial elongation factor, fungal chitin polysaccharide, fungal xylanase, and endogenous stimulatory peptides. Pathogens evade or inhibit PTI by secreting effector molecules, which leads to effector-triggered susceptibility (ETS). In turn, plants have evolved intracellular nucleotide-binding and leucine-rich repeat receptors (NLRs) that can perceive effectors and activate effector-triggered immunity (ETI). Pathogens may also evade or inhibit ETI by evolving to remove effectors or diversify effectors. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a PyEli17 protein that induces HR and ROS accumulation in Pythium.

[0006] Another object of the present invention is to provide a gene encoding the above protein.

[0007] Another object of the present invention is to provide applications of the above protein or encoding gene.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] A PyEli17 protein is at least one of the following:

[0010] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO.1;

[0011] (b) An analogue of the amino acid sequence shown in SEQ ID NO: 1 obtained by replacing, inserting or deleting one or more amino acids and still having the function of activating plant immunity and disease resistance.

[0012] The above-mentioned PyEli17 protein can activate the immune and disease resistance effects of plants; preferably, it can activate the pattern-triggered immunity effect in tobacco.

[0013] The nucleotide sequence of the gene encoding the above-mentioned PyEli17 protein is obtained according to the codon coding rules.

[0014] A PyEli17 gene, whose nucleotide sequence is at least one of the following:

[0015] (a) the nucleotide sequence shown in SEQ ID NO.2;

[0016] (b) Analogs of the nucleotide sequence in (a) above obtained by base insertion, deletion, or substitution that still have the function of activating plant immunity and disease resistance.

[0017] A PyEli17 expression vector comprises the nucleotide sequence shown in SEQ ID NO.2.

[0018] The vector skeleton of the PyEli17 expression vector is pBin-3HA.

[0019] The use of the above-mentioned PyEli17 protein, PyEli17 gene and / or PyEli17 expression vector in inducing plant reactive oxygen burst and / or upregulating the expression of plant immune-related pathway marker genes.

[0020] The plant immunity-related pathway marker gene is at least one of NbCyp71D20, NbPti5, NbWRKY7 and NtHIN1.

[0021] The use of the above-mentioned PyEli17 protein, PyEli17 gene and / or PyEli17 expression vector in activating plant immune disease resistance.

[0022] Application of the above-mentioned PyEli17 protein, PyEli17 gene and / or PyEli17 expression vector in the preparation of plant immune inducers.

[0023] The use of the above-mentioned PyEli17 protein, PyEli17 gene and / or PyEli17 expression vector in screening disease-resistant varieties.

[0024] A method for activating plant immune disease resistance, comprising the following steps:

[0025] (1) Integrating the nucleotide sequence of the PyEli17 gene into an expression vector and transferring it into Agrobacterium to obtain Agrobacterium expressing the PyEli17 gene;

[0026] (2) Applying Agrobacterium expressing the PyEli17 gene to plants to activate plant immune resistance.

[0027] The application to plants refers to application to plant leaves.

[0028] The plant is Nicotiana benthamiana.

[0029] Compared with the prior art, the present invention has the following advantages and effects:

[0030] The inventors of the present invention discovered in experiments that a Pythium ultimum) can trigger plant hypersensitive response (HR) and reactive oxygen species (ROS) accumulation, which can stimulate HR and promote ROS accumulation, and was named PyEli17. It was objectively evaluated using the Agrobacterium-mediated transient expression system and found that it can significantly increase the expression of PTI-related pathway genes, proving that it can effectively activate plant immunity and disease resistance. It is helpful for the research and development of plant immune inducers. The powerful function of this gene can be used as a candidate gene for the development of plant immune inducers, and can also be used to directly introduce genes into plants using transgenic technology to develop and cultivate disease-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a photograph of the surface morphology of leaves to which Agrobacterium was applied in Example 3.

[0032] Figure 2 This is the result of DAB staining of leaves to which Agrobacterium was applied in Example 3.

[0033] Figure 3 This is a diagram of the electrolyte leakage measurement results in Example 3.

[0034] Figure 4 This is a diagram showing the results of quantitatively detecting the accumulation of active oxygen in Example 3.

[0035] Figure 5 This is a diagram showing the results of the immune stimulation effect test in Example 3.

[0036] Figure 6 This is a diagram of the Western blot experimental results in Example 3.

[0037] Figure 7 This is the SDS-PAGE electrophoresis diagram in Example 4.

[0038] Figure 8 It is a photograph of the leaf surface morphology after protein injection in Example 4 and a result diagram after DAB staining.

[0039] Fig. 9 This is a graph showing the results of the electrolyte leakage measurement after protein injection in Example 4.

[0040] Fig.10 This is a diagram showing the results of quantitatively detecting the accumulation of active oxygen after protein injection in Example 4. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0042] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0043] The vector pBin-3HA is a pBin vector carrying an HA fusion tag, which has been disclosed in the literature Zheng L, Yu Y, ZhengY, Wang Y, Wu N, Jiang C, Zhao H, Niu D. Long small RNA76113 targetsCYCLICNUCLEOTIDE-GATED ION CHANNEL 5 to repress disease resistance in rice. Plant Physiol. 2024 Feb 29;194(3):1889-1905. doi: 10.1093 / plphys / kiad599. PMID:37949839; PMCID: PMC10904327.

[0044] Example 1 Extraction of PyEli gene and construction of expression vector

[0045] In the previous experiments, the inventors screened a series of potential PyEli proteins and their corresponding genes that can stimulate plant immunity and disease resistance from Pythium ultimum. In order to further clarify their effects, the following experiments were designed for verification.

[0046] 1.1 Experimental strains

[0047] The tested strain Pythium ultimum ( Pythiumultimum ) was preserved by the Potato Research Laboratory, Crop Research Institute, Guangdong Academy of Agricultural Sciences. The strain was preserved in 10% V8 solid medium at 10°C.

[0048] 1.2 Extraction of RNA from Pythium ultimum and acquisition of cDNA of target gene

[0049] Collect the hyphae of Pythium ultimum, then freeze them in liquid nitrogen and put them into a mortar for cooling and grinding. Extract and purify the RNA of Pythium ultimum according to the recommended method of Tiangen Total RNA Extraction and Purification Kit. According to the method provided by the RNA Reverse Transcription Kit of Novizan, reverse transcription and synthesis of cDNA were performed using Oligo(dT) as primer. Using the above cDNA as a template, PCR amplification was performed with the corresponding upstream and downstream primers to obtain the gene fragments of PyEli2 (SEQ ID NO.4) and PyEli17 (SEQ ID NO.2).

[0050] PyEli2 primer: F: CGATAGGGTACCCCCATGAACGCCCTGCGGTTC;

[0051] PyEli2 primer: R: GGATCCGTCGACCCCTACGCACATCTGAGGCTC;

[0052] PyEli17 primer: F: CGATAGGGTACCCCCATGAAATTCCAAGCCGTC;

[0053] PyEli17 primer: R: GGATCCGTCGACCCCCGCGAAGCAGCTGCCCTC.

[0054] The PCR reaction system was: 2.5 μL 10× PCR reaction buffer; 1.5 μL 1.5 mM MgCl2; 0.5 μL 2.5 mM dNTPs; 0.25 μL Taq DNA polymerase (5.0 U / μL); 0.5 μL primer; 0.5 μL template; and sterile water was added to 25 μL.

[0055] The reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1:30 min, 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

[0056] 1.3 Construction of expression vector

[0057] The pBin-3HA empty vector plasmid was digested with SmaI, and the PyEli2 and PyEli17 gene fragments obtained in 1.2 were connected to the vector using the homologous recombinase of Novizan.

[0058] The reaction system is as follows: 2 μL 10×CEⅡ reaction buffer; 2 μL of the above PCR recovery product; 2 μL of the above enzyme-digested empty vector; 1 μL homologous recombinase; and sterile water to make up to 10 μL.

[0059] The reaction procedure was: react at 37°C for 30 min. The ligation product was transformed into E. coli DH5α, and the transformants were screened on Kan resistance medium. The positive clones were picked to extract the plasmids for colony PCR identification. The identified positive clones were sequenced, and the sequencing proved that the pBin-3HA:PyEli2 and pBin-3HA:PyEli17 expression vectors were obtained correctly.

[0060] Example 2 Preparation and transformation of competent cells

[0061] 2.1 Preparation of Nicotiana benthamiana seedlings

[0062] Nicotiana benthamiana Nicotiana benthamiana ) were sown in plastic pots (d=10cm) filled with vermiculite (2-4mm) and grown in a greenhouse with 14 h light (strong light) / 10 h dark. After growing for 7 days and growing two true leaves, they were transplanted to a culture soil with a volume ratio of 5:1 of vermiculite and black soil for 30 days. Leaves at the same 3rd, 4th, and 5th leaf positions were taken for expressing the experimental gene.

[0063] 2.2 Obtaining Agrobacterium competent cells

[0064] Agrobacterium GV3101 strain was streaked on LB solid medium plates and inverted for 18-20 h at 28°C; a single colony was placed in LB liquid medium (containing 100 mg / L Rif) and cultured with shaking at 28°C for 18-20 h; 100 times the volume of bacterial solution without antibiotics was added to the bacterial solution and cultured with shaking at 28°C until OD600 reached 0.3-0.5; after cooling on ice, the solution was centrifuged at 4000 r / min for 5 min at 4°C and the supernatant was discarded; 20 mmol / L CaCl was added 2 The precipitate was suspended in the solution, centrifuged at 4000r / min for 5min at 4℃, and the supernatant was discarded; 20mmol / L CaCl 2 The solution is used to suspend the bacterial pellet again for later use.

[0065] 2.3 Transformation of Agrobacterium with pBin-3HA expression vector

[0066] The pBin-3HA:PyEli2 and pBin-3HA:PyEli17 expression vectors were transformed into Agrobacterium cells respectively by electroporation.

[0067] Rinse the electroporation cup three times with 70% alcohol, and then air-dry the alcohol completely. Add 100ng of the expression vector prepared in 1.3 to the Agrobacterium competent cell and place it on ice for 30 minutes. Transfer the Agrobacterium competent cells to the electroporation cup and perform electroporation transformation using a voltage of 2.5kV. After the electroporation is completed, add the Agrobacterium competent cells to 400μL LB liquid culture medium and culture at 28℃ for 2h. Take 20μL of bacterial solution and evenly spread it on a solid LB culture medium plate containing 50mm kanamycin and 25mm rifampicin, and culture it inverted at 28℃ for 48h. Pick a single colony for colony PCR to obtain positive clones, and obtain Agrobacterium positive clones transferred into the pBin-3HA:PyEli2 and pBin-3HA:PyEli17 expression vectors.

[0068] 2.4 Transient expression of PyEli protein in Nicotiana benthamiana

[0069] The positive clones obtained in 2.3 were placed in LB liquid culture medium and cultured at 28°C with shaking for 30 h. The bacterial liquid was collected and centrifuged at 8000 rpm for 2 min. 2 Wash three times. Finally, wash with 10 mM MgCl 2 Dilute the bacterial solution to an OD600 value of 0.3. Mix the bacterial solution with the bacterial solution containing the silencing suppressor P19 in a ratio of 1:1 (the expression vector Agrobacterium containing the silencing suppressor p19 gene of the tomato bushy stunt virus gene can improve the expression effect of Agrobacterium after co-injection. For the transient expression method, please refer to the literature "Optimization of transient expression conditions of pCB302-3 vector mediated by Agrobacterium in Nicotiana benthamiana [J]. Journal of Huazhong Agricultural University, 2015, 34(3):5.DOI:10.13300 / j.cnki.hnlkxb.2015.03.018."). Use a 1 mL syringe to slowly inject the bacterial solution into the tobacco leaves from the back of the leaves. Inject 4 leaves of each of the 3 plants.

[0070] In addition, referring to the above experimental method, Agrobacterium suspension containing GFP and INF1 genes was prepared and injected into other leaves as controls using the same method, with 3 replicates in each group.

[0071] Example 3 Detection and verification of tobacco leaves after Agrobacterium transformation

[0072] 3.1 Observation of leaf surface morphology after expression

[0073] Adjust the OD value of the Agrobacterium solution to 0.3-0.4, and then use a 1ml syringe to inject the appropriate-age Nicotiana benthamiana. Five days after the injection, observe the part injected with Agrobacterium and take a photo for preservation. The results are as follows: Figure 1 As shown, the GFP group and the PyEli2 group did not show obvious changes, while the INF1 and PyEli17 groups showed obvious necrosis and discoloration. The performance of the INF1 and PyEli17 groups was very similar, proving that PyEli17 showed a similar function of inducing plant immune response as INF1, while PyEli2, although a protein close to PyEli17, did not show obvious effects, proving that only PyEli17 in this series of proteins can stimulate immune response.

[0074] 3.2 Detection of reactive oxygen species (ROS) accumulation

[0075] The OD value of the Agrobacterium solution was adjusted to 0.3-0.4, and then injected into Nicotiana benthamiana of appropriate age using a 1 ml syringe. After 36 hours of injection of all treatment genes, samples of the injected leaves were taken, stained with 1 mg / ml DAB solution in the dark for 8 hours, and then decolorized with 95% ethanol. Finally, a camera was used to take pictures and record the phenotype. The results are shown in the figure. Figure 2As shown, obvious brown polymers were formed at the injection sites of both the INF1 group and the PyEli17 group, proving that a large amount of ROS was produced in the contacted tobacco leaves.

[0076] 3.3 Electrolyte leakage determination

[0077] The electrolyte leakage test is an experimental method for quantitatively evaluating cell death. Samples were taken 36 hours after injection according to the method in 3.2. The injected tissues were taken for five replicates in each experimental group for electrolyte leakage detection. The difference before and after boiling was determined as the electrolyte leakage value using a conductivity meter. The results are shown in Figure 3 Both the INF1 and PyEli17 groups showed obvious electrolyte leakage, proving that after treatment with these two groups, reactive oxygen species induced apoptosis in plant cells.

[0078] 3.4 Quantitative detection of reactive oxygen species accumulation

[0079] The imagJ software was used to quantitatively analyze the leaves with reactive oxygen phenotypes photographed in 3.2. GFP was used as the control and set as the reference value 1. The data of the other experimental groups were based on the GFP detection value to obtain relative quantitative values. The results are shown in the figure. Figure 4 .

[0080] 3.5 Immune stimulation effect detection

[0081] In order to detect the effect of injection on tobacco pattern-triggered immunity (PTI), we used quantitative PCR technology to detect the expression of PTI-related Maker gene. The detection gene primers are as follows:

[0082] qNbCyp71D20-F:GTTGACGCATTGTTGAG;

[0083] qNbCyp71D20-R: ATCTTCGCCTCCTAATGC;

[0084] qNbPti5-F:CCTCCAAGTTTGAGCTCGGATAGT;

[0085] qNbPti5-R:CCAAGAAATTCTCCATGCACTCTGTC;

[0086] qNbWRKY7-F:CACAAGGGTACAAACAACACAG;

[0087] qNbWRKY7-R:GGTTGCATTTGGTTCATGTAAG;

[0088] qNtHINl-1F:TACATGCGTATTAGGCTTAAG;

[0089] qNtHINl-1R: CTACCAATCAAGATGGCATCTGG;

[0090] The OD value of the Agrobacterium solution was adjusted to 0.3-0.4, and then injected into Nicotiana benthamiana of appropriate age using a 1 ml syringe. After 48 hours of injection, the injected leaves were taken as samples, and RNA was extracted, reverse transcribed into cDNA, and quantitative PCR experiments were performed. The GFP group was used as a control to analyze the expression level of the above Maker gene. The experimental results are shown in Figure 5 As shown, the expression levels of PTI-related genes NbCyp71D20, NbPti5, NbWRKY7 and NtHINl in the PyEli17 group were significantly increased, proving that after injection of Agrobacterium containing PyEli17, the broad-spectrum immune function of plants can be effectively stimulated, and the disease resistance of plants can be significantly improved.

[0091] 3.6 Western blot experiment

[0092] In order to prove that the transferred vector expressed the target protein and that plant immunity was induced by the protein, this experiment performed WB test on the injected tobacco samples. According to the method in 3.2, the injected leaves were taken as samples 48 hours after injection, and total protein was extracted. The detection was performed according to the conventional WB experimental method, SDS-PAGE gel was prepared, electrophoresed, transferred to PVDF membrane, blocked with skim milk for 1.5 to 3 hours, hybridized with HRP-coupled HA antibody (Wuhan Sanying, catalog number: 66006) for 1 to 3 hours, and the membrane was washed three times with TBST buffer for chemiluminescence detection.

[0093] The results are as follows Figure 6 As shown, the corresponding protein expression products were detected in the total proteins extracted from the leaves injected with the expression vector, proving that the expression vector was successfully expressed in the tobacco leaves and achieved the corresponding effect.

[0094] Example 4 Prokaryotic expression and effect verification of PyEli17 protein

[0095] 4.1 Prokaryotic expression

[0096] In order to further verify the effect of PyEli17 protein, the prokaryotic expression method was used to prepare PyEli17 protein. The specific steps are as follows:

[0097] The PyEli17 gene was integrated into pET32a-6His to obtain the recombinant plasmid pET32a-6His:PyEli17, and then the recombinant plasmid was transformed into Escherichia coli E. coliBL21(DE3), using 50ug / mL ampicillin (Amp) resistance plates to screen transformed strains. Pick the transformed colonies, shake and culture overnight, and extract the plasmid for identification. Plasmid sequencing results show that the transformed strain already carries the PyEli17 target gene. Finally, the recombinant Escherichia coli strain was obtained after screening E. coli BL21(DE3)-PyEli17.

[0098] The recombinant strain E. coli BL-21(DE3)-PyEli17 was inoculated into LB liquid medium and cultured in a shake flask. When the OD value reached 0.6, IPTG with a final concentration of 0.2 mM was added for induction culture for 16 h, and samples were taken. The cells were disrupted with an ultra-high pressure cell disruptor, centrifuged, and purified using a His-tagged nickel column to obtain the PyEli17 protein solution.

[0099] The GFP protein solution was prepared according to the above method.

[0100] 4.2 SDS-PAGE electrophoresis identification

[0101] Prepare BSA protein solutions with gradient concentrations of 0.125, 0.25, 0.5, 1, 2.5, and 5 mg / mL, and use a 12.5% ​​denatured acrylamide color gel rapid preparation kit to prepare SDS-PAGE electrophoresis gel together with the PyEli17 protein solution and GFP protein solution obtained in 4.1. The SDS-PAGE electrophoresis results are shown in Figure 2. Figure 7 As shown, the experimental results prove that PyEli17 and GFP proteins are successfully expressed with high purity and can be used for subsequent experiments.

[0102] 4.3 Tobacco leaf injection experiment

[0103] Prepare Nicotiana benthamiana plants according to the method of Examples 2 and 3, and slowly inject the protein solution into the tobacco leaves from the back of the leaves using a 1 mL syringe. Injection was repeated for 3 plants and 4 leaves each.

[0104] Then, the electrolyte leakage was observed and detected by referring to the methods of 3.1 to 3.4 in Example 3. The experimental results are as follows: Figures 8 to 10 As shown, the experimental results proved that after injection of PyEli17 protein, similar effects were achieved as those of injection of Agrobacterium vector. Obvious necrosis and ROS generation occurred around the injection site, and obvious electrolyte leakage occurred in the cells, proving that PyEli17 protein can stimulate plant immune response.

[0105] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of PyEli17 protein or PyEli17 gene in activating tobacco immune disease resistance; The amino acid sequence of the PyEli17 protein is shown in SEQ ID NO.1; The nucleotide sequence of the PyEli17 gene is shown in SEQ ID NO.

2.

2. Application of PyEli17 protein or PyEli17 gene in the preparation of tobacco immune inducer; The amino acid sequence of the PyEli17 protein is shown in SEQ ID NO.1; The nucleotide sequence of the PyEli17 gene is shown in SEQ ID NO.

2.

3. Application of PyEli17 protein or PyEli17 gene in screening tobacco immune and disease-resistant varieties; The amino acid sequence of the PyEli17 protein is shown in SEQ ID NO.1; The nucleotide sequence of the PyEli17 gene is shown in SEQ ID NO.

2.

4. A method for activating plant immune disease resistance, characterized in that The steps include: (1) Integrating the nucleotide sequence of the PyEli17 gene into an expression vector and transferring it into Agrobacterium to obtain Agrobacterium expressing the PyEli17 gene; (2) Applying Agrobacterium expressing the PyEli17 gene to plants to activate plant immune resistance; The plant is Nicotiana benthamiana; The nucleotide sequence of the PyEli17 gene is shown in SEQ ID NO.

2.

5. The method according to claim 4, characterized in that: The application to plants refers to application to plant leaves.

Images