Application of corn gene ZmACO2 in improvement of drought resistance of corn

Abstract

The invention belongs to the technical field of corn gene engineering, and discloses application of a ZmACO2 gene in improvement of drought resistance of corn. The gene ZmACO2 capable of improving corn drought tolerance and application of the gene in rice drought tolerance genetic improvement are separated, cloned and identified through functional verification. According to the invention, drought phenotype identification is carried out on a CRISPR mutant material of ZmACO2, and the result shows that ZmACO2 is a negative regulatory factor of corn drought response, so that the function and application approach of the gene are proved, and a new gene resource is provided for improvement of corn drought resistance.

Description

Technical Field

[0001] The present invention belongs to the technical field of corn genetic engineering, and specifically relates to the application of the ZmACO2 gene in improving corn drought resistance. The applicant has isolated, cloned and identified a gene ZmACO2 that can improve corn drought tolerance through functional verification, and the application of the gene in rice drought resistance genetic improvement. The present invention identifies the drought phenotype of the CRISPR mutant material of ZmACO2, and the results show that ZmACO2 is a negative regulatory factor of corn drought response, confirming the function and application of the gene. Background Art

[0002] Traditional breeding methods are time-consuming and have unpredictable results. The rapid development of transgenic technology has provided an important way to improve crop yield, stress resistance and disease resistance. Using transgenic technology and transgenic plant materials to study the function of genes at the plant physiological, biochemical and molecular levels has great practical significance for increasing crop yields under drought conditions, creating new materials and providing theoretical support for molecular breeding. Cultivating new varieties to increase crop yields under drought conditions is the main way to improve crop stress resistance, and has important practical significance for solving the impact of crop yield reduction due to drought.

[0003] When drought strikes, corn will be damaged to varying degrees, and even no grains will be harvested in severe cases. Therefore, it is of great significance to study the growth and development of corn and its resistance to drought. Using genetic engineering technology to obtain varieties that are genetically drought-resistant and then improve the drought resistance of corn at different growth stages has become a way of modern genetic breeding.

[0004] The present invention isolates the ZmACO2 gene from corn, and the gene controls the length of corn ear, the number of grains per row and the number of grains per ear. Knocking out the gene can increase the length of corn ear and the number of grains per row. There is no certain correlation between the increase in corn yield and the drought resistance of corn plants. Through candidate gene association analysis, we identified that there is an Indel in the 5'UTR region of ZmACO2 that is significantly correlated with drought resistance, and thus the drought resistance of the ZmACO2 gene is studied.

[0005] The successful identification of the function of transgenic materials in improving the stress resistance of corn will be of great significance for breeding new stress-resistant corn varieties and even for the genetic improvement of plant stress resistance. Summary of the invention

[0006] The purpose of the present invention is to provide an application of a corn gene ZmACO2 in regulating corn drought resistance. The amino acid sequence encoded by the gene is shown in SEQ ID NO.3.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] Application of maize gene ZmACO2 in regulating drought resistance of maize, wherein the amino acid sequence encoded by the gene is shown in SEQ ID NO.3;

[0009] The above-mentioned applications are specifically:

[0010] Knocking out or inhibiting the gene encoding the protein shown in SEQ ID NO.3 in corn to enhance the drought resistance of corn;

[0011] In the above application, preferably, the knockout method includes: homologous recombination or CRISPR-Cas9 technology, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein;

[0012] In the above-mentioned application, preferably, the inhibition method includes: antisense RNA technology or interfering RNA technology.

[0013] In the above-mentioned application, preferably, the knockout method uses CRISPR-Cas9 technology, and the gRNA is: GTCGTCCAGGTCCGGTATCTCGG and GCGTCTTGCTGGCGAACTCGAGG.

[0014] In the above application, preferably, the gene is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0015] A method for preparing drought-resistant transgenic corn comprises knocking out or inhibiting the gene encoding the protein shown in SEQ ID NO. 3 in corn.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] The present invention clones and verifies a maize drought resistance gene ZmACO2 in maize, verifies the relationship between maize drought resistance and the expression level of ZmACO2, and verifies that the drought resistance of maize can be improved by reducing its expression level. The difference in drought resistance between transgenic materials and wild-type materials is due to the editing of the gene coding region, which causes the protein level encoded by the gene to decrease. In terms of the mechanism of action, it is speculated that the gene affects the drought resistance of maize by affecting the ethylene synthesis pathway in the plant. Therefore, the present invention provides a new gene resource for improving maize drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of association analysis, expression analysis and haplotype analysis of ZmACO2 in natural maize populations.

[0019] Among them: A is the association analysis of ZmACO2 in natural populations; B and C are the comparative analyses of FPKM (DS) and Survival rate (%) among different haplotypes in natural populations.

[0020] Figure 2 This is a schematic diagram of the phenotype of the ZmACO2 gene knockout material after drought treatment and rehydration at the seedling stage.

[0021] Among them: A is a schematic diagram of the phenotype of corn ZmACO2 gene knockout materials after drought treatment and rehydration at the seedling stage, from left to right: the wild-type family WT as the control, and the two ZmACO2 gene-edited families aco2-cr1 and aco2-cr2; B is a data graph of the survival rate of corn ZmACO2 gene knockout materials after drought resistance and rehydration at the seedling stage, from left to right: the wild-type family WT as the control, and the survival rate of the two ZmACO2 gene-edited families aco2-cr1 and aco2-cr2 after rehydration.

[0022] Figure 3 Schematic diagram of the phenotype of corn ear weight in ZmACO2 gene knockout materials under different drought conditions.

[0023] Among them: A is a schematic diagram of the phenotype of corn ear weight of ZmACO2 gene knockout materials under different drought conditions, from top to bottom: wild-type family WT as control, two ZmACO2 gene editing families aco2-cr1 and aco2-cr2; from left to right: normal conditions (WW), moderate drought (DT1) and severe drought (DT2). B is a data diagram of corn ear weight of ZmACO2 gene knockout materials under different drought treatment conditions. DETAILED DESCRIPTION

[0024] The following embodiments further define the present invention. According to the following description and examples, those skilled in the art can determine the basic features of the present invention, and can make appropriate improvements and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for various uses and conditions. The technical solutions described in the present invention, unless otherwise specified, are conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial channels or published materials.

[0025] Example 1: ZmACO2 cloning

[0026] Total DNA was extracted from leaves of maize inbred line KN5585 plants. Primers ACO20-F and ACO20-R were designed according to the genome reference sequence of maize B73 (National Crop Germplasm Center) (primer names and sequences are shown in Table 1). The ZmACO2 gene was amplified by PCR and resequenced in KN55B5 material to obtain the complete nucleotide sequence of the ZmACO2 gene (SEQ ID NO.1).

[0027] The total DNA of plant leaves was extracted using the CTAB method, and the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, followed by denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s for 34 cycles, and finally extension at 72°C for 5 min.

[0028] Table 1. Primers used in the present invention and their sequences

[0029]

[0030] Example 2: Candidate gene association analysis of ZmACO2

[0031] In order to clarify the relationship between the allelic variation of ZmACO2 and drought resistance in natural maize populations, candidate gene association analysis was performed. The results showed that there was an Indel in the 5'UTR region of ZmACO2 that was significantly associated with drought resistance ( Figure 1 A), divided into two haplotypes, one is Insert 8bp, the other is Deletion 8bp, these two haplotypes have different expression levels ( Figure 1 B) and survival rate ( Figure 1 There are significant differences in C).

[0032] Example 3: Genetic transformation of ZmACO2 in maize and identification of maize seedling drought treatment phenotypes

[0033] The genetic transformation of ZmACO2 gene knockout uses the full-length CDS sequence of ZmACO2 in the transgenic receptor material KN5585 (shown in SEQ ID NO.2) as the applied gene, and designs the gene target according to the website http: / / cbi.hzau.edu.cn / crispr / , and finally obtains two Guide RNAs (GTCGTCCAGGTCCGGTATCTCGG and GCGTCTTGCTGGCGAACTCGAGG, whose reverse complementary sequences can correspond to SEQ ID NO.1 and SEQ ID NO.2), and designs two Target primers using the two Guide RNA sequences, namely Target-1F and Target-2F. The first and second ZmU6 promoters are amplified using pU6F1 and pU6R, pU6F2 and pU6R; Target-1F and gRR0, Target-2F and gRR1 are used to amplify the first and second Target+sgRNA fragments, respectively. Using pU6F1 and gRR0, pU6F2 and gRR1 for overlap, ZmU6-Target1-sgRNA and ZmU6-Target2-sgRNA fragments were amplified respectively, and multi-homologous recombination was carried out on the CPB-ZmUbi-hspCas9 vector (CN116574754A) after HindIII digestion. (Primer sequence is shown in Table 1, and primer ID is 2. Then the obtained clones were sequenced using CRISPR vector detection primers (primer sequence is shown in Table 1, and primer ID is 3) to confirm that the gene was connected to the vector. The correctly cloned plasmid was genetically transformed into the maize inbred line KN5585 by Agrobacterium-mediated genetic transformation (genetic transformation was completed by the Life Science and Technology Center of China Seed Group Co., Ltd.).

[0034] Thus, two maize transformation events with KN5585 as the background were obtained. We used WT material as control and two knockout events aco2-cr1 and aco2-cr2 (the knockout lines contain the sequences shown in SEQ ID NO.4 and SEQ ID NO.5, respectively) to conduct drought experiments at the seedling stage. The maize seeds of the three materials were sown in planting boxes, and 4 maize plants were planted in each box. After sowing, an appropriate amount of water was poured in the pot to allow the seeds to germinate and grow normally. Three weeks after sowing, the maize seedlings were subjected to drought treatment. . Drought treatment was performed until the moisture content of the planting soil dropped to 10-20%, and then rewatering was performed. After one week of rewatering, the survival rate of the plants was investigated (survival rate = surviving plants / total plants). It was found that there was a significant difference in survival rate between the control and the two knockout lines (P = 5.2x 10 -4 ; P = 0.003), the survival rate of the two knockout lines after drought treatment and rewatering was significantly increased compared with the control, indicating that ZmACO2 negatively regulates maize drought resistance ( Figure 2 ).

[0035] Example 4: Identification of ear weight phenotypes of ZmACO2 knockout line materials after drought treatment

[0036] The wild-type material WT was used as the control, and the two knockout lines aco2-cr1 and aco2-cr2 were planted under normal (WW), moderate drought (DT1), and severe drought (DT2) conditions. The corresponding soil moisture contents were (70±5)%, (50±5)%, and (35±5)% of the field water holding capacity, respectively. After maturity, the corn ear traits were investigated. The results showed that under WW conditions, the ear weight of the two knockout lines increased by an average of ~16.5 g (P<1.0x 10 -3 ); Under DT1 condition, the average ear weight of the two knockout lines increased by 13.9 g (P<1.0x 10 -3 ); Under DT2 conditions, the average ear weight of the two knockout lines increased by 15.0 g (P < 1.0 x 10 -3 )( Figure 3 ), which further proves that ZmACO2 plays an important role in regulating maize drought resistance.

Claims

1. Corn Genes ZmACO2 In the application of regulating drought resistance of corn, the amino acid sequence encoded by the gene is shown as SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: Knocking out or inhibiting the gene encoding the protein shown in SEQ ID NO. 3 in corn can enhance the drought resistance of corn.

3. The use according to claim 2, characterized in that: The knockout method includes: homologous recombination or CRISPR-Cas9 technology, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein.

4. The use according to claim 2, characterized in that: The inhibition methods include: antisense RNA technology or interfering RNA technology.

5. The use according to claim 3, characterized in that: The knockout method uses CRISPR-Cas9 technology, and the gRNA is: GTCGTCCAGGTCCGGTATCTCGG and GCGTCTTGCTGGCGAACTCGAGG.

6. The use according to claim 1, characterized in that: The gene is shown as SEQ ID NO.1 or SEQ ID NO.

2.

7. A method for preparing drought-resistant transgenic corn, comprising knocking out or inhibiting the gene encoding the protein shown in SEQ ID NO. 3 in corn.

Images