A Lepista sordida L-2 strain with uniform mushroom fruiting and an efficient cultivation technique

By accumulating and selecting the new strain L-2 with thick shank and thin shank and its efficient cultivation technology, the problems of untidy mushroom production and fragile shank and the blister of the shank and the blister of the shank are solved, and high-yield and high-quality shank and shank are achieved, which enhances its commercial value.

CN119286660BActive Publication Date: 2025-07-29达州市农业科学研究院
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411480862.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-23
Publication Date
2025-07-29
Estimated Expiration
2044-10-23

AI Technical Summary

Technical Problem

In the production of flower-faced fragrant mushrooms, there are problems such as fragile caps, irregular mushroom production, unobstructed trends, and difficult to manage, which affects its yield and quality and hinders the commercialization process.

Method used

Through domestication and breeding, the new strain L-2 with thick shanks, neat and obvious tides of mushrooms are obtained. Combined with specific cultivation techniques, including pre-wet fermentation of culture materials, seeding, soil covering, low-temperature culture and mushroom cultivation management, the growth environment such as temperature, humidity and light are optimized to ensure mycelium growth and fruiting body development.

Benefits of technology

The cultivation effect of the flower-faced fragrant mushroom with non-fragrant caps, neat mushroom production, obvious trend, high nutritional value, high yield and strong disease resistance has been achieved, and the commercialization potential of the product has been enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286660B_ABST
    Figure CN119286660B_ABST
Patent Text Reader

Abstract

The present invention relates to a strain of Lepista sordida and its high-efficiency cultivation technology. The classified name of the Lepista sordida of the present invention is Lepista sordida, the strain number is Lepista sordida L-2, the tentative variety name is "Daxiangmo No. 2", which is preserved in the China Center for Type Culture Collection (CCTCC), the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, the preservation number is CCTCC NO: M20241717, and the preservation date is July 31, 2024. The said strain has a thick stalk and a thin cap, neat fruiting, obvious tidal order, high nutritional value, high yield, and strong disease resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a pleurotus ostreatus strain and an efficient cultivation technology thereof. Background Art

[0002] The Lepistasordida mushroom, a member of the family Trichoderma and genus Trichoderma, is a rare, grass-decomposing edible fungus with great potential for development. Its fruiting bodies are characterized by their vibrant color, delicious flavor, rich nutrition, and high medicinal value, making them highly sought after by consumers.

[0003] However, in production, there are technical problems with the brittle cap of the fruiting body of the violet-faced mushroom, poor transportation resistance, irregular fruiting, unclear tide times, and difficulty in management. These problems may affect its yield, quality, and commercialization process. The present invention is based on solving the problems of unclear tide times, irregular fruiting, and brittle caps of the fruiting body of the violet-faced mushroom. The breeding team carried out a survey on wild resources of the violet-faced mushroom, collected mushrooms, and domesticated new strains in Dazhou City. By collecting wild violet-faced mushroom fruiting bodies and systematically studying the biological characteristics, culture characteristics, and cultivation techniques of the isolated strains, a new violet-faced mushroom strain 'L-2' with a thick stalk and a thin cap, neat fruiting, and clear tide times was obtained through systematic domestication and selection. Summary of the invention

[0004] The invention aims to provide a flower-faced shimeji mushroom with thick stem and thin cap, neat fruiting, obvious tide times, unbreakable cap, high nutritional value, high yield and strong disease resistance.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] On the one hand, the present invention provides a strain of Lepista sordida, characterized in that: the classification name of the strain is Lepista sordida, the strain number is Lepista sordida L-2, the tentative variety name is "Daxiang Mushroom No. 2", and it is preserved in the China Center for Type Culture Collection (CCTCC), the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, the preservation number is CCTCCNO: M20241717, and the preservation date is July 31, 2024.

[0007] Furthermore, the ITS sequence of the L-2 strain of the Oleander is shown in SEQ ID NO.3.

[0008] Furthermore, the spores of the L-2 strain of the leucanthemum are colorless, transparent, smooth in surface, cylindrical or oval in shape, and have a size of (4.0-5.0) um×(5.0-7.0) um. The spore print is lotus root pink to light pink.

[0009] Furthermore, the mycelium of the Lepista sordida L-2 strain is light purple and villous. Under a microscope, the mycelium is transparent, uniform in thickness, and has clamp connections; the mycelial growth temperature is 3-28 °C, and the optimal temperature is 20-25 °C.

[0010] Furthermore, the fruiting bodies of the Lepista sordida L-2 strain are clustered or solitary. The cap is grayish purple to light purple, hemispherical to flat, slightly convex in the middle, with a diameter of 2.4-5.5 cm; the flesh is purple, with a strong and fragrant taste; the gills are purple, lamellar, slightly sparse and of unequal length; the stipe is 8.0-13.0 cm long, 0.70-1.60 cm in diameter, firm in texture, straight, nearly cylindrical, and slightly tapering upwards; the surface is the same color as the cap but slightly lighter, and the base is slightly swollen.

[0011] Furthermore, the growth period of the Lepista sordida L-2 strain is about 110 days.

[0012] Furthermore, the Lepista sordida L-2 strain produces mushrooms neatly, with a total of 4-5 flushes. After the previous flush of mushrooms is over, stop spraying water on the soil layer. Cultivating the mycelium for 1 week and then watering can stimulate the growth of the next flush of mushrooms.

[0013] Furthermore, the biological efficiency of the Lepista sordida L-2 strain is 45%-50%.

[0014] Furthermore, the suitable growth environment of the Lepista sordida L-2 strain is as follows:

[0015] Temperature: A basidiomycete fungus with medium-temperature fruiting. The suitable temperature for mycelial growth is 3-28 °C, and the more suitable temperature is 20-25 °C; the fruiting temperature range is 8-25 °C, and the optimal temperature is 12-20 °C. Under natural conditions, the whole growth period of fermented material bed cultivation is about 110 days. Temperatures lower than or higher than the growth range are not conducive to the normal growth of fruiting bodies.

[0016] Light: During the mycelial growth period, light is not required. Strong direct light is not conducive to the germination of mycelia and the differentiation of fruiting bodies. The formation of primordia requires a certain amount of scattered light. During the fruiting body growth period, the suitable light intensity is 200-400 lx. If the light is too strong or too weak, the color of the fruiting body will become lighter.

[0017] Humidity: The relative air humidity during the formation and growth of fruiting bodies is 80-90%.

[0018] Air: The mycelium requires less oxygen during growth; the fruiting body requires good ventilation during growth and development.

[0019] Nutrition: It belongs to straw-decomposing fungi. The mycelium can utilize monosaccharides such as glucose and nitrogen sources such as peptone. In cultivation, corncobs, rice straw, wheat straw, soybean straw, corn straw, etc. can be used as the main carbon sources, and livestock and poultry manures such as cow dung and pig dung or bran, soybean meal, and corn flour can be used as nitrogen sources. At the same time, trace inorganic salts such as potassium dihydrogen phosphate, gypsum, and superphosphate need to be supplemented.

[0020] Soil acidity and alkalinity (pH): The suitable pH is 5 - 7.

[0021] On the other hand, the present invention provides an efficient cultivation technique for Lepista sordida, and the efficient cultivation technique comprises the following steps:

[0022] 1) Pre - wetting and fermentation of the culture medium

[0023] 1.1) Pre - wetting: The culture medium is fully pre - wetted until it forms a ball when held in the hand and loosens when placed on the ground. The culture medium consists of 60% corn cob, 36% dried cow dung, 2% lime, and 2% gypsum.

[0024] 1.2) Fermentation: Add 1 / 2 of the lime and gypsum in step 1.1), mix well and then stack for fermentation.

[0025] 2) Sowing

[0026] One week before sowing, disinfect the cultivation site, and then carry out sowing.

[0027] 3) Covering with soil

[0028] Select loam with loose texture, good air and water retention, and a pH value of 5.0 - 7.0. Add 2% lime to the soil particles one week in advance, mix well and expose to the sun for disinfection. 15 - 20 days after sowing, when the mycelium on the surface of the bed has consumed 2 / 3 of the culture medium, cover with soil. The thickness of the soil layer is 2 cm - 3 cm. When covering with soil, first cover with coarse soil, and then fill with fine soil until the surface is flat. The "consuming 2 / 3 of the culture medium" means that 2 / 3 of the culture medium has been consumed.

[0029] 4) Low - temperature cultivation

[0030] After covering with soil, keep the soil moisture content at about 30% - 70%, cover with a film to keep moisture. Ventilate by uncovering the film in the morning and evening. After the mycelium climbs onto the soil layer, uncover the film for ventilation, dry the moisture on the surface of the covered soil layer and then cover with the film, and carry out after - ripening cultivation at 3 - 15°C.

[0031] 5) Management during the mushroom - growing period

[0032] After 60 - 110 days of low - temperature cultivation, spray water on the covered soil layer for 5 - 10 days, stimulate the mycelium to knot and thicken with light, and control the temperature in the mushroom house at 10 - 28°C. During the mushroom - growing period, the moisture content of the covered soil layer is 50% - 95%, the relative air humidity is 60% - 95%, and there is light.

[0033] 6) Harvesting

[0034] When the mushroom shape is regular, the edge is slightly involuted, and the mushroom body color is light purple or gray - purple, it can be harvested. When harvesting, gently twist the mushroom stalk, twist it left and right to pick the mushroom, pick the large ones and leave the small ones.

[0035] Preferably, step 1) is specifically as follows: The culture medium is fully pre-wetted until it forms a ball when held in the hand and loosens when placed on the ground. Add 1 / 2 of the lime and gypsum in each formula, mix well, and build a pile with a width of 2.0 m and a height of 1.5 m. The top of the pile is in the shape of a turtle's back, and exhaust holes are inserted at intervals of 40 cm for stacking and fermentation. After the culture medium is stacked for 3 - 5 days, the pile temperature reaches 65°C - 75°C, and the first turning of the pile is carried out after 3 days. When turning the pile, add 1 / 2 of the lime and gypsum in the formula layer by layer, insert exhaust holes at intervals of 40 cm, and adjust the water content of the culture medium to 65% - 70%. 2 - 3 days after the first turning of the pile, when the pile temperature reaches 65°C - 70°C and is maintained for 3 days, the second turning of the pile is carried out, and water is added to adjust the water content of the culture medium to 65% - 70%. Exhaust holes are inserted at intervals of 1 m at the top and sides of the pile. 6 - 8 days after the second turning of the pile, the third turning of the pile is carried out, and exhaust holes are inserted at intervals of 1 m in the middle of the pile.

[0036] Preferably, step 2) is specifically sowing using a shelf (4 layers) with a length of 2 m, a width of 1 m, and a height of 2 m. One week before sowing, clean the shelf, and spread 0.5 kg of lime powder per square meter in the cultivation site for disinfection. Spread the material 12 cm high, 80 cm wide, and 2 m long on each layer, and use the layer sowing or hole sowing method for sowing. The seeding rate per square meter is 1 - 1.5 Kg. Sow 3 shelves (12 layers) for each strain, and control the sowing temperature at 18°C - 25°C and the humidity at about 80%.

[0037] Preferably, step 3) is specifically selecting a loam soil with loose texture, good air permeability and water retention, and a pH value of 5.0 - 7.0. It is best to select the clay loam soil under the plough layer mixed with peat soil or forest surface soil. The soil particles are mixed with 2% lime one week in advance and exposed to the sun for disinfection. 15 - 20 days after sowing, when the mycelium on the surface of the ridge bed has eaten 2 / 3 of the material, cover the soil with a thickness of 2 cm - 3 cm. When covering the soil, first cover the coarse soil, and then fill the surface with fine soil to make it flat.

[0038] Preferably, step 4) is specifically making the soil water content about 60% after covering the soil, covering the film to keep moisture. Uncover the film for ventilation in the morning and evening for 15 minutes each time. After the mycelium climbs onto the soil layer, uncover the film for ventilation, dry the surface moisture of the covered soil layer, and then cover the film for after-ripening culture at 6 - 12°C.

[0039] Preferably, step 5) is specifically spraying heavy water (spraying until the fine soil layer shines) on the covered soil layer for 1 week after low-temperature culture for 90 - 100 days, with a light intensity of 100 lx - 300 lx, stimulating the mycelium to twist and thicken. Control the temperature in the mushroom house at 15 - 23°C for mushroom management. During the mushroom emergence period, the water content of the covered soil layer is 85% - 90%, the relative air humidity is 90% - 95%, and the light intensity is 200 lx - 400 lx.

[0040] Preferably, step 6) is specifically that the mushroom is round and regular in shape, with the edge slightly curled inwards, and the color of the mushroom body is light purple or grayish purple, then it can be harvested. When harvesting, gently twist the mushroom stalk, twist it left and right to pick the mushroom, pick the large ones and leave the small ones. Do not spray water on the mushroom bed 1 day before harvesting. After harvesting, promptly tidy up the mushroom bed. Keep the water content of the soil layer at 60%, and cultivate under light of 200 lx - 400 lx for about 6 days. After the mushroom buds grow again, manage them in the same way as the first flush of mushrooms.

[0041] Preferably, in the high-efficiency cultivation technology of the aforementioned Lepista sordida, the Lepista sordida is the Lepista sordida L-2 strain and its offspring. It is characterized in that: the taxonomic name of the strain is Lepista sordida, the strain number is Lepista sordida L-2, the tentative variety name is "Daxiangmo No. 2", it is preserved in the China Center for Type Culture Collection (CCTCC), the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the preservation number is CCTCC NO: M20241717, and the preservation date is July 31, 2024.

[0042] The present invention also provides the fruiting body produced by the Lepista sordida L-2.

[0043] The present invention also provides the Lepista sordida mushroom sticks cultivated from the Lepista sordida L-2.

[0044] The present invention also provides the application of the Lepista sordida L-2 in the cultivation of Lepista sordida.

[0045] The present invention also provides the application of the Lepista sordida L-2 in the preparation of foods containing Lepista sordida.

[0046] Compared with the prior art, the present invention has the following advantages:

[0047] The present invention provides a new strain of Lepista sordida, which has the following characteristics and advantages compared with the existing common varieties: thick stalk and thin cap, the mushroom cap is not easy to break, the fruiting is neat, the flushes are obvious, high nutritional value, high yield, strong disease resistance, and a relatively wide temperature range for mycelial growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] The beneficial effects of the present invention will be described in detail below in conjunction with the drawings and specific embodiments.

[0049] Figure 1 It is the spore morphological characteristics, where Figure A is L-2, Figure B is Daxiangmo No. 1, and Figure C is Jilin Lepista sordida No. 3.

[0050] Figure 2 It is the spore print morphological characteristics, where Figure A is L-2, Figure B is Daxiangmo No. 1, and Figure C is Jilin Lepista sordida No. 3.

[0051] Figure 3Morphological characteristics of mycelia under culture conditions, where Figure A is L-2, Figure B is Daxiang mushroom No. 1, and Figure C is Jilin Huailianxiang mushroom No. 3.

[0052] Figure 4 Microscopic morphological characteristics of mycelia, where Figure A is L-2, Figure B is Daxiang mushroom No. 1, and Figure C is Jilin Huailianxiang mushroom No. 3.

[0053] Figure 5 Morphological characteristics of fruiting bodies, where Figure A is L-2, Figure B is Daxiang mushroom No. 1, and Figure C is Jilin Huailianxiang mushroom No. 3.

[0054] Figure 6 Mushroom yield chart, where Figure A is L-2, Figure B is Daxiang mushroom No. 1, and Figure C is Jilin Huailianxiang mushroom No. 3. Detailed implementation mode

[0055] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0056] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The test materials used in the following embodiments are all obtained from conventional biochemical reagent stores unless otherwise specified.

[0057] Example 1 Strain breeding process:

[0058] On October 12, 2019, the research group collected an upright wild fruiting body in Xiangjiaping Village, Guandu Town, Wanyuan City, numbered HL-19. The collection site was loam, pH6, the temperature at the time of collection was 10-16°C, and the altitude was 1356 meters. When the wild fruiting body was found, it was dark purple, with a medium-sized and slightly small cap, unfolded in a wavy shape, growing in clusters in weeds, and there was shade. The HL-19 fruiting body was taken back to the laboratory of Dazhou Academy of Agricultural Sciences for morphological identification, and inoculated on PDA medium by tissue separation method. Through continuous purification of the isolated strains, 12 test tube strains of pure Huailianxiang mushroom strains (L-1~L-12) were obtained. The isolated strains were identified by DNA molecular identification to obtain ITS sequences, and a phylogenetic tree was constructed based on the Neighbor-Joining method algorithm. As a result, HL-19 branched closely with related strains of Lepista sordida, and was separated from the branches of existing strains, indicating that this strain had genetic differences from existing strains. Combining with the morphological characteristic data of the fruiting body, this strain was determined to be Lepista sordida.

[0059] In the spring of 2020, at the Liujiaba experimental base of Dazhou Academy of Agricultural Sciences, the original seeds and cultivated seeds of strains Y1 to Y12 were produced, and fruiting was carried out by cultivating with fermented materials. Twelve tested strains and one main cultivated strain (Daxiang mushroom No. 1, the main cultivated variety) were compared, and data recording and analysis were carried out on the agronomic trait indexes such as the mycelial growth rate, fruiting body appearance, and yield of strain HL-19. The results showed that there were no significant differences in the fruiting body appearance and fruiting period among L-2, L-7, and L-11, but there were differences in the fruiting yield. Further, a rescreening verification test was carried out at the Liujiaba experimental base. The three better isolates obtained from the preliminary screening were used for rescreening fruiting to further verify the yield, anti-contamination ability, and stability of the strains, and to screen the target strains. From September 2020 to January 2021, the strains obtained from the preliminary screening were used for spawn production and fruiting. The results showed that their yields were all higher than that of the main cultivated variety. Comprehensive evaluations were carried out on the fruiting batches, uniformity, single plant weight, biological efficiency, growth cycle, etc., and comprehensive analysis was carried out in combination with the data of the preliminary screening test, indicating that L-2 was the best strain. Subsequently, the biological characteristics detection and data verification of strain L-2 were carried out in the laboratory. According to "NY / T1845-2010 Identification of Edible Mushroom Strains - Antagonistic Reaction", an antagonistic test was carried out with the existing strains. Combining the biological characteristics and fruiting performance of the strains, the results showed that strain L-2 had high yield, neat fruiting, and obvious batches, and could be used for subsequent regional tests.

[0060] Combining the biological characteristics and fruiting performance of strain L-2, a new strain of Lepista sordida with neat fruiting, high yield, and obvious batches was domesticated, tentatively named "Daxiang mushroom No. 2".

[0061] Example 2 Sequence identification of strain L-2:

[0062] It includes the following processes:

[0063] Extraction of fungal genomic DNA: Extracted according to the instructions of the Piseno Ezup column fungal genomic DNA extraction kit. The obtained DNA solution was stored at -20°C for later use.

[0064] 0 to 39 μL.

[0065] The PCR program was: 95°C for 5 min; 95°C for 30 s; 58°C for 30 s; 72°C for 1 min; 35 cycles were carried out in sequence according to the aforementioned temperature and time; finally 72°C for 7 min.

[0066] The sequence of the ITS1 primer 595F is SEQ ID NO.1: 5'-TCCGTAGGTGAACCTGCGG-3';

[0067] The sequence of ITS4 is SEQ ID NO.2: 5’-TCCTCCGCTTATTGATATGC-3’;

[0068] The identification sequence results of the strain L-2 of the present invention are as follows SEQ ID NO.3:

[0069] TACCTGATTTGAGGTCAAAATGTCATAAATTTGTCCAAGTCAATGGACTGTTAGAAGCTGAACCCCATGTTAAAGCTGCTTCACAACCATGGCGTAGATAATTATCACACCAAAAGCTGGTCCACAAAGGTTCCGCTAATGCATTTAAGAGGAGCCGACTTCTAGAGAAGCCCGCAATAACCTCCACATCCAAGCCAATCCAACTTGCAAAAGCTGAAAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAATTTAAAGGCATAAAGCCCATTAATAACATTCTATTACATTCTTATGGGGTATAATAAAAACATAGACTTGAAACACAAGGAAAGCCATGTTTGCACACAGCATTCCTCAAACCGAGTTTCCTCGAGAGTTGTTTCAAATCTACAAAAGGTGCACAGGTGGTAAAAATGGCGCTAGGCGTGCACATGCTCCAAAAAGCCAGCACAACCCAACCAAGTTTATTCAATAATGATCCTTCCGCAGGTTCACCCTACGGAAGGA;

[0070] The ITS sequences of the sequenced results were compared for homology in NCBI by BLAST. The comparison results were based on a similarity of more than 99%, and molecular identification of the strains was performed. The identification result was Lepista sordida.

[0071] The strain isolated in this example was deposited at the China Center for Type Culture Collection (CCTCC) on July 12, 2024. The deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit number is CCTCC NO: M20241717, and the deposit date is July 31, 2024.

[0072] Example 3 Morphological characteristics and biological properties:

[0073] 1. Spores Colorless, transparent, smooth surface, cylindrical or oval, size (4.0 - 5.0) um × (5.0 - 7.0) um ( Figure 1 ), spore print lotus pink to light pink ( Figure 2 ).

[0074] 2. Mycelium Light purple, villous. Under the microscope, the mycelium is transparent, uniform in thickness, with clamp connections; the mycelium growth temperature is 3 - 28 °C, and the optimum temperature is 20 - 25 °C ( Figure 3 , Figure 4 ).

[0075] 3. Fruiting body Clustered or solitary. The cap is gray - purple to light purple, hemispherical to flat - spreading, slightly convex in the middle, with a diameter of 2.4 - 5.5 cm; the flesh is purple, with a strong and fragrant taste; the gills are purple, lamellar, slightly sparse, unequal in length; the stipe is 8.0 - 13.0 cm long, 0.70 - 1.60 cm in diameter, firm in texture, straight - growing, nearly cylindrical, slightly tapering upwards; the surface is the same color as the cap but slightly lighter, and the base is slightly swollen ( Figure 5 ).

[0076] 4. Growth period

[0077] The growth period is about 110 days.

[0078] 5. Biological efficiency

[0079] Generally, it is 45% - 50%.

[0080] 6. Disease and pest resistance characteristics

[0081] The mycelium has strong disease and pest resistance.

[0082] 7. Suitable growth environment

[0083] Temperature: A basidiomycete fungus with medium - temperature fruiting. The suitable temperature for mycelium growth is 3 - 28 °C, and the more suitable temperature is 20 - 25 °C; the fruiting temperature range is 8 - 25 °C, and the optimum temperature is 12 - 20 °C. Under natural conditions, the whole growth period of fermentation - material bed cultivation is about 110 days. Temperatures lower than or higher than the growth range are not conducive to the normal growth of fruiting bodies.

[0084] Light: During the mycelium growth period, light is not required. Intense direct sunlight is not conducive to the germination of mycelium and the differentiation of fruiting bodies. A certain amount of scattered light is required for the formation of primordia. During the growth period of fruiting bodies, the appropriate light intensity is 200 - 400 lx. If the light is too strong or too weak, the color of the fruiting body will become lighter.

[0085] Humidity: During the formation and growth period of fruiting bodies, the relative air humidity is 80 - 90%.

[0086] Air: The mycelium requires less oxygen during growth; good ventilation is required for the growth and development of fruiting bodies.

[0087] Nutrition: It belongs to straw-decomposing fungi. The mycelium can utilize monosaccharides such as glucose and nitrogen sources such as peptone. In cultivation, corncobs, rice straw, wheat straw, soybean straw, corn straw, etc. can be used as the main carbon sources, and livestock and poultry manures such as cow dung and pig dung or bran, soybean meal, and corn flour can be used as nitrogen sources. At the same time, trace inorganic salts such as potassium dihydrogen phosphate, gypsum, and superphosphate need to be supplemented.

[0088] pH value: The suitable pH is 5 - 7.

[0089] Example 4 Comparison with strains 'Daxiangmo No.1' and 'Jilin Hualianxiangmo No.3'

[0090] 1. Morphological differences

[0091] The fruiting bodies of L-2 grow in clusters. The pileus is grayish purple to light purple, hemispherical to flat, slightly convex in the middle; the pileus of Daxiangmo No.1 is light purple, oblate hemispherical, convex in the middle, and the edge has waterlogged patterns, and the color in the middle is lighter than that at the edge; the pileus of 'Jilin Hualianxiangmo No.3' is relatively flat, pinkish purple, white and convex in the middle ( Figure 5 ) The descriptions of the mycelium and fruiting bodies are compared in Tables 1 and 2.

[0092] The pileus of the L-2 strain is hat-shaped and not easy to open or flatten; the diameter of the pileus is about 2 - 3 cm, only 1 / 3 - 1 / 2 of the pileus diameter of Daxiangmo No.1 or Jilin Hualianxiangmo No.3, so it is not easy to break.

[0093]

[0094] 2. Yield differences

[0095] The biological efficiency of 'L-2' is 45% - 50%, the biological efficiency of 'Daxiangmo No.1' (CK) is 40% - 45%, and the biological efficiency of Jilin Hualianxiangmo is 35% - 40%. Under the same inoculation amount, L-2 has a 12.24% and 29.74% increase in yield compared to the control (Tables 2, Figure 6 )

[0096] 3. Mushroom emergence rate

[0097] The fruiting of strain L-2 is neat, with 4 to 5 flushes of fruiting. After the end of the previous flush of mushrooms, spraying water on the soil layer is stopped, and the mycelium is cultured for 1 week. Then, watering is carried out to stimulate the fruiting of the next flush of mushrooms. For Lentinus odoratus No. 1 and Lentinus sp. Jilin No. 3 (CK), the flushes are not obvious, and continuous management is required for about 60 days from the start of fruiting to the end of the fruiting period ( Figure 6 ).

[0098] 4. Growth rate

[0099] The growth period of strain L-2 is about 110 days, and it takes 8 - 10 days for the fruiting body to grow from the mushroom bud to maturity. The growth period of Lentinus odoratus No. 1 is about 85 days, and it takes about 5 - 7 days for the fruiting body to grow from the mushroom bud to maturity.

[0100] 5. Quality

[0101]

[0102] 6. Taste

[0103] The taste of strain L-2 is crispier and more tender than that of Lentinus odoratus No. 1 and Lentinus sp. Jilin No. 3. For the stir-fried mushrooms (only adding edible oil and salt), 10 people are randomly selected for tasting, and the fruiting bodies of each strain are scored according to the scoring criteria in Table 4. The comparison of the scoring results is shown in Table 5.

[0104] Table 4 Scoring criteria for the taste of fruiting bodies

[0105]

[0106] Table 5 Scoring results for the taste of fruiting bodies of Lentinus sp

[0107]

[0108] 7. Stress resistance

[0109] , with 3 replicates set up, the contaminated area (Penicillium, Gypsum mold) of the mushroom bed and the pest damage rate of the fruiting bodies are counted. The comparison of the pest resistance characteristics and the contamination rate is shown in Table 6. It is not easily affected by pests and is resistant to Penicillium and Gypsum mold.

[0110] Table 6 Comparison table of pest resistance and contamination rate of Lentinus sp

[0111]

[0112] 8. Biological efficiency

[0113] In the autumn of 2022, the Lentinus sp strains were sown using the stainless steel shelf bed cultivation method. 15 kg of cultivation material (dry weight) was used per square meter, and 2 bottles (750 ml / bottle) of spawn were used per square meter. 3 replicates were set up for each strain, and the comparison of the yields is shown in Table 7:

[0114] Table 7 Comparison table of yields of Lentinus sp (kg / m2)

[0115]

[0116] Example 4 Cultivation Method of Lepista sordida L-2

[0117] 1) Fermentation of culture medium

[0118] The culture medium is fully pre-wetted until it forms a ball when squeezed by hand and loosens when placed on the ground. Add 1 / 2 of the lime and gypsum in each formula, mix well, and build a pile with a width of 2.0 m and a height of 1.5 m. The top of the pile is in the shape of a turtle's back, and exhaust holes are inserted at intervals of 40 cm for stacking fermentation. After the culture medium is stacked for 3 - 5 days, the pile temperature reaches 65℃ - 75℃, and the first turning of the pile is carried out after 3 days. When turning the pile, add 1 / 2 of the lime and gypsum in the formula layer by layer, insert exhaust holes at intervals of 40 cm, and adjust the water content of the culture medium to 65% - 70%. 2 - 3 days after the first turning of the pile, when the pile temperature reaches 65℃ - 70℃ and is maintained for 3 days, the second turning of the pile is carried out, and water is added to adjust the water content of the culture medium to 65% - 70%. Exhaust holes are inserted every 1 m at the top and side of the pile. 6 - 8 days after the second turning of the pile, the third turning of the pile is carried out, and exhaust holes are inserted every 1 m in the middle of the pile.

[0119] 2) Sowing

[0120] Use a shelf with a length of 2 m, a width of 1 m, and a height of 2 m (4 layers) for sowing. One week before sowing, clean the shelf, and sprinkle 0.5 kg of lime powder per square meter in the cultivation place for disinfection. Spread the material 12 cm high, 80 cm wide, and 2 m long on each layer, and use the layer sowing or hole sowing method for sowing. The seeding rate per square meter is 1 - 1.5 Kg. Each strain is sown on 3 shelves (12 layers), and the sowing temperature is controlled at 18℃ - 25℃ and the humidity is controlled at about 80%.

[0121] 3) Covering soil

[0122] Select a loam soil with loose texture, good air and water retention, and a pH value of 5.0 - 7.0. It is best to select the clay loam soil under the plough layer mixed with peat soil or forest surface soil. The soil particles are mixed with 2% lime one week in advance and exposed to the sun for disinfection. 15 - 20 days after sowing, when the mycelium on the surface of the bed has eaten 2 / 3 of the material, cover the soil with a thickness of 2 cm - 3 cm. When covering the soil, first cover the coarse soil, and then fill the surface with fine soil until it is flat.

[0123] 5) Low-temperature cultivation

[0124] After covering the soil, make the soil water content about 60%, cover the film to keep moisture. Ventilate by uncovering the film in the morning and evening for 15 minutes each time. After the mycelium climbs onto the soil layer, uncover the film for ventilation, dry the water on the surface of the covered soil layer, and then cover the film for after-ripening cultivation at 6 - 12℃.

[0125] 5) Management during the mushroom-growing period

[0126] After culturing at low temperature for 90 - 100 days, spray heavy water on the covering soil layer for 1 week, with light intensity of 100 lx - 300 lx, to stimulate the mycelium to knot and thicken. Control the temperature in the mushroom house at 15 - 23 °C and manage the fruiting. During fruiting, the water content of the covering soil layer is 85% - 90%, the relative air humidity is 90% - 95%, and the light intensity is 200 lx - 400 lx.

[0127] 6) Harvest

[0128] When the mushroom shape is regular, with the edge slightly involuted and the mushroom body color being light purple or gray - purple, it can be harvested. During harvesting, gently twist the mushroom stalk, twist it left and right to pick the mushroom, pick the large ones and leave the small ones. Do not spray water on the mushroom bed 1 day before harvesting. After harvesting, promptly tidy up the mushroom bed. Keep the water content of the soil layer at 60% and culture under light intensity of 200 lx - 400 lx for about 6 days. After the mushroom buds grow again, manage them as in the first flush of mushrooms.

[0129] The above - mentioned are only the preferred embodiments of the present invention and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to equivalent embodiments by using the disclosed technical content without departing from the technical solution of the present invention. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A Lepista sordida strain, characterized in that, The taxonomic name of the strain is Lepista sordida L-2, and its Latin scientific name is Lepista sordida . The strain is deposited in the China Center for Type Culture Collection (CCTCC). The deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit number is CCTCC NO: M20241717, and the deposit date is July 31, 2024.

2. A fruiting body of Lepista sordida, which is produced by the strain described in claim 1.

3. A spawn-run bag of Lepista sordida, which is produced by the strain described in claim 1.

4. Use of the Lepista sordida strain described in claim 1 in the cultivation of Lepista sordida.

5. Use of the Lepista sordida strain described in claim 1 in the preparation of foods containing Lepista sordida.

6. The high-efficiency cultivation method of the Lepista sordida strain or its offspring described in claim 1, characterized in that, The method comprises the following steps: 1) Pre-wetting of the culture medium: The culture medium is fully pre-wetted until it can be formed into a ball by hand and loosens when placed on the ground. The culture medium consists of 60% corncob, 36% dry livestock manure, 2% lime, and 2% gypsum. 2) Fermentation of the culture medium: Add 1 / 2 of the lime and gypsum in step 1), mix well and then pile up for fermentation. 3) Seeding: One week before seeding, disinfect the cultivation site and then carry out seeding. 4) Covering with soil: Select a loam soil with loose texture, good air permeability and water retention, and a pH value of 5.0 - 7.

0. The soil particles are mixed with 2% lime one week in advance and exposed to the sun for disinfection. 15 - 20 days after seeding, when the mycelium on the surface of the bed has grown into 2 / 3 of the culture medium, cover with soil. The soil layer thickness is 2 cm - 3 cm. When covering with soil, first cover with coarse soil and then fill with fine soil until the surface is flat. 5) Low-temperature cultivation: After covering with soil, make the soil water content 30% - 70%, cover with a film to keep moisture, uncover the film for ventilation in the morning and evening. After the mycelium climbs onto the soil layer, uncover the film for ventilation, dry the moisture on the surface of the covered soil layer and then cover with a film, and carry out after-ripening cultivation at 3 - 15 °C. 6) Management during the mushroom-growing period: After 60 - 110 days of low-temperature cultivation, spray water on the covered soil layer for 5 - 10 days, stimulate the mycelium to knot and thicken with light, control the temperature in the mushroom house at 10 - 28 °C, the water content of the covered soil layer is 50% - 95% during the mushroom-growing period, the relative air humidity is 60% - 95%, and there is light. 7) Harvesting: When the mushroom shape is regular, the edge is slightly curled inwards, and the color of the mushroom body is light purple or grayish purple, it can be harvested. When harvesting, gently twist the mushroom stalk and twist it left and right to pick the mushroom, pick the large ones and leave the small ones.

7. The high-efficiency cultivation method of the Lepista sordida strain or its offspring according to claim 6, characterized in that, The specific steps of 1) and 2) are as follows: The culture medium is fully pre-wetted until it can be formed into a ball by hand and loosens when placed on the ground. Add 1 / 2 of the lime and gypsum in the formula, mix well and build a pile with a width of 2.0 m and a height of 1.5 m. The top of the pile is in the shape of a turtle's back, and exhaust holes are inserted at intervals of 40 cm for piling and fermentation. After the culture medium is piled for 3 - 5 days, the pile temperature reaches 65 °C - 75 °C, and the first turning of the pile is carried out after 3 days. When turning the pile, add 1 / 2 of the lime and gypsum in the formula layer by layer, insert exhaust holes at intervals of 40 cm, and adjust the water content of the culture medium to 65% - 70%. 2 - 3 days after the first turning of the pile, when the pile temperature reaches 65 °C - 70 °C and is maintained for 3 days, carry out the second turning of the pile, add water to adjust the water content of the culture medium to 65% - 70%, and insert exhaust holes at intervals of 1 m at the top and side of the pile. 6 - 8 days after the second turning of the pile, carry out the third turning of the pile, and insert exhaust holes at intervals of 1 m in the middle of the pile.

Citation Information

Patent Citations

  • Corncob lepista sordida culture material and method for cultivating lepista sordida

    CN107082698A