Peptides with repairing effects and their applications

Abstract

This application relates to the technical field of peptides, specifically a peptide with repairing effects and its applications. The peptide contains the following amino acid sequence: (EVDEQMLNVQNK)n, where n is any natural number from 3 to 10. This peptide significantly enhances keratinocyte activity and proliferation, exhibiting excellent skin repair-promoting effects.

Description

Technical Field

[0001] This application relates to the technical field of peptides, and mainly to a peptide with repairing effects and its applications. Background Technology

[0002] Sea cucumbers (holothurians), belonging to the phylum Echinodermata and class Holothurioider, are marine invertebrates with a long history. Currently, there are over 1250 species of sea cucumbers worldwide, distributed globally, primarily in tropical and temperate regions. Tropical regions include Malaysia, the Philippines, Indonesia, and Fiji, where sea cucumbers are diverse and abundant, accounting for a significant proportion of the world's sea cucumber resources. Temperate regions include China, Japan, South Korea, and Canada.

[0003] Sea cucumbers are distributed in both southern and northern my country. In the north, they are mainly found in Liaoning, Hebei, and Shandong provinces. The northern sea cucumber species are relatively limited, primarily the japonicus (Apostichopus japonicus), which is currently the only edible sea cucumber recorded in the Bohai and Yellow Seas and is considered one of the world's most prized sea cucumbers, often referred to as the "King of Sea Cucumbers." Southern sea cucumbers are more diverse and abundant, including species such as Acaudina molpadioides, Stichopus variegates, Thelenota ananas, Stichopus chloronotus, Actinopyga mauritiana, Holothuria nobilis, and Stichopus horens, distributed in Jiangsu, Fujian, Hainan, and the Xisha Islands.

[0004] Sea cucumber has been regarded as a superior nutritional and health food since ancient times, with effects such as enhancing muscle strength, boosting immunity, and preventing arthritis, anemia, and impotence. The Qing Dynasty classic *Compendium of Materia Medica Supplement* records: "Sea cucumber is warm and nourishing, comparable to ginseng, hence its name; it tastes sweet and salty, nourishes the kidneys, benefits essence, eliminates phlegm, controls urination, strengthens yang, treats impotence, and kills sores and parasites." Protein is an important component of sea cucumber; in dried sea cucumber, the protein content can approach 90%, including a significant amount of collagen. Studies have shown that sea cucumber peptides, as a type of marine bioactive peptide, possess various bioactive functions, such as antioxidant, anti-inflammatory, anti-fatigue, anti-tumor, immunomodulatory, and blood pressure-lowering effects. Currently, sea cucumber peptides on the market are obtained through the capture of sea cucumbers, followed by hydrolysis or enzymatic hydrolysis, and finally purification to acquire specific sea cucumber peptides with specific effects. This technology is currently the mainstream method for obtaining sea cucumber peptides. However, the high price of sea cucumbers themselves makes the extracted sea cucumber peptides even more expensive, and it also leads to the large-scale harvesting of marine life. Furthermore, the extracted sea cucumber peptides / proteins carry the risk of animal-derived immunogenicity. With the development and maturation of synthetic biotechnology, recombinant sea cucumber peptides / proteins have emerged. Currently, the amino acid sequences of sea cucumber peptides / proteins obtained through "reverse processing" of sea cucumber extracts are obtained. Using synthetic biotechnology, recombinant sea cucumber peptides / proteins can be obtained, offering advantages such as scalability and environmental friendliness. Recombinant sea cucumber peptides / proteins have immeasurable application scenarios and effects in the medical aesthetics industry. Summary of the Invention

[0005] This application provides a polypeptide with repair efficacy and its application. The polypeptide has excellent skin repair efficacy and can significantly improve the vitality and proliferation rate of keratinocytes. Based on the significant and excellent skin repair effect of the polypeptide, it will be widely used in the preparation of skin repair agents and / or cosmetics.

[0006] This application involves the following:

[0007] 1. A polypeptide with repairing effects, said polypeptide containing the following amino acid sequence: (EVDEQMLNVQNK) n , where n is 3, 4, 5, 6, 7, 8, 9 or 10.

[0008] 2. The polypeptide according to claim 1, wherein the polypeptide is selected from any one or more of the following:

[0009] The polypeptide with n=3 and an amino acid sequence as shown in SEQ ID NO:2 is: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0010] The polypeptide with n = 4 and an amino acid sequence as shown in SEQ ID NO: 3 is: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

[0011] The polypeptide with n = 5 and an amino acid sequence as shown in SEQ ID NO: 4 is: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNK;

[0012] The polypeptide with n = 6 and an amino acid sequence as shown in SEQ ID NO: 5 is: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK;

[0013] The polypeptide with n = 7 and an amino acid sequence as shown in SEQ ID NO: 6 is: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0014] The polypeptide with n = 8 and an amino acid sequence as shown in SEQ ID NO: 7 is: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0015] The peptide with n=9 and an amino acid sequence as shown in SEQ ID NO:8 is: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0016] The peptide with n = 10 and an amino acid sequence as shown in SEQ ID NO: 9 is: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0017] And a polypeptide whose amino acid sequence is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to any of the sequences in SEQ ID NO:2 to SEQ ID NO:9;

[0018] Preferably, the polypeptide is a polypeptide with an amino acid sequence as shown in SEQ ID NO:5; and / or, a polypeptide with an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:6.

[0019] 3. The polypeptide according to claim 2, wherein the gene sequence encoding the polypeptide with the amino acid sequence shown in SEQ ID NO:5 is shown in SEQ ID NO:10; and / or has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:10.

[0020] 4. The polypeptide according to item 2 or 3, wherein the polypeptide is a natural polypeptide or a recombinant polypeptide;

[0021] Preferably, the polypeptide is sea cucumber collagen.

[0022] 5. The polypeptide according to any one of items 2-4, wherein the method for preparing the recombinant polypeptide comprises: recombining the gene encoding the polypeptide into a basic plasmid to obtain a recombinant plasmid;

[0023] The recombinant plasmid was transduced into the host cell to obtain recombinant cells;

[0024] The recombinant cells were cultured, and the polypeptide was isolated from the culture medium.

[0025] 6. The polypeptide according to claim 5, wherein the basic plasmid is selected from any one or more of the pPIC9K vector, pPIC9 vector, pPIC9K-His vector, and pPIC3.5K vector;

[0026] And / or, the host cell is selected from any one or more of Pichia pastoris GS115, Pichia pastoris MG1003, Pichia pastoris KM71 and Pichia pastoris SMD1168.

[0027] 7. The recombinant cells cultured according to the polypeptide described in item 5 or 6 include seed culture;

[0028] The seed culture medium used is a seed culture medium.

[0029] The seed culture medium is selected from any one or more of BMGY medium, MGY medium, MGYH medium, RD medium, RDH medium, MD medium, MDH medium, SOC medium and YPD medium.

[0030] 8. The recombinant cells cultured according to any one of items 5-7 include fermentation culture;

[0031] The fermentation culture medium used in the fermentation process is a fermentation medium.

[0032] The fermentation medium is selected from any one or more of BSM medium, BMMY medium and BMM medium;

[0033] Preferably, the fermentation medium is BSM medium.

[0034] 9. The polypeptide according to any one of items 5-8, wherein the fermentation culture includes methanol induction;

[0035] Methanol induction was initiated when the wet weight of recombinant cells was 50-150 g / L, 50-75 g / L, 75-150 g / L, or 100-150 g / L.

[0036] 10. According to the polypeptide described in item 9, the pH of the fermentation broth is adjusted to 5.5-7.0 during methanol induction; preferably 6.0-6.5.

[0037] 11. The method for separating the polypeptide from the culture medium according to any one of items 5-10 includes any one or more of solid-liquid separation, chromatography, and dialysis;

[0038] Preferably, the solid-liquid separation method includes any one or more of centrifugation, microfiltration, vacuum filtration, and ultrafiltration;

[0039] Preferably, the chromatography includes any one or more of ion chromatography and hydrophobic chromatography.

[0040] 12. Preparation of any one of the polypeptides described in items 1-11 and its use as a skin repair agent and / or cosmetic.

[0041] 13. A composition having a repairing effect, said composition comprising any one of the polypeptides described in items 1-11.

[0042] 14. A skin repair agent comprising the polypeptide of any one of items 1-11 and / or the composition of item 13.

[0043] Invention Effects

[0044] The sea cucumber collagen (i.e., polypeptide) of this application, especially the polypeptide prepared by synthetic biology technology (gene recombination method), has excellent effects in promoting the proliferation of keratinocytes and improving their cell vitality, thus exhibiting significant and excellent skin repair efficacy; this recombinant sea cucumber collagen (polypeptide) can be applied in the cosmetics and medical aesthetics industries and has broad application prospects. Attached Figure Description

[0045] Figure 1 Plasmid map of the .pPIC9K recombinant plasmid.

[0046] Figure 2 Mass spectrometry results of the .pPIC9K recombinant plasmid.

[0047] Figure 3 Agarose gel electrophoresis results of linearized pPIC9K recombinant plasmid electroporated into Pichia pastoris GS115 host strain; where bands 1 to 6 refer to the 6 parallel samples of nucleic acid electrophoresis.

[0048] Figure 4 Electrophoretic image of peptides expressed by recombinant cells after methanol induction culture on BMMY medium.

[0049] Figure 5 Electrophoretic image of peptides expressed by recombinant cells thawed from cryopreservation and cultured on BMMY medium after methanol induction.

[0050] Figure 6 Chromatogram of the protein after purification using the method of Example 19.

[0051] Figure 7 Chromatogram of the protein after purification using the method of Example 20.

[0052] Figure 8 Cell viability of human keratinocytes co-cultured with polypeptide 4 and different concentrations of sea cucumber collagen. Specific implementation methods

[0053] It should be noted that certain terms are used in the specification and claims to refer to specific components. Those skilled in the art will understand that different terms may be used to refer to the same component. This specification and claims do not distinguish components based on differences in terminology, but rather on differences in their functions.

[0054] As used throughout the specification and claims, the terms "comprising" or "including" are open-ended and should be interpreted as "comprising but not limited to". The subsequent descriptions in the specification are preferred embodiments for carrying out this application; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of this application. The scope of protection of this application shall be determined by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0055] It should be understood that the embodiments of this application described herein include embodiments that are "composed of" and / or "substantially composed of". References to values ​​or parameters of "about" herein include (and describe) variations of that value or parameter itself. For example, a reference to "about X" includes a description of "X".

[0056] As used in this article, references to “not” values ​​or parameters generally refer to and describe “except for” values ​​or parameters.

[0057] As used in this article, the term “approximately XY” has the same meaning as “approximately X to approximately Y”.

[0058] As used herein and in the appended claims, the singular forms “a / an” and “the” include the plural objects unless the context clearly indicates otherwise. It should also be noted that claims may be drafted to exclude any optional elements. Therefore, this statement is intended as a preliminary basis for the use of exclusive terms such as “only” or “merely” in conjunction with the description of the elements of the claim, or for the use of the limitation of “no”.

[0059] As used herein, the term "and / or" in words such as "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, as used herein, the term "and / or" in words such as "A, B and / or C" is intended to include each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0060] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein and refer to a polymeric form of amino acids of any length, which may include coding and non-coding amino acids, chemically or biochemically modified or derived amino acids, and polypeptides having a modified peptide backbone.

[0061] As used herein, “binding” (e.g., Cas13d nuclease binding to RNA or to a target nucleic acid) refers to a non-covalent interaction between macromolecules (e.g., a non-covalent interaction between a protein and guide RNA; a non-covalent interaction between guide RNA and a target nucleic acid). When in a non-covalent interaction state, macromolecules are referred to as “associated,” “interacting,” or “binding” (e.g., when molecule X is said to interact with molecule Y, it means that molecule X binds to molecule Y in a non-covalent manner). Not all components of a binding interaction need to be sequence-specific (e.g., in contact with phosphate residues in the DNA backbone), but some parts of a binding interaction can be sequence-specific.

[0062] The term "amino acid" and its abbreviations, as commonly understood by those skilled in the art, are as follows: Ala is abbreviated as A, Leu as L, Gln as Q, Ser as S, Arg as R, Lys as K, Glu as E, Thr as T, Asn as N, Met as M, Gly as G, Trp as W, Asp as D, Phe as F, His as H, Tyr as Y, Cys as C, Pro as P, Ile as I, and Val as V.

[0063] A polynucleotide or polypeptide shares a certain percentage of "sequence identity" with another polynucleotide or polypeptide. This means that when aligned, the percentages of bases or amino acids are the same, and the two sequences are in the same relative positions. Sequence identity can be determined in many different ways. To determine sequence identity, various methods and computer programs (such as BLAST, T-COFFEE, MUSCLE, MAFFT, Phyre2, etc.) can be used to align sequences.

[0064] As used herein, “complementarity” refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid via conventional Watson-Crick base pairing. The complementarity percentage indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (i.e., Watson-Crick base pairing) with a second nucleic acid (e.g., approximately 5, 6, 7, 8, 9, 10 / 10, representing approximately 50%, 60%, 70%, 80%, 90%, and 100% complementarity, respectively). “Complete complementarity” means that all consecutive residues in the nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in the second nucleic acid sequence. As used herein, “substantially complementary” refers to a degree of complementarity of at least approximately 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of approximately 40, 50, 60, 70, 80, 100, 150, 200, 250 or more nucleotides, or to two nucleic acids hybridizing under stringent conditions.

[0065] The term "hybridization" refers to a reaction in which one or more polynucleotides react to form a complex, which is stabilized by hydrogen bonds between the bases of the nucleotide residues. Hydrogen bonding can occur through Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific mechanism. A sequence that can hybridize with a given sequence is called the "complementary sequence" of that given sequence.

[0066] As used herein, the term "recombinant" means that a specific nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR), and / or ligation steps that produce a construct having a coding or non-coding sequence that can be distinguished from endogenous nucleic acids present in natural systems. "Recombinant nucleic acid," such as a recombinant plasmid, refers to a non-naturally occurring nucleic acid, such as a nucleic acid created through human intervention by artificially combining two separately separated segments of a sequence. This artificial combination is often accomplished by chemical synthesis or by artificially manipulating isolated fragments of nucleic acid. These operations can link nucleic acid fragments with the desired function together to produce the desired functional combination. When recombinant polynucleotides encode polypeptides, the encoded polypeptide sequence can be naturally occurring (wild-type, reference, or standard sequence) or a variant of a naturally occurring polypeptide sequence (e.g., a mutant).

[0067] As used herein, “variant” is defined as a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide but retains the necessary characteristics. A typical variant of a polynucleotide differs from the nucleic acid sequence of another reference polynucleotide. Changes in the nucleic acid sequence of a variant may or may not alter the amino acid sequence of the polypeptide encoded by the reference polynucleotide. Nucleotide changes can result in amino acid substitutions, additions, deletions, fusions, and truncations in the polypeptide encoded by the reference sequence, as described below. A typical variant of a polypeptide differs from another reference polypeptide in its amino acid sequence. Typically, the differences are limited, making the sequences of the reference polypeptide and the variant very similar overall and identical in many regions. The amino acid sequences of the variant and the reference polypeptide can differ by any combination of one or more substitutions, additions, or deletions. The substituted or inserted amino acid residues may or may not be amino acid residues encoded by the genetic code. Variants of polynucleotides or polypeptides may be naturally occurring (such as allelic variants) or may be variants of unknown natural origin. Non-natural variants of polynucleotides and polypeptides can be prepared by mutagenesis, by direct synthesis, and by other recombinant methods known to those skilled in the art.

[0068] A “vector” is a composition of substances containing isolated nucleic acids and capable of delivering said isolated nucleic acids into the cell. Many vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Typically, a suitable vector contains at least one origin of replication functioning in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selective markers. The term “vector” should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc.

[0069] As used herein, the terms “transduction” and “transfection” include methods known in the art for introducing DNA into cells to express a target protein or molecule using infectious agents (such as viruses) or other means. In addition to viral or virus-like reagents, there are chemical-based transfection methods, such as those using calcium phosphate, dendritic polymers, liposomes, or cationic polymers (e.g., DEAE-dextran or polyethyleneimine); non-chemical methods, such as electroporation, cell squeezing, sonoporation, optical transfection, impalefection, protoplast fusion, plasmid delivery, or transposons; particle-based methods, such as those using gene guns, magnetic transfection or magnet-assisted transfection, particle bombardment; and hybridization methods (such as nuclear transfection).

[0070] As used in this article, the terms “transfection,” “transformation,” or “transduction” refer to the process of transferring or introducing exogenous nucleic acids into host cells. “Transfected,” “transformed,” or “transduced” cells are cells that have been transfected, transformed, or transduced with exogenous nucleic acids.

[0071] This application provides a polypeptide with repairing effects, the polypeptide containing the following amino acid sequence: (EVDEQMLNVQNK) n The value of n is 3, 4, 5, 6, 7, 8, 9, or 10. Different values ​​of n result in different polypeptides. The amino acid sequence of the repeating unit of this polypeptide is EVDEQMLNVQNK, SEQ ID NO:1.

[0072] When n is 3, the polypeptide is polypeptide 1, and the amino acid sequence is as shown in SEQ ID NO:2: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:2. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:2; in some embodiments, the amino acid sequence of the polypeptide has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:2.

[0073] When n is 4, the polypeptide is polypeptide 2, and the amino acid sequence is as shown in SEQ ID NO:3: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:3. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:3; in some embodiments, the amino acid sequence of the polypeptide has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:3.

[0074] When n is 5, the polypeptide is polypeptide 3, and the amino acid sequence is as shown in SEQ ID NO:4: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:4. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:4; in some embodiments, the amino acid sequence of the polypeptide has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:4.

[0075] When n is 6, the polypeptide is polypeptide 4, and the amino acid sequence is as shown in SEQ ID NO:5: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:5. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:5; in some embodiments, the amino acid sequence of the polypeptide has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:5.

[0076] When n is 7, the polypeptide is polypeptide 5, and its amino acid sequence is as shown in SEQ ID NO:6: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:6. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:6; in some embodiments, the amino acid sequence of the polypeptide has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:6.

[0077] When n is 8, the polypeptide is polypeptide 6, and its amino acid sequence is as shown in SEQ ID NO:7: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:7. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:7; in some embodiments, the amino acid sequence of the polypeptide has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:7.

[0078] When n is 9, the polypeptide is polypeptide 7, and its amino acid sequence is as shown in SEQ ID NO:8: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQ NK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:8. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:8; in some embodiments, the amino acid sequence of the polypeptide has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:8.

[0079] When n is 10, the polypeptide is polypeptide 8, and its amino acid sequence is as shown in SEQ ID NO:9: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:9. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:9; in some embodiments, the amino acid sequence of the polypeptide has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:9.

[0080] It should be noted that, in this application, the meaning of polypeptide N (N is 3, 4, 5, 6, 7, 8, 9 or 10) is: the polypeptide itself and / or polypeptides having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with the polypeptide amino acid sequence. For example, polypeptide 1 may be a polypeptide with an amino acid sequence as shown in SEQ ID NO:2; or a polypeptide with an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:2; or it may be any mixture thereof.

[0081] In some embodiments, the polypeptide is a single polypeptide; in other embodiments, the polypeptide is a mixture of multiple peptides with different amino acid sequences.

[0082] In some embodiments, the polypeptide is selected from any one or more of polypeptides 1 to 8.

[0083] In some embodiments, the polypeptide is polypeptide 1, polypeptide 2, polypeptide 3, polypeptide 4, polypeptide 5, polypeptide 6, polypeptide 7, or polypeptide 8.

[0084] In some embodiments, the polypeptide is a mixture of polypeptide 1 and polypeptide 4; in some embodiments, the polypeptide is a mixture of polypeptide 2 and polypeptide 4; in some embodiments, the polypeptide is a mixture of polypeptide 3 and polypeptide 4; in some embodiments, the polypeptide is a mixture of polypeptide 5 and polypeptide 4; in some embodiments, the polypeptide is a mixture of polypeptide 2, polypeptide 4 and polypeptide 5; in some embodiments, the polypeptide is a mixture of polypeptide 3, polypeptide 4 and polypeptide 5; in some embodiments, the polypeptide is a mixture of polypeptide 2, polypeptide 3, polypeptide 4 and polypeptide 5.

[0085] In some embodiments, the polypeptide is a natural polypeptide or a recombinant polypeptide.

[0086] In some embodiments, the method for preparing the recombinant polypeptide includes:

[0087] The gene encoding the polypeptide is inserted into the basic plasmid to obtain the recombinant plasmid;

[0088] The recombinant plasmid was transduced into the host cell to obtain recombinant cells;

[0089] The recombinant cells were cultured, and the polypeptide was isolated from the culture medium.

[0090] In some embodiments, the gene sequence encoding the polypeptide 4 is as shown in SEQ ID NO:10 or has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:10; in some embodiments, the gene sequence encoding the polypeptide 4 has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:10.

[0091] As those skilled in the art will understand, a basic plasmid is an expression vector for a target gene (i.e., a gene encoding a polypeptide). In this application, there are no excessive restrictions on the selection of the basic plasmid, as long as it can carry, transduce, and express the target gene into the host cell. For example, the basic plasmid can be a pPIC9K vector, a pPIC9 vector, a pPIC9K-His vector, a pPIC3.5K vector; or any combination of two or more of the above-listed vectors.

[0092] In this application, it is understood that there are no excessive restrictions on the selection of host cells. For example, the host cells may be Pichia pastoris GS115, Pichia pastoris MG1003, Pichia pastoris SMD1168, Pichia pastoris KM71; or any combination of two or more of the above-listed.

[0093] In some implementations, methanol induction is also included during fermentation culture.

[0094] In some embodiments, methanol induction is initiated when the wet weight of recombinant cells is within the range of 50-150 g / L, 50-75 g / L, 75-150 g / L, 100-150 g / L, or any wet weight within the range of 50-150 g / L. In some embodiments, methanol induction is initiated when the wet weight of recombinant cells is within the range of 50 g / L, 60 g / L, 75 g / L, 80 g / L, 90 g / L, 100 g / L, 110 g / L, 125 g / L, 130 g / L, 140 g / L, 150 g / L, or any wet weight within the range of 50-150 g / L. In some preferred embodiments, methanol induction is initiated when the wet weight of recombinant cells is 100 g / L, 125 g / L, or 150 g / L.

[0095] During fermentation, methanol induction was performed when the recombinant cell wet weight was 50 g / L. After fermentation, the peptide content in the fermentation broth was 6.12 g / L. Further methanol induction when the recombinant cell wet weight was 75 g / L increased the peptide content to 8.23 ​​g / L. When the recombinant cell wet weight was 100-125 g / L, methanol induction resulted in a peptide content of at least 11.84-12.15 g / L, and even as high as 13 g / L. Therefore, controlling the timing of methanol induction can significantly increase the final peptide yield.

[0096] In some embodiments, the pH of the fermentation broth is adjusted to 5.5-6.0, 6.0-6.5, or 6.5-7.0 during methanol induction; in other embodiments, the pH of the fermentation broth is adjusted to 5.5, 6.0, 6.5, or 7.0 during methanol induction. In some preferred embodiments, the pH of the fermentation broth is adjusted to 6.0 or 6.5 during methanol induction. Under these conditions, after fermentation, the polypeptide content in the fermentation broth is at least as high as 10.65-11.24 g / L.

[0097] The peptide obtained in this application was used to culture keratinocytes. The results showed that the cell viability of keratinocytes increased from 100% to 105.33-135.04% compared to the negative control; thus, the peptide of this application can significantly improve keratinocyte viability. Immediately after adding the peptide of this application to keratinocytes, the proliferation rate of keratinocytes reached 116%-131%; after 24 hours of culture, the proliferation rate of keratinocytes further increased to 155%-208%; and after 48 hours of culture, the proliferation rate of keratinocytes significantly increased to 631%-891%. Therefore, the peptide of this application can exert its significant and excellent repair efficacy by significantly improving the cell viability and cell proliferation capacity of keratinocytes.

[0098] This application provides the use of the polypeptide in the preparation of skin repair agents and / or cosmetics.

[0099] This application provides a composition with repairing effects, the composition comprising the polypeptide.

[0100] This application also provides a skin repair agent comprising the polypeptide and / or the composition.

[0101] It should be understood that the skin repair agent can be formulated as a topical preparation; exemplary forms include any one or more of liquids, lotions, creams, powders, blocks, and oils. In some embodiments, the skin repair agent further includes excipients; the excipients include any one or more of the group consisting of excipients, antibacterial agents, anti-inflammatory agents, antioxidants, propellants, whitening agents, thickeners, suspending agents, surfactants, pH adjusters, complexing agents, pearlescent agents, astringents, and fragrances. Example

[0102] Specific embodiments of the present application will now be described in more detail with reference to the accompanying drawings. While specific embodiments of the present application are shown in the drawings, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0103] Example 1. Polypeptide

[0104] This embodiment provides the following 8 polypeptides, namely polypeptide 1 to polypeptide 8, whose amino acid sequences are shown below:

[0105] Polypeptide 1, amino acid sequence as shown in SEQ ID NO:2: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0106] Polypeptide 2, amino acid sequence as shown in SEQ ID NO:3: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0107] Polypeptide 3, the amino acid sequence of which is shown in SEQ ID NO:4: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNK;

[0108] Peptide 4, the amino acid sequence of which is shown in SEQ ID NO:5: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK;

[0109] Peptide 5, amino acid sequence as shown in SEQ ID NO:6: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

[0110] Peptide 6, amino acid sequence as shown in SEQ ID NO:7: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

[0111] Peptide 7, the amino acid sequence of which is shown in SEQ ID NO:8: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

[0112] Peptide 8, the amino acid sequence of which is shown in SEQ ID NO:9: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

[0113] Example 2. Synthesis and Identification of Recombinant Plasmids

[0114] 1. Synthesis of recombinant plasmids

[0115] This embodiment describes the construction of a recombinant plasmid expressing polypeptide 4; wherein the amino acid sequence of polypeptide 4 is shown in SEQ ID NO:5:

[0116] EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0117] The gene sequence encoding polypeptide 4 is shown in SEQ ID NO:10:

[0118] GAGGTCCAGAACAGATGTTAAACGTTCAAAATAAAGAAGTGGATGAGCAAATGTTGAATGTACAGAACAAGGAGGTGGACGAGCAGATGCTTAACGTTCAGAATAAAGAAGTTGATGAACAAATGCTAAACGTCCAAAATAAGGAAGTAGACGAGCAGATGCTGAACGTACAAAACAAGGAAGTCGATGAGCAGATGCTCAATGTGCAAAATAAATGA.

[0119] The recombinant plasmid was synthesized by Jiangsu GenScript Biotech Co., Ltd. The base plasmid vector was pPIC9K (purchased from Thermo Fisher Scientific; geneJET plasmid miniprep kit, K0503), containing a secretion signal peptide. The gene sequence encoding polypeptide 5 was directly ligated to the secretion signal peptide to obtain the recombinant plasmid, named pPIC9K recombinant plasmid. The plasmid map of the recombinant plasmid is shown below. Figure 1 As shown.

[0120] 2. Sequencing and identification of recombinant plasmids

[0121] The recombinant plasmid extraction and sequencing methods are as follows:

[0122] 1) Inoculate the pPIC9K recombinant plasmid into LB liquid medium and incubate overnight at 37°C and 220 rpm. Pour the bacterial culture into a 1.5 mL centrifuge tube and centrifuge at 12000 rpm for 1 min. Remove the supernatant medium and repeat the above steps 3 to 4 times to enrich all the bacterial cells into the centrifuge tube.

[0123] 2) The pPIC9K recombinant plasmid was recovered according to the instructions of the high-purity plasmid mini-extraction kit (Thermo Fisher Scientific, geneJET plasmid mini-extraction kit, K0503).

[0124] 3) Take 60 μL of the prepared 60℃ ddH2O, centrifuge at 12000 rpm for 2.5 min, collect the pPIC9K recombinant plasmid in a 1.5 mL centrifuge tube, and perform DNA sequencing on the pPIC9K recombinant plasmid. The plasmid sequencing was performed by Shanghai Sangon Biotech Co., Ltd. using mass spectrometry. The detection results are shown in [link to results]. Figure 2 The results showed that the target protein sequence was completely correct after plasmid synthesis.

[0125] Example 3. Construction and screening of recombinant cells

[0126] 1. Linearization of plasmids

[0127] 1) Prepare the vector enzyme digestion system according to Table 1.

[0128] Table 1. Vector Enzyme Digestion System

[0129]

[0130] 2) Incubate overnight at 37℃ using enzyme digestion;

[0131] 3) Agarose gel electrophoresis was performed, with undigested plasmids used as a control;

[0132] 4) After successful enzyme digestion, inactivate at 65℃ for 20 minutes.

[0133] 2. Linearized plasmid purification and recovery

[0134] 1) Configure the vector purification system according to Table 2.

[0135] Table 2. Carrier Purification System

[0136]

[0137] 2) Let stand at -20℃ for at least 35 minutes;

[0138] 3) Centrifuge at 4℃ and 12000rpm for 15min, discard the supernatant, and you can observe a white precipitate on the wall at this time;

[0139] 4) Add 400 μL of pre-cooled 80% ethanol to resuspend the precipitate;

[0140] 5) Centrifuge at 4℃ and 12000rpm for 10min, discard the supernatant, and dry after opening the lid;

[0141] 6) Add 10 μL of ddH2O to dissolve the precipitate.

[0142] 3. Preparation of GS115 competent cells

[0143] 1) Streak the bacterial culture onto a YPD plate and incubate at 30 degrees Celsius for 3-5 days until single colonies grow;

[0144] 2) Pick a single clone and place it into 10 mL LYPD medium (125 mL Erlenmeyer flask), and incubate at 30 degrees Celsius and 300 rpm for 1-2 days;

[0145] 3) Transfer to 100ml LYPD culture medium, initial bacterial concentration is OD600 = 0.2, incubate at 30 degrees Celsius and 300 rpm for 1-2 days until OD600 reaches 0.2. 600 =1.3-1.5; (Note: If the OD value cannot be determined, transfer to different concentrations for culture);

[0146] 4) Collect the bacterial culture by centrifugation at 4℃ for 5 minutes at 1500g, and resuspend the bacterial culture in 250mL of pre-cooled sterile water to clean the bacterial culture;

[0147] 5) Collect the bacterial culture by centrifuging at 1500g and 4℃ for 5min (adjust the rate of decrease to greater than 6), add 10mL of pre-cooled 1M sorbitol to resuspend the bacterial culture, and gently pipette during resuspension.

[0148] 6) Collect the inoculum by centrifuging at 1500g for 5 minutes at 4℃ (adjust the rate of decrease to greater than 6). Add 300uL of pre-cooled 1M sorbitol to resuspend the inoculum. Gently pipette during resuscitation. The final volume of the inoculum should be about 500uL (in actual operation, the final volume of the inoculum should be about 700uL). Dispense into 100uL tubes and place them on ice for use in electroporation.

[0149] 4. Electroconversion

[0150] 1) Take 80 μL of competent cells, add 6 μg of linearized pPIC9K, mix well, and transfer to a pre-cooled 0.2 cm electroporation cuvette;

[0151] 2) Place on ice for 5 minutes;

[0152] 3) Perform electric shock according to the yeast electric shock parameters (1.5kV, 25uF, 200Ω);

[0153] 4) Immediately add 2ml of pre-cooled 1M sorbitol + HEPES (10ml 1M sorbitol + 100ul 2M HEPES, pH=8.0), and transfer to a 2ml sterile centrifuge tube;

[0154] 5) Incubate at 30℃ for 1-2 hours;

[0155] 6) Dilute 5, 10 and 100 times respectively and spread 300ul / plate onto a 15cm YPD plate containing 100mg / l Zeocin. Incubate at 30℃ until clones grow.

[0156] 5. Screening for positive clones

[0157] 1) Streak the clones grown on the MD plate onto a 0.5 mg / mL G418 plate using a 10 μL pipette tip and incubate at 30°C for 3-5 days;

[0158] 2) Select clones with good growth and streak them onto 2 mg / mL and 4 mg / mL G418 plates simultaneously, and incubate at 30°C for 3-5 days;

[0159] 3) Try to select 5 clones that grow well on 4 mg / mL G418 plates for induction expression. If the growth is poor on 4 mg / mL plates, select clones on 2 mg / mL plates.

[0160] Example 4. Screening and preservation of pPIC9K recombinant cells

[0161] Several recombinants (i.e., pPIC9K recombinant cells) from YPD plates containing G418 at concentrations of 4 g / L and 6 g / L were selected and inoculated into 30 mL of BMGY liquid medium. The cells were cultured at 29°C and 220 rpm for 24 h to prepare the fermentation broth. The fermentation broth was then placed in sterile centrifuge tubes and centrifuged at 5000 rpm for 5 min. The precipitate was collected and washed twice with sterile water to obtain the bacterial cells. The bacterial cells were resuspended in 30 mL of BMGY liquid medium and cultured at 220 rpm at 29°C for 4 days. Methanol was added every 24 h for induction, with each addition reaching a final concentration of 1% (v / v). After induction, the supernatant was collected by centrifugation at 6000 rpm for 5 min and analyzed by electrophoresis. The results are shown below. Figure 4 As shown, well-expressed recombinants were selected for glycerol culture preservation under the following conditions: -80℃ refrigerator for later use.

[0162] The components and proportions of the BMGY liquid culture medium are as follows: yeast extract 10.0 g / L, peptone 20.0 g / L, glycerol 10.0 ml / L, dipotassium hydrogen phosphate 1.8 g / L, potassium dihydrogen phosphate 7.08 g / L, 10*YNB 100 ml / L, and 500*B 2 ml / L. B is a standard reagent purchased from Biosharp, catalog number BS905.

[0163] The components and proportions of BMMY medium are as follows: yeast extract 10.0 g / L, peptone 20.0 g / L, methanol 10.0 ml / L, dipotassium hydrogen phosphate 1.8 g / L, potassium dihydrogen phosphate 7.08 g / L, 10*YNB 100 ml / L, and 500*B 2 ml / L. Here, B represents biotin, a standard reagent.

[0164] Example 5. Shake-flask culture and optimization of pPIC9K recombinant cells

[0165] The BMMY medium used in this embodiment is an optimized version. The components and ratios of the optimized BMMY medium in this embodiment are as follows: yeast extract 10.0 g / L, peptone 20.0 g / L, methanol 10.0 ml / L, dipotassium hydrogen phosphate 1.08 g / L, potassium dihydrogen phosphate 4.25 g / L, ammonium sulfate 10 g / L, 10*YNB 25 ml / L, and 500*B 2 ml / L.

[0166] The optimized cultivation method is as follows:

[0167] 1) Inoculate 0.1 ml of the glycerol bacteria obtained in Example 5 into 50 ml of liquid BMGY medium and incubate at 29°C and 220 rpm for 48 h;

[0168] 2) Take 5 ml of a primary shake flask and inoculate it into BMMY medium. Induce methanol induction every 24 hours, adding methanol each time to a final concentration of 1% (v / v). After induction for 96 hours, separate the solid and liquid phases and perform electrophoresis. The electrophoresis results are as follows: Figure 5 As shown.

[0169] Examples 6-9. Optimization of fermenter culture medium

[0170] Unless otherwise specified, the BMGY culture medium formulation and proportions in the following examples are as follows: yeast extract 10.0 g / L, peptone 20.0 g / L, glycerol 10.0 ml / L, dipotassium hydrogen phosphate 1.8 g / L, potassium dihydrogen phosphate 7.08 g / L, 10*YNB 25 ml / L, 500*B 25 ml / L.

[0171] Unless otherwise specified, the components and proportions of PTM1 are as follows: copper sulfate pentahydrate 6.0 g / L, sodium iodide 0.08 g / L, manganese sulfate monohydrate 3.0 g / L, sodium molybdate dihydrate 0.2 g / L, boric acid 0.02 g / L, cobalt chloride 0.5 g / L, ferrous sulfate 65 g / L, biotin 0.2 g / L, and sulfuric acid 5 ml / L.

[0172] Example 6

[0173] The seed culture medium was BMGY medium, and the fermentation medium was BSM medium: potassium sulfate 18.20 g / L, magnesium sulfate heptahydrate 14.90 g / L, calcium sulfate dihydrate 0.93 g / L, potassium hydroxide 4.13 g / L, 85% phosphate 26.70 ml / L, ammonium sulfate 10.00 g / L, glycerol 40.00 g / L, bubbly antagonist 0.10 g / L, PTM1 4.35 ml / L.

[0174] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 100g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). At the same time, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged. After fermentation, the protein content was determined using the Coomassie Brilliant Blue method (Bradford method).

[0175] Example 7

[0176] The seed culture medium was BMGY medium, and the fermentation medium was BSM medium: potassium sulfate 12.74 g / L, magnesium sulfate heptahydrate 10.43 g / L, calcium sulfate dihydrate 0.65 g / L, potassium hydroxide 2.89 g / L, 85% phosphate 18.69 ml / L, ammonium sulfate 7.00 g / L, glycerol 40.00 g / L, bubbly antagonist 0.10 g / L, PTM1 4.35 ml / L.

[0177] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 100g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). At the same time, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged. After fermentation, the protein content was determined using the Coomassie Brilliant Blue method (Bradford method).

[0178] Example 8

[0179] The seed culture medium was BMGY medium, and the fermentation medium was BSM medium: potassium sulfate 9.10 g / L, magnesium sulfate heptahydrate 7.45 g / L, calcium sulfate dihydrate 0.47 g / L, potassium hydroxide 2.07 g / L, 85% phosphate 13.4 ml / L, ammonium sulfate 5.00 g / L, glycerol 40.00 g / L, bubbly antagonist 0.10 g / L, PTM1 4.35 ml / L.

[0180] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 100g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). At the same time, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged. After fermentation, the protein content was determined using the Coomassie Brilliant Blue method (Bradford method).

[0181] Example 9

[0182] The seed culture medium was BMGY medium, and the fermentation medium was BSM medium: potassium sulfate 5.46 g / L, magnesium sulfate heptahydrate 4.47 g / L, calcium sulfate dihydrate 0.28 g / L, potassium hydroxide 1.24 g / L, 85% phosphate 8.01 ml / L, ammonium sulfate 3.00 g / L, glycerol 40.00 g / L, bubbly antagonist 0.10 g / L, PTM1 4.35 ml / L.

[0183] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 100g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). At the same time, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged. After fermentation, the protein content was determined using the Coomassie Brilliant Blue method (Bradford method).

[0184] After fermentation, the protein expression levels in Examples 6, 7, 8, and 9 were 5.83 g / L, 7.18 g / L, 10.68 g / L, and 7.56 g / L, respectively (see Table 3). Example 8 showed the highest protein expression. Therefore, the culture medium for the 10L fermenter was determined to be: potassium sulfate 9.10 g / L, magnesium sulfate heptahydrate 7.45 g / L, calcium sulfate dihydrate 0.47 g / L, potassium hydroxide 2.07 g / L, 85% phosphate 13.4 ml / L, ammonium sulfate 5.00 g / L, glycerol 40.00 g / L, foaming agent 0.10 g / L, and PTM 14.35 ml / L.

[0185] Table 3. Protein expression levels in Examples 6, 7, 8, and 9.

[0186]

[0187] Examples 10-14. Optimization of wet weight at the start of methanol induction

[0188] The following examples primarily focus on optimizing the wet weight of cells before methanol induction. Unless otherwise specified, the components and proportions of the fermentation medium in the following examples are the same as in Example 9, specifically: potassium sulfate 9.10 g / L, magnesium sulfate heptahydrate 7.45 g / L, calcium sulfate dihydrate 0.47 g / L, potassium hydroxide 2.07 g / L, 85% phosphate 13.4 ml / L, ammonium sulfate 5.00 g / L, glycerol 40.00 g / L, bubbly antagonist 0.10 g / L, and PTM1 4.35 ml / L.

[0189] The components and proportions of PTM1 are as follows: copper sulfate pentahydrate 6.0 g / L, sodium iodide 0.08 g / L, manganese sulfate monohydrate 3.0 g / L, sodium molybdate dihydrate 0.2 g / L, boric acid 0.02 g / L, cobalt chloride 0.5 g / L, ferrous sulfate 65 g / L, biotin 0.2 g / L, and sulfuric acid 5 ml / L.

[0190] Example 10

[0191] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 50g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). At the same time, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged, and the protein content was measured after fermentation.

[0192] Example 11

[0193] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection at a volume of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After glycerol was depleted (when dissolved oxygen rose), feeding began, with controlled addition of 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 75g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). Simultaneously, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. Induction was performed for 30 hours before the fermentation was terminated. Protein content was measured after fermentation.

[0194] Example 12

[0195] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection at a volume of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring speed was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding began, with controlled addition of 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 100g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). Simultaneously, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. Induction was performed for 30 hours before the fermentation was completed, and the protein content was measured.

[0196] Example 13

[0197] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 125g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). At the same time, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged, and the protein content was measured after fermentation.

[0198] Example 14

[0199] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 150g / L, starvation was initiated for 2 hours, followed by methanol induction (1L methanol plus 12ml PTM1). At the same time, 35% (m / v) sorbitol was added, with a sorbitol to methanol volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged, and the protein content was measured after fermentation.

[0200] After fermentation, the protein expression levels of Examples 10 to 14 were measured, as shown in Table 4. Example 13 showed the highest protein expression. Therefore, methanol induction was initiated when the wet weight of the pPIC9K recombinant cells reached 125 g / L.

[0201] Table 4. Protein expression concentrations after methanol induction at different wet weights of pPIC9K recombinant cells.

[0202]

[0203]

[0204] Examples 15-18. Optimization of pH at the start of methanol induction

[0205] The following examples primarily focus on optimizing the pH of the fermentation broth before methanol induction. Unless otherwise specified, the components and proportions of the fermentation medium in the following examples are the same as in Example 9, specifically: potassium sulfate 9.10 g / L, magnesium sulfate heptahydrate 7.45 g / L, calcium sulfate dihydrate 0.47 g / L, potassium hydroxide 2.07 g / L, 85% phosphoric acid 13.4 ml / L, ammonium sulfate 5.00 g / L, glycerol 40.00 g / L, bubbly antagonist 0.10 g / L, and PTM1 4.35 ml / L.

[0206] The components and proportions of PTM1 are as follows: copper sulfate pentahydrate 6.0 g / L, sodium iodide 0.08 g / L, manganese sulfate monohydrate 3.0 g / L, sodium molybdate dihydrate 0.2 g / L, boric acid 0.02 g / L, cobalt chloride 0.5 g / L, ferrous sulfate 65 g / L, biotin 0.2 g / L, and sulfuric acid 5 ml / L.

[0207] Example 15

[0208] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 125g / L, starvation was initiated. During the starvation phase, the pH was adjusted to 5.5. After 2 hours of starvation, methanol (1L methanol plus 12ml PTM1) was added for induction, while simultaneously adding 35% (m / v) sorbitol at a volume ratio of 1:5. The fermentation was induction for 30 hours, and the fermenter was discharged. The protein content was measured after fermentation.

[0209] Example 16

[0210] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 125g / L, starvation was initiated. During the starvation phase, the pH was adjusted to 6.0. After starvation for 2 hours, methanol (1L methanol plus 12ml PTM1) was added for induction, while simultaneously adding 35% (m / v) sorbitol at a volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged, and the protein content was measured after fermentation.

[0211] Example 17

[0212] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 125g / L, starvation was initiated. During the starvation phase, the pH was adjusted to 6.5. After 2 hours of starvation, methanol (1L methanol plus 12ml PTM1) was added for induction, while simultaneously adding 35% (m / v) sorbitol at a volume ratio of 1:5. After 30 hours of induction, the fermenter was discharged, and the protein content was measured after fermentation.

[0213] Example 18

[0214] A 10L fermenter (Zhenjiang Dongfang) was selected. After autoclaving, the volume was 5L. Ammonia water was used to adjust the pH to 5.0, and the air flow rate was adjusted to 10L / min. Inoculation was performed under flame protection with an inoculation amount of 10 vol.%. Throughout the fermentation process, the pH was maintained at 5.0, and the stirring was controlled between 100-800 rpm to maintain dissolved oxygen above 30 vol.%. After the glycerol was depleted (when dissolved oxygen rose), feeding was started by adding 50% (m / v) glycerol (1L glycerol plus 12ml PTM1). When the cell wet weight reached 125g / L, starvation was initiated. During the starvation phase, the pH was adjusted to 7.0. After starvation for 2 hours, methanol (1L methanol plus 12ml PTM1) was added for induction, while simultaneously adding 35% (m / v) sorbitol at a volume ratio of 1:5. The fermentation was induction for 30 hours, and the fermenter was discharged. The protein content was measured after fermentation.

[0215] After fermentation, the protein expression levels of Examples 15 to 18 were measured, as shown in Table 5. Example 17 showed the highest protein expression. Therefore, methanol induction was initiated when the pH of the fermentation broth was adjusted to 6.5. However, protein degradation occurred at pH 6.5, while no degradation occurred at pH 6.0, and the protein expression level was also higher.

[0216] Table 5 Protein expression concentrations after methanol induction at different pH levels

[0217]

[0218] Examples 19 and 20. Protein purification

[0219] Fermentation was carried out using the method of Example 16, and the proteins in the fermentation broth were purified after fermentation.

[0220] Example 19

[0221] Fermentation was performed using the method described in Example 16, and the proteins in the fermentation broth were purified after fermentation. The purification method was as follows:

[0222] 1) Separate the fermentation broth into solid and liquid components at 6000 rpm for 10 min at 4℃.

[0223] 2) Enzyme inactivation: Take the supernatant and inactivate the enzyme in a 65℃ (60-70℃ is generally acceptable) water bath for 20 minutes (10-60 minutes is generally acceptable).

[0224] 3) Ultrafiltration desalination: Shandong Bona organic membrane experimental machine was selected, and the molecular cutoff of the organic membrane was selected to be 2000 Daltons for ultrafiltration desalination, and the conductivity was controlled to be below 1 mS / cm.

[0225] 4) Membrane filtration: Add sodium dihydrogen phosphate to the above liquid to make the conductivity 2 mS / cm, then adjust the pH to 6 with sodium hydroxide, and finally filter with a 0.45 μm membrane.

[0226] 5) Ion chromatography: Jiangsu Hanbang protein purification instrument was selected, and Hedera Q FF pre-packed column was used. Buffer A: 20mM sodium dihydrogen phosphate, pH adjusted to 6.0 with sodium hydroxide, filtered through a 0.45µm membrane; Buffer B: 20mM sodium dihydrogen phosphate, pH adjusted to 6.0 with sodium hydroxide, filtered through a 0.45µm membrane. The column was equilibrated with 10 CV using buffer A, with a loading rate of 2ml / min. After loading, the column was washed with buffer A until conductivity and pH stabilized. Then, further impurities were removed using 5% buffer B and 95% buffer A. The target protein was eluted with 5-20% buffer B, followed by 5 CV of elution with 100% buffer B, then 10 CV of water wash, 3 CV of 0.5M sodium hydroxide wash, and another 10 CV of water wash. Finally, the column was stored in 20 vol.% ethanol.

[0227] 6) After ultrafiltration to remove salt, freeze-dry the protein.

[0228] 7) Methods for determining protein purity:

[0229] Mobile phase A: 1000 ml of purified water containing 0.75‰ TFA; Preparation method: 500 ml solution + 500 ml ultrapure water + 750 μL TFA, sonicate for 10 min to remove air bubbles.

[0230] Mobile phase B: 1000 ml of 0.75‰ TFA in acetonitrile; preparation method: 500 ml solution + 500 ml acetonitrile + 750 μL TFA, sonicate for 10 min to remove air bubbles.

[0231] Chromatographic conditions: Shim-pack Scepter C4: 4.6 × 250 mm, 5 μm. Flow rate: 1.0 ml / min; column temperature: 35℃; UV detector, detection wavelength: 220 nm; injection: 50 μL; gradient conditions as shown in Table 6. The chromatogram of the product is shown below. Figure 6 As shown.

[0232] Table 6 Chromatographic Elution Procedures

[0233]

[0234] Example 20

[0235] Fermentation was performed using the method described in Example 16, and the proteins in the fermentation broth were purified after fermentation. The purification method was as follows:

[0236] 1) Separate the fermentation broth into solid and liquid components at 6000 rpm for 10 min at 4℃.

[0237] 2) Enzyme inactivation: Take the supernatant and inactivate the enzyme in a 65℃ (65-70℃ is generally acceptable) water bath for 20 minutes (10-60 minutes is generally acceptable).

[0238] 3) Membrane filtration: Add sodium dihydrogen phosphate to the above liquid to make the conductivity 200 mS / cm, then adjust the pH to 6 with sodium hydroxide, and finally filter with a 0.45 μm membrane.

[0239] 4) Hydrophobic chromatography: Jiangsu Hanbang protein purification instrument was selected, and the chromatography column was Hedera Butyl 4FF. Buffer A: 20mM sodium dihydrogen phosphate, 2M ammonium sulfate, pH adjusted to 6.0 with sodium hydroxide, filtered through a 0.45µm membrane; Buffer B: 20mM sodium dihydrogen phosphate, pH adjusted to 6.0 with sodium hydroxide, filtered through a 0.45µm membrane. The column was equilibrated with 10 CV using buffer A, with a loading rate of 2ml / min. After loading, the column was washed with buffer A until conductivity and pH stabilized. Then, further impurities were removed using 5% buffer B and 95% buffer A. The target protein was eluted with 25-30% buffer B, followed by 5 CV of elution with 100% buffer B, then 10 CV of water wash, 3 CV of 0.5M sodium hydroxide wash, and another 10 CV of water wash. Finally, the column was stored in 20% ethanol.

[0240] 5) Ultrafiltration desalination: The eluted sample is subjected to ultrafiltration desalination with an organic membrane selective molecular cutoff of 2000 Daltons, and finally replaced with phosphate buffer (20mM sodium dihydrogen phosphate, pH adjusted to 6.0 with sodium hydroxide, 0.45um membrane filtration).

[0241] 6) Ion Chromatography: Jiangsu Hanbang protein purification instrument was selected, and Hedera Q FF pre-packed column was chosen. Buffer A: 20mM sodium dihydrogen phosphate, pH adjusted to 6.0 with sodium hydroxide, filtered through a 0.45µm membrane; Buffer B: 20mM sodium dihydrogen phosphate, pH adjusted to 6.0 with sodium hydroxide, filtered through a 0.45µm membrane. The column was equilibrated with 10 CV using buffer A, with a loading rate of 2ml / min. After loading, the column was washed with buffer A until conductivity and pH stabilized. Then, further impurities were removed using 5% buffer B and 95% buffer A. The target protein was eluted with 5-20% buffer B, followed by 5 CV of elution with 100% buffer B, then 10 CV of water wash, 3 CV of 0.5M sodium hydroxide wash, and another 10 CV of water wash. Finally, the column was stored in 20 vol.% ethanol.

[0242] 7) After ultrafiltration to remove salt, freeze-dry the protein.

[0243] 8) The purity determination method is the same as in Example 19.

[0244] The chromatogram of the product is as follows Figure 7 As shown.

[0245] Protein effect verification

[0246] Sea cucumber collagen exhibits a good effect in promoting cell proliferation, indicating that it has repairing properties. However, to determine the cell proliferation effect, it is essential to ensure a reasonable drug concentration (i.e., the concentration of sea cucumber collagen added) at a certain cell concentration to guarantee the accuracy of subsequent cell proliferation measurements. Therefore, the following experiment was designed:

[0247] 1. Cell viability assay

[0248] 1.1 Cell viability assay: Human keratinocytes in the logarithmic growth phase were collected, and after adjusting the cell density, they were seeded into 96-well plates, with 100 μl of culture medium in each well. After culturing in a CO2 cell incubator for 24 h, the culture medium was aspirated, and the cells were washed twice with PBS buffer. Then, the cells were grouped and administered drugs according to the sample preparation concentrations in Table 7.

[0249] Table 7. Cell viability sample concentration design table

[0250]

[0251] 1.2 Grouping details are shown in Table 8.

[0252] Table 8 Grouping and Dosage Concentration

[0253]

[0254] 1.3 Model Drug Administration: After drug administration, cells were placed in a CO2 cell culture incubator for 24 hours, followed by MTT assay to measure absorbance (OD) at 490 nm. Cell viability was calculated. Blank wells contained only cell culture medium. Three replicates were prepared for each sample, and the mean and SD values ​​were calculated. Specific results are shown in Table 9. Figure 8 Among them, the cell viability is relatively high when the concentration of sea cucumber collagen added is in the range of 0.156%-2.5%. Even with a low concentration of sea cucumber collagen added, such as 0.156%-0.313%, high cell viability can still be achieved.

[0255] Cell viability (%) = OD490 of sample group / OD490 of negative control group × 100%.

[0256] Table 9 shows the cell viability of sea cucumber collagen obtained from Example 19 after adding different concentrations to the cell samples and culturing the cells for 24 hours.

[0257]

[0258]

[0259] from Figure 8 As shown in Table 9, after adjusting to a certain cell density, three samples with cell viability ≥90% were re-coated into three 96-well plates and added to the same group at three concentrations of sea cucumber collagen (i.e., three concentrations of sea cucumber collagen added, as shown in Table 10, which are (%, m / v): 0.300%, 0.110% and 0.050%).

[0260] 1.4 Cell proliferation detection

[0261] After obtaining the concentration of sea cucumber protein that resulted in higher cell viability, the effect of sea cucumber collagen on cell proliferation was further verified.

[0262] After adjusting to a certain cell density, three 96-well plates were re-seeded, and three sample concentrations with cell viability ≥90% from the same group were added. After addition, the plates were incubated for 0h, 24h, and 48h. MTT assays were performed simultaneously, and the relative cell proliferation rates at 0h, 24h, and 48h were calculated. Specific results are shown in Table 10. Comparison between the sample groups and the positive control revealed that both 0.300% and 0.110% of the drug promoted cell proliferation; however, the effect was superior at 0.300%.

[0263] Relative cell proliferation rate (%) = OD490 of sample group / OD490 of negative control group × 100%.

[0264] Table 10 shows the relative cell proliferation rates after 0, 24, and 48 hours of cell culture following the addition of different amounts of sea cucumber collagen in Example 19.

[0265]

[0266] The description in this disclosure is provided for illustrative and descriptive purposes only and is not intended to be exhaustive or to limit the disclosure to its forms. Many modifications and variations will be apparent to those skilled in the art. The embodiments were chosen and described in order to better illustrate the principles and practical application of this disclosure and to enable those skilled in the art to understand this disclosure and to design various embodiments with various modifications suitable for a particular purpose.

Claims

1. A polypeptide with repairing effects, the amino acid sequence of which is shown in SEQ ID NO:5: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

2. The polypeptide according to claim 1, wherein the gene sequence encoding the polypeptide with the amino acid sequence shown in SEQ ID NO:5 is shown in SEQ ID NO:

10.

3. The polypeptide according to claim 1, wherein the polypeptide is a natural polypeptide or a recombinant polypeptide.

4. The polypeptide according to claim 1, wherein the polypeptide is sea cucumber collagen.

5. The polypeptide according to claim 3, wherein the method for preparing the recombinant polypeptide comprises: The gene encoding the polypeptide is recombined into the basic plasmid to obtain the recombinant plasmid; The recombinant plasmid was transduced into the host cell to obtain recombinant cells; The recombinant cells were cultured, and the polypeptide was isolated from the culture medium.

6. The polypeptide according to claim 5, wherein the basic plasmid is selected from any one or more of the pPIC9K vector, pPIC9 vector, pPIC9K-His vector, and pPIC3.5K vector; And / or, the host cell is selected from any one or more of Pichia pastoris GS115, Pichia pastoris MG1003, Pichia pastoris KM71 and Pichia pastoris SMD1168.

7. The polypeptide according to claim 6, wherein the cultured recombinant cells comprise seed culture; The seed culture medium used is a seed culture medium. The seed culture medium is selected from any one or more of BMGY medium, MGY medium, MGYH medium, RD medium, RDH medium, MD medium, MDH medium, SOC medium and YPD medium; And / or, culturing recombinant cells includes fermentation culture; The fermentation culture medium used in the fermentation process is a fermentation medium. The fermentation medium is selected from any one or more of BSM medium, BMMY medium and BMM medium.

8. The polypeptide according to claim 7, wherein the fermentation culture includes methanol induction; Methanol induction was initiated when the wet weight of recombinant cells was 50-150 g / L, 50-75 g / L, 75-150 g / L, or 100-150 g / L. And / or, adjust the pH of the fermentation broth to 5.5-7.0 during methanol induction; And / or, the method for separating the polypeptide from the culture medium is selected from any one or more of solid-liquid separation, chromatography, and dialysis.

9. The polypeptide according to claim 8, wherein the solid-liquid separation method is selected from any one or more of centrifugation, microfiltration, vacuum filtration, and ultrafiltration.

10. The polypeptide according to claim 8, wherein the chromatography is selected from any one or more of ion chromatography and hydrophobic chromatography.

11. The preparation of the polypeptide according to any one of claims 1-10 and its use as a skin repair agent and / or cosmetic.

12. A composition having a repairing effect, said composition comprising the polypeptide according to any one of claims 1-10.

13. A skin repair agent comprising the polypeptide of any one of claims 1-10 and / or the composition of claim 12.

Images