A group B Streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology

Through isothermal amplification and CRSPR/Cas12a technology, accurate Group B Streptococcus detection is achieved within 40 minutes, solving the problems of long detection time and low sensitivity in the prior art, and providing an instant, fast and user-friendly detection solution.

CN119286625BActive Publication Date: 2025-08-22NANJING FIRST HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411109412.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-13
Publication Date
2025-08-22
Estimated Expiration
2044-08-13

AI Technical Summary

Technical Problem

The existing detection technology cannot achieve accurate nucleic acid testing of Group B streptococci in a short period of time, and the existing rapid detection methods have problems with low sensitivity and high false positive rate, which cannot meet the immediate detection needs during labor.

Method used

A microfluidic chip device based on isothermal amplification and CRSPR/Cas12a technology is adopted, combining gravity microfluidic chip design and nucleic acid isothermal amplification detection system to achieve fast and accurate Group B streptococci detection.

Benefits of technology

nucleic acid amplification and fluorescence detection are completed within 40 minutes, reducing aerosol contamination, providing user-friendly immediate and rapid detection, and avoiding the risk of antibiotic abuse and neonatal infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286625B_ABST
    Figure CN119286625B_ABST
Patent Text Reader

Abstract

The present invention discloses a kind of group B streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology, it is characterised in that it includes microfluidic chip and supporting instant detection device, wherein: microfluidic chip includes two detection liquid channels, two detection liquid channels eventually intersect in detection chamber, and two detection liquid channels are respectively supplied to isothermal amplification system and CRSPR / Cas12a system detection liquid droplet; Instant detection device includes upper cover, housing, chip slot, amber filter plate, LED light source, light path channel, observation window, PTC heating plate, battery box and switch. The present invention can complete nucleic acid amplification and fluorescence detection within 40 minutes, and the closed microfluidic chip reaction system can effectively reduce aerosol generation; The present invention is more convenient for obstetrics and individuals to carry out instant rapid detection of group B streptococcus compared to large molecular detection device.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of detection, in particular to the field of group B streptococcus detection, and specifically is a group B streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology. Background Art

[0002] Group B Streptococcus (GBS) is a major pathogen causing neonatal infections. GBS colonization of the digestive and genitourinary tracts of pregnant women is a major risk factor for early-onset GBS disease (GBS-EOD) in newborns. Approximately 50% of pregnant women with GBS colonization will transmit the bacteria to their newborns. Without prophylactic intravenous antibiotics during delivery, 1% to 2% of newborns will develop GBS-EOD.

[0003] The current "Expert Consensus on Prevention of Perinatal Group B Streptococcal Disease (China)" recommends GBS screening for all pregnant women between 35 and 37 weeks of gestation. Without a vaginal speculum, a swab is taken from the lower third of the vagina. The same swab is then used to obtain a sample from the rectum through the rectal sphincter. Pregnant women with a positive GBS screening test, a history of neonatal GBS, or GBS bacteriuria during the current pregnancy are recommended to receive prophylactic antibiotics for GBS after premature rupture of membranes or entry into labor.

[0004] Clinically, GBS screening results are still not returned at the time of labor. The consensus recommends that if at least one of the following high-risk factors is present: inevitable preterm birth, premature rupture of membranes, rupture of membranes ≥18 hours, or intrapartum fever ≥38°C, broad-spectrum antibiotics that cover GBS are recommended to effectively prevent the occurrence of GBS-EOD. If a more efficient and rapid GBS detection kit is available to better address the issue of GBS results not returning at the time of labor, GBS colonization status can be determined in a very short time. This will help clinical practice prevent GBS infection in newborns while avoiding the overuse of antibiotics, which can lead to toxic side effects, the emergence of drug-resistant pathogens, superinfection or cross-infection, and low immunity.

[0005] Existing detection technologies, such as live bacterial culture, PCR, and qPCR, are time-consuming and unsuitable for on-site detection of Group B Streptococcus. Existing rapid detection methods, such as antigen testing, suffer from inaccuracy, low sensitivity, and high false-positive rates. Overall, existing detection methods are unable to simultaneously provide accurate nucleic acid detection and a user-friendly testing process.

[0006] Current guidelines recommend that standard GBS screening procedures involve placing the swab in non-nutrient transport medium after sampling and sending it for testing within 24 hours. Laboratories should enrich the swab in selective enrichment broth for 18–24 hours, then inoculate it onto blood agar. GBS can be identified using techniques such as latex agglutination, chromogenic culture, DNA probes, or nucleic acid amplification testing (NAAT). Enrichment culture can improve GBS detection rates, but the testing time is long and it is only used for screening at 35–37 weeks of gestation. Single-line NAAT is shorter (1–2 hours) and can be used for immediate testing during labor in women who have not undergone GBS screening. However, the lack of enrichment culture reduces sensitivity, resulting in a 7%–10% failure rate. Furthermore, in clinical practice, especially during premature labor, a 1–2 hour testing time cannot guarantee results before fetal delivery. Furthermore, studies have shown that many infants with severe GBS infection are born prematurely before the recommended screening time. Therefore, a more efficient and rapid GBS detection kit is needed to better deal with GBS results that have not been returned at the time of delivery, to clarify the GBS colonization situation in a very short time, to help clinicians prevent neonatal GBS infection while avoiding the abuse of antibiotics, and to avoid toxic and side effects caused by the abuse of antibiotics, the emergence of drug-resistant pathogens, superinfection or cross-infection, and low immunity.

[0007] Currently available clinical methods for detecting Group B Streptococcus within 15 minutes include immunochromatographic assays. This kit is limited to detecting Group B Streptococcus in human vaginal secretion samples. Consensus recommends that vaginal and anal swabs be obtained for GBS testing. GBS extracts need to be improved to more universal secretion extracts capable of extracting GBS from both anal and vaginal secretions. Furthermore, immunochromatographic assays lack amplification, and their lower limit of detection is 10^5 CFU / ml, resulting in poor sensitivity and a high risk of false negatives. Clinically, pregnant women with high-risk factors are currently given antibiotics for infection prevention. Therefore, the sensitivity of the test results should be emphasized in the development of test kits to avoid missed GBS screening in newborns. Summary of the Invention

[0008] In response to the problems existing in the background technology, the present invention proposes an instant detection device for Group B Streptococcus based on isothermal amplification and CRSPR / Cas12a technology.

[0009] Technical solution:

[0010] A group B Streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology, comprising a microfluidic chip and a matching instant detection device, wherein:

[0011] The microfluidic chip includes two detection liquid channels, which eventually intersect in the detection chamber. The two detection liquid channels are used for the isothermal amplification system and the CRSPR / Cas12a system detection liquid to droplet respectively;

[0012] The instant detection device includes an upper cover, an outer shell, a chip slot, an amber filter plate, an LED light source, an optical path channel, an observation window, a PTC heating plate, a battery box and a switch. The outer shell is provided with a chip slot for embedding a microfluidic chip; the PTC heating plate is arranged on the back of the chip slot and is connected to the battery box through a switch for heating the chip slot; in the outer shell, an amber filter plate and an observation window are stacked in sequence on the front of the chip slot to form a horizontal observation channel, and the color change of the microfluidic chip behind the amber filter plate is observed through the observation window; in the outer shell, an optical path channel is provided at the bottom of the observation channel, and an LED light source is arranged in the optical path channel, and the LED light source is connected to the battery box through a switch to provide brightness for the observation channel.

[0013] Preferably, the instant detection device further comprises a lens, and the LED light source provides brightness to the observation channel through the lens.

[0014] Preferably, the upper cover of the instant detection device is a rectangular parallelepiped when combined with the outer shell, the longitudinal section of the outer shell is L-shaped, and the longitudinal section of the upper cover is rectangular.

[0015] Preferably, a vent is provided on the detection cavity of the microfluidic chip.

[0016] Preferably, the two detection liquid channels and the detection cavity of the microfluidic chip are formed by cutting grooves on the bottom plate and pasting an optical-grade bottom sealing film on the grooved surface.

[0017] Preferably, the base plate is made of PMMA material.

[0018] Preferably, the grooving method is light-curing printing or integral casting.

[0019] Preferably, the first channel of the microfluidic chip includes a first inlet, a first flow channel, a first reaction chamber, and a third flow channel connected in sequence; the second channel of the microfluidic chip includes a second inlet, a second flow channel, a second reaction chamber, and a fourth flow channel connected in sequence.

[0020] Preferably, the depths of the first inlet, the second inlet, the first reaction chamber, the second reaction chamber and the detection chamber are 2 mm, 2 mm, 2 mm, 2 mm and 2.5 mm respectively; the width and depth of the first flow channel and the second flow channel are 0.6 mm; the width and depth of the third flow channel and the fourth flow channel are 0.4 mm; wherein the bottom surfaces of the first reaction chamber and the second reaction chamber are both 4.2 mm in side length and 7.5 mm in area. 2The detection cavity is a regular triangle with a cavity height of 2mm and a volume of 15μL; the detection cavity is a cylinder with a diameter of 4mm and a height of 2.5mm, with a total volume of 30μL.

[0021] Specifically:

[0022] The CRSPR / Cas12a system detection solution is obtained by mixing 1 volume of AsCas12a, 1 volume of crRNA, 4 volumes of 10× reaction buffer, 5 volumes of ssDNA / ssRNA reporter, 1 volume of recombinant RNase inhibitor, and 14 volumes of enzyme-free water;

[0023] The sequence of crRNA is: TTTCACCAGCTGTATTAGAAGTACATG;

[0024] The isothermal amplification system is obtained by mixing 1 volume of forward primer, 1 volume of reverse primer, 3.4 volume of template, enzyme-free water, 8.85 volume of dehydration reaction buffer, and 0.75 volume of magnesium acetate.

[0025] The sequence of the forward primer is: ATATGATGTATCTATCTGGAACTCTAGTGGC

[0026] The sequence of the reverse primer is: ATGATTTACCACTTGTGGAGTTGTCACTTGA.

[0027] Beneficial effects of the present invention

[0028] 1. The present invention can complete nucleic acid amplification and fluorescence detection within 40 minutes, and the closed microfluidic chip reaction system can effectively reduce aerosol generation;

[0029] 2. Compared with large molecular detection devices, the present invention is more convenient for obstetricians and individuals to conduct real-time rapid detection of group B streptococci. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : The overall view of the separation of the instant detection device and the microfluidic chip without the upper cover, where Figure 1 A. Front view of the instant detection device without the cover installed. Figure 1 B is a front oblique view of the separated instant detection device and microfluidic chip without the cover installed. Figure 1 C. Front oblique view of the microfluidic chip embedded in the instant detection device without the cover installed. Figure 1 D. Rear oblique view of the instant detection device;

[0031] Figure 2 : Overall view of the instant detection device with the upper cover installed, wherein, Figure 2A is a side view of the upper cover and the instant detection device separated. Figure 2 B. An oblique view of the upper cover and the instant detection device separated. Figure 2 C vertical posterior oblique view, Figure 2 D upright posterior oblique view;

[0032] Figure 3 : Schematic diagram of the overall microfluidic chip, where: Figure 3 A is an oblique view of the microfluidic chip without the optical-grade bottom film attached. Figure 3 B is the front oblique view of the microfluidic chip after adhering the optical grade bottom film. Figure 3 C is an oblique view of the microfluidic chip after adhering the optical-grade bottom film;

[0033] Figure 4 : Schematic diagram of the operation of the microfluidic chip after the sample liquid is dropped into it;

[0034] Figure 5 :Comparison of the size of the microfluidic chip and the coin;

[0035] Figure 6 : Comparison chart of negative and positive results after chip heating reaction;

[0036] In the accompanying drawings, 1- microfluidic chip includes 101- first inlet, 102- second inlet, 103- first flow channel, 104- second flow channel, 105- third flow channel, 106- fourth flow channel, 107- first reaction chamber, 108- second reaction chamber, 109- detection chamber, 110- vent, 111- optical grade bottom film;

[0037] 2-Instant detection device includes, 201-upper cover, 202-housing, 203-chip slot, 204-amber filter plate, 205-LED light source, 206-light path channel, 207-lens, 208-observation window, 209-PTC heating plate, 210-battery box, 211-switch; DETAILED DESCRIPTION

[0038] The present invention will be further described below with reference to the embodiments, but the scope of protection of the present invention is not limited thereto:

[0039] Combine Figure 3 The microfluidic chip 1 is 33 mm long, 20 mm wide and about 3.5 mm thick;

[0040] The microfluidic chip 1 is composed of a 0.45 mm optical grade sealing plate and a 3 mm polymethyl methacrylate (PMMA) plate;

[0041] The microfluidic chip 1 is made of PMMA material and can be manufactured by methods such as photocuring printing and integral casting;

[0042] The microfluidic chip 1 is provided with flow channels and chambers, which are composed of a first inlet 101, a second inlet 102, a first flow channel 103, a second flow channel 104, a third flow channel 105, a fourth flow channel 106, a first reaction chamber 107, a second reaction chamber 108, and a detection chamber 109;

[0043] The depths of the first inlet 101, the second inlet 102, the first reaction chamber 107, the second reaction chamber 108 and the detection chamber 109 are 2 mm, 2 mm, 2 mm, 2 mm and 2.5 mm respectively; the width and depth of the first flow channel 103 and the second flow channel 104 are 0.6 mm, and the width and depth of the third flow channel 105 and the fourth flow channel 106 are 0.4 mm; wherein, the bottom surfaces of the first reaction chamber 107 and the second reaction chamber 108 are both 4.2 mm in length and 7.5 mm in area. 2 The detection cavity 109 is a cylinder with a diameter of 4 mm and a height of 2.5 mm, and a total volume of 30 μL.

[0044] The upper ends of the first flow channel 103 and the second flow channel 104 are respectively connected to the first inlet 101 and the second inlet 1022, forming an "L" shape as a whole;

[0045] The upper portions of the first reaction chamber 107 and the second reaction chamber 108 are connected to and communicate with the upper ends of the first flow channel 103 and the second flow channel 104;

[0046] The upper portions of the third flow channel 105 and the fourth flow channel 106 are connected to and communicate with the upper portions of the first reaction chamber 107 and the second reaction chamber 108, and then extend parallel to the ground of the microfluidic chip, and finally converge in a "Y" shape with mirror symmetry;

[0047] The detection cavity 109 intersects with the converging third flow channel 105 and the fourth flow channel 106;

[0048] The vent 110 is located on the outer edge of the detection cavity 109 near the microfluidic chip, has a diameter of 0.4 mm, and leads to the bottom surface of the chip, that is, the side without the bottom film, and communicates with the outside.

[0049] Combine Figure 1 and Figure 2 The instant detection device 2 is about 7.3 cm long, 4.0 cm wide and 5.0 cm high, and consists of an upper cover 201, a battery box 210, a PTC heating plate 209, a chip slot 203, a shell 202, an amber filter plate 204, an LED light source 205 and a lens 207;

[0050] The upper cover 201 is a rectangular parallelepiped with a length of 73 mm, a width of 20.5 mm, and a height of 17.5 mm. At the lower edge, i.e., the side in contact with the housing 202, there is a protrusion with a thickness of 1.5 mm, a length of 20.5 mm, and a height of 2 mm, to facilitate assembly with the housing 202.

[0051] After the upper cover 201 and the outer shell 202 are combined, the space formed in the middle can accommodate the circuit, the PTC heating plate 209 and the microfluidic chip 1.

[0052] The battery box 210 contains three 1.5V batteries to supply power to the PTC heating plate 209 with a rated voltage of 4.5V.

[0053] The PTC heating plate 209 is 30 mm long, 30 mm wide, and 6 mm high. The rated voltage of the heating plate is 4.5 V, the rated power is 1 W, and the temperature can be maintained at 37°C.

[0054] The amber filter plate 204 is 5 mm thick, filters a wavelength of 470 nm, is 33.3 mm long, and 4 mm wide, and is precisely embedded in the observation window of the housing 202;

[0055] The LED light source 205 emits blue light with a wavelength of 460-470 nm, a rated voltage of 4.5 V, and a rated power of 1 W.

[0056] The lens 207 has a diameter of 21.7 mm, a focal length of 3 mm, a working distance of 3 mm, and a numerical aperture of 0.7 mm. The lens focuses the blue light emitted by the LED light source 205 into the chip slot 203;

[0057] The switch 211 is located on the upper rear side of the battery box 210 and is a three-position switch. Position 1 is to close the entire circuit, position 2 is to turn on the PTC heating plate 209 , and position 3 is to turn on the LED light source 205 .

[0058] The technical features of the present invention are as follows:

[0059] 1. Design of gravity microfluidic chip

[0060] (1) The design of the two reaction chambers, the integrated flow path inside the chip, and the "L"-shaped arrangement of the reaction chambers enable the chip to carry out the reaction process with the help of gravity;

[0061] (2) The fully enclosed microfluidic chip design can avoid aerosol contamination;

[0062] (3) The chip is small and can meet the requirements of high speed;

[0063] 2. Combination of gravity microfluidic chip and nucleic acid isothermal amplification detection system

[0064] (1) Combination of isothermal amplification system and CRISPR / Cas detection system;

[0065] (2) Gravity microfluidics combined with isothermal amplification and CRISPR / Cas detection systems can better empower each other;

[0066] 3. Design of supporting testing equipment

[0067] (1) The arrangement of the internal parts of the entire instant detection device and the relative orientation of the internal parts;

[0068] (2) The optical pathway is embedded inside the device so that the LED light beam is more concentrated in the detection cavity during fluorescence excitation.

[0069] Specific operation process:

[0070] During the specific implementation process, an optical-grade bottom film 111 is used to seal the microfluidic chip 1 for standby use. The sample taken is subjected to preliminary processing (the preliminary processing may include DNA extraction and pathogen nucleic acid release, etc.). The treated sample is mixed with the isothermal amplification system, and the isothermal amplification system and the CRISPR / Cas12a system are dripped into the first inlet 101 and the second inlet 102 respectively with a 15 μL dropper. Use a bottom film (or a sealing material such as transparent tape) to seal the first inlet 101 and the second inlet 102. Open the upper cover 201 of the instant detection device 2, and place the sealed microfluidic chip 1 into the chip slot 203. The chip slot 203 is the same size as the microfluidic chip 1, which can just accommodate the microfluidic chip 1, and make the back of the chip fit tightly with the PTC heating plate 209. Close the upper cover 201. It can be observed through the observation window 208 and the amber filter 204 that, driven by gravity, the liquid at the first inlet 101 and the second inlet 102 flows through the first flow channel 103 and the second flow channel 104, and finally enters the first reaction chamber 107 and the second reaction chamber 108 respectively.

[0071] Turn on switch 211, by first gear, dial second gear, turn on PTC heating plate 209, wait for temperature to rise to setting temperature (according to the different isothermal amplification techniques used, can be adjusted), DNA target is first carried out isothermal amplification in the first reaction chamber 107, Cas12a and crRNA can be combined in advance in the second reaction chamber 108 and obtain optimal trans-cutting temperature preheating in advance.After waiting for 15-40 minutes (according to the different isothermal amplification techniques used, can be adjusted), instant detection device 2 is rotated 90 ° clockwise (the face where amber filter plate 204 is the device front).At this time, chip is in vertical state, and under gravity drive, the reaction system in the first reaction chamber 107, the second reaction chamber 108 passes through the third flow channel 105, the fourth flow channel 106 respectively, and is finally mixed in detection chamber 109.CRISPR / Cas12a proceeds to carry out 5 minutes trans-cutting determination, and Cas12a, under the guidance of crRNA, the amplified product of specific identification, carries out trans-cutting to surrounding fluorescent reporter molecules, and then produces fluorescent signal.

[0072] After the reaction is complete, switch 211 is moved from position 2 to position 3, turning off the PTC heater 209 and turning on the LED light source 205. The LED light source 205 emits blue light in the 460-470 nm wavelength range. This light travels through optical channel 206, through lens 207, and is focused into the detection chamber 109, where it excites the fluorescent reporter molecules and produces a fluorescent signal. The final reaction results can be observed with the naked eye through observation window 208 and amber filter plate 204. Specific embodiment 1:

[0074] The total volume of the CRISPR / Cas12a reaction system was 15 μL, including 100 nM AsCas12a, 200 nM crRNA, 1000 nM DNA reporter, 1 × NEB r3.1 buffer, and 2 U / μL RNase inhibitor;

[0075] The isothermal amplification system (also known as the recombinase polymerase amplification (RPA) reaction system) had a total volume of 15 μL, including 1 μL of forward primer (Sangon Biotech), 1 μL of reverse primer (Sangon Biotech), 3.4 μL of template and enzyme-free water (purchased from New England Biolabs, Inc.), 8.85 μL of dehydration reaction buffer (purchased from TwistDx), and 0.75 μL of magnesium acetate (purchased from TwistDx).

[0076] Table 1 CRISPR / Cas12a detection system

[0077]

[0078] The ssDNA reporter is: FAM-CCCCC-BHQ1-3';

[0079] The ssRNA reporter is: FAM-UUUUU-BHQ1-3';

[0080] The present invention selects the sequence on the cfb gene encoding the CAMP factor of group B Streptococcus as the target, and we designed a pair of RPA primers and crRNA for guiding Cas12a.

[0081] The gene sequences involved are as follows:

[0082] GBS cfb gene target sequence:

[0083] ACCAACATGGGCCCTGTAAATTAAAAATACTGCAGTAGAAGTGATTTTAGTTTTAAAGGAGGAAATTTATTATGAACGTTACACATATGATGTATCTATCTGGAACTCTAGTGGCTGGTGCATTGTTATTTTCACCAGCTGTATTAGAAGTACATGCTGATCAAGTGACAACTCCACAAGTGGTAAATCATGTAAATAGTAATAATCAAGCCCAGCAAATGGCTCAAAAGCTTGATCAAGA

[0084] RPA forward primer: ATATGATGTATCTATCTGGAACTCTAGTGGC

[0085] RPA reverse primer: ATGATTTACCACTTGTGGAGTTGTCACTTGA

[0086] crRNA sequence: TTTCACCAGCTGTATTAGAAGTACATG

[0087] Use the gravity microfluidic chip and supporting detection equipment of the present invention, as well as the specific operation process of the invention.

[0088] Add the sample and the configured RPA reaction reagent to the first inlet 101, add the CRISPR / Cas12a reaction reagent to the second inlet 102, and then use a piece of optical-grade bottom film 111 to seal the first inlet 101 and the second inlet 102. When the microfluidic chip 1 is in a horizontal state, the two reagents will flow into the first reaction chamber 107 and the second reaction chamber 108 respectively under the action of gravity. Under incubation at 37°C, the synthetic cfb gene sequence with a concentration of 100 copies / μL in the first reaction chamber 107 is RPA amplified. In the second reaction chamber 108, Cas12a and crRNA will be pre-combined and pre-heated to the optimal trans-cutting temperature. After rotating the chip 90°, the chip is in a vertical state. Driven by gravity, the two reagents will be mixed in the detection chamber 109, and CRISPR / Cas12a will continue to perform trans-cutting determination for 5 minutes. The specific process is as follows Figure 4 .

[0089] The PTC heating plate 209 can reach 37°C in about 5 minutes, and the temperature remains relatively stable within 30 minutes, fluctuating at 37±0.5°C. Under the stimulation of the LED light source 205, the naked eye can clearly distinguish between positive and negative results. The final reaction result can be observed by the naked eye through the orange filter. The result is as follows Figure 6 .

[0090] Compared with the prior art, the present invention has obvious advantages:

[0091] 1. Existing detection technologies, such as live bacterial culture, PCR, and qPCR, are time-consuming and cannot meet the requirements for on-site detection of Group B Streptococcus. This invention combines isothermal amplification technology with CRISPR / Cas12a to produce results within 40 minutes.

[0092] 2. Existing rapid detection methods, such as antigen detection, have problems such as inaccuracy, insensitivity, and high false positive rates. This invention, by combining isothermal amplification technology with CRISPR / Cas12a, can achieve a sensitive detection accuracy of 1 copy;

[0093] 3. Existing detection methods generally fail to achieve both accurate nucleic acid detection and a user-friendly testing process. The instant detection device provided by the present invention is compact and portable. Operation requires only mixing the treated sample solution with the reaction system and adding it to the chip inlet. After constant temperature incubation, invert the solution and observe the results after thorough mixing.

[0094] In summary: Pregnant women often give birth within 1-2 hours, and the entire process from sampling to GBS test results can be completed at the bedside in as little as 40 minutes. This is simple and acceptable, providing a crucial window for clinicians to confirm a diagnosis, select treatment, and choose the delivery method.

[0095] The specific embodiments described herein are merely illustrative of the spirit of the present invention. Persons skilled in the art may make various modifications, additions, or substitutions to the described specific embodiments without departing from the spirit of the present invention or exceeding the scope of the appended claims.

Claims

1. A device for detecting Group B Streptococcus based on isothermal amplification and CRSPR / Cas12a technology, characterized in that It includes a microfluidic chip (1) and a matching instant detection device (2), wherein: The microfluidic chip (1) includes two detection liquid channels, which eventually intersect at a detection chamber (109), and the two detection liquid channels are respectively used for the isothermal amplification system and the CRSPR / Cas12a system detection liquid to be dropped in; the first channel of the microfluidic chip (1) includes a first inlet (101), a first flow channel (103), a first reaction chamber (107), and a third flow channel (105) connected in sequence; the second channel of the microfluidic chip (1) includes a second inlet (102), a second flow channel (104), a second reaction chamber (108), and a fourth flow channel (109) connected in sequence. (106); the depths of the first inlet (101), the second inlet (102), the first reaction chamber (107), the second reaction chamber (108) and the detection chamber (109) are 2 mm, 2 mm, 2 mm, 2 mm and 2.5 mm respectively; the width and depth of the first flow channel (103) and the second flow channel (104) are 0.6 mm; the width and depth of the third flow channel (105) and the fourth flow channel (106) are 0.4 mm; wherein the bottom surfaces of the first reaction chamber (107) and the second reaction chamber (108) are both 4.2 mm in side length and 7.5 mm in area. 2 The detection cavity (109) is a regular triangle with a cavity height of 2 mm and a volume of 15 μL; the detection cavity (109) is a cylinder with a diameter of 4 mm and a height of 2.5 mm, with a total volume of 30 μL; The instant detection device (2) comprises an upper cover (201), a housing (202), a chip slot (203), an amber filter plate (204), an LED light source (205), an optical path channel (206), an observation window (208), a PTC heating plate (209), a battery box (210) and a switch (211), wherein the housing (202) is provided with a chip slot (203) for embedding the microfluidic chip (1); the PTC heating plate (209) is provided on the back of the chip slot (203) and is connected to the battery box (210) via the switch (211) for heating the chip slot (203); in the housing (202), the amber filter plate (204) and the observation window (208) are sequentially stacked on the front of the chip slot (203) to form a horizontal observation channel , observing the discoloration of the microfluidic chip (1) behind the amber filter plate (204) through the observation window (208); in the housing (202), an optical path channel (206) is set at the bottom of the observation channel, and an LED light source (205) is set in the optical path channel (206), and the LED light source (205) is connected to the battery box (210) through the switch (211) to provide brightness for the observation channel; the instant detection device (2) also includes a lens (207), and the LED light source (205) provides brightness for the observation channel through the lens (207); the upper cover (201) of the instant detection device (2) is a rectangular parallelepiped after being combined with the housing (202), the longitudinal section of the housing (202) is L-shaped, and the longitudinal section of the upper cover (201) is rectangular.

2. The device according to claim 1, characterized in that A vent (110) is provided on the detection cavity (109) of the microfluidic chip (1).

3. The device according to claim 1, characterized in that The two detection liquid channels and the detection cavity (109) of the microfluidic chip (1) are formed by cutting grooves on the bottom plate and pasting an optical-grade bottom sealing film (111) on the grooved surface.

4. The device according to claim 3, characterized in that The base plate is made of PMMA.

5. The device according to claim 3, characterized in that The grooving method is light-curing printing or integral casting.

6. The device according to claim 1, characterized in that: The CRSPR / Cas12a system detection solution is obtained by mixing 1 volume of AsCas12a, 1 volume of crRNA, 4 volumes of 10× reaction buffer, 5 volumes of ssDNA / ssRNA reporter, 1 volume of recombinant RNase inhibitor, and 14 volumes of enzyme-free water; The sequence of crRNA is: TTTCACCAGCTGTATTAGAAGTACATG; The isothermal amplification system is obtained by mixing 1 volume of forward primer, 1 volume of reverse primer, 3.4 volume of template, enzyme-free water, 8.85 volume of dehydration reaction buffer, and 0.75 volume of magnesium acetate. The sequence of the forward primer is: ATATGATGTATCTATCTGGAACTCTAGTGGC The sequence of the reverse primer is: ATGATTTACCACTTGTGGAGTTGTCACTTGA.

Citation Information

Patent Citations

  • Primer group for detecting group B streptococcus, primer solution comprising primer group and kit as well as application thereof

    CN108531630A

  • Nucleic acid detection instrument and nucleic acid detection method

    CN115838624A