bacillus velezensis bvfa21, compositions, fermentation processes and uses thereof

By using Bacillus belye BVFA21 and its sterile fermentation broth, especially p-methoxybenzoic acid, the problems of pesticide residues and resistance of chemical fungicides have been solved, achieving highly efficient control of Fusarium moniliformes and making it suitable for biological control of plum diseases.

CN119286709BActive Publication Date: 2025-12-30GUIZHOU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411543985.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-31
Publication Date
2025-12-30
Estimated Expiration
2044-10-31

AI Technical Summary

Technical Problem

Existing chemical fungicides have problems such as pesticide residues, rampant pests and resistance when controlling plant pathogenic fungi, and long-term use leads to reduced efficacy, failing to meet the demand for environmentally friendly and highly effective pesticides.

Method used

Using Bacillus belye BVFA21 and its sterile fermentation broth, especially the fermentation broth containing p-methoxybenzoic acid, plant disease inhibitors are prepared and applied through fermentation methods, particularly for the inhibition of Fusarium effusum. The disease inhibitors are prepared by spraying on crop fruits and drenching the roots, and by using fermentation products or metabolites.

Benefits of technology

It effectively controls plum diseases, reduces the possibility of plant infection by pathogenic fungi, has broad application prospects in biological control, and does not produce drug resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286709B_ABST
    Figure CN119286709B_ABST
Patent Text Reader

Abstract

The application discloses bacillus velezensis BVFA21, a composition, a fermentation method and purposes thereof, the strain is preserved in the China Center for Type Culture Collection with a preservation number of CCTCC NO:M2024623, and the preservation date is April 3, 2024. The strain has antagonism to fusarium proliferatum, and the application method is that sterile fermentation liquor of the strain BVFA21 is sprayed on crop fruits. The bacillus velezensis BVFA21, the fermentation product of the bacillus velezensis BVFA21 and the metabolite of the bacillus velezensis BVFA21 can effectively control the occurrence of plum diseases and reduce the possibility of plum being infected by various pathogenic fungi. It is shown that the strain has a wide application prospect in the field of biological control of plant diseases, and also has a high development value in the development of biological control agents.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field related to bio-agriculture, and particularly relates to a new strain and a composition thereof, a fermentation method, and an application in biological control of plant diseases. BACKGROUND

[0002] The existence of plant pathogenic fungi seriously affects the healthy development of the agricultural industry. Plant pathogenic fungi refer to fungi that can parasitize plants and cause diseases. So far, more than 8000 species of plant pathogenic fungi have been recorded, accounting for 80% of the total number of plant diseases. More than 30,000 plant diseases caused by fungi have been recorded. Globally, plant pathogenic fungi cause 10% to 30% reduction in the yield of important crops such as food, vegetables, and fruit trees every year, resulting in economic losses of hundreds of billions of dollars in global agriculture.

[0003] At present, various chemical fungicides and other chemical control methods are widely used in agriculture to reduce the impact of plant pathogenic fungi on agricultural production. Chemical control methods play an important role in agricultural production, and have the advantages of fast effect, good prevention and control effect, and convenient operation. However, long-term and excessive use of chemical fungicides can lead to the gradual emergence of the "3R" problem of pesticide residue, harmful organism resurgence, and biological resistance.

[0004] Most chemical pesticides are difficult to degrade in a short time after application, and can accumulate in large quantities in agricultural products and soil, not only polluting the environment but also affecting human health. Long-term and unreasonable use of pesticides can accelerate the development of pesticide resistance in plant pathogenic fungi, leading to the need for increased use of pesticides for subsequent control, entering a vicious cycle, and eventually resulting in a significant decrease in control effect and resurgence of the disease.

[0005] With the improvement of living standards, people have gradually paid more attention to the quality and safety of agricultural products, and environmentally friendly, residue-free, safe and efficient pesticides have become the new requirements of people. Microbial pesticides are favored by current new pesticide researchers due to their non-polluting, non-residual, low control cost, and resistance to resistance.

[0006] Among the many biocontrol microorganisms, Bacillus plays an important role. Live bacteria and / or sterile fermentation broth of Bacillus have high antagonistic effect on a variety of plant pathogenic fungi, and are widely distributed and have strong stress resistance. Therefore, it is of great significance to find suitable Bacillus strains, extract efficient and stable bacteriostatic components from their fermentation products, and use them for the control of plant pathogenic fungi. SUMMARY

[0007] The purpose of the present application is to provide Bacillus velezensis BVFA21, its composition, fermentation method and use, especially the use of sterile fermentation liquor of Bacillus velezensis BVFA21 in preventing and treating crop diseases caused by Fusarium proliferatum.

[0008] According to a first main aspect of the present application, a new Bacillus velezensis BVFA21 is provided, which is preserved in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China, postcode: 430072, telephone: 027-68754052) with the preservation number CCTCC NO: M2024623, the preservation date is April 3, 2024, and the classification name is Bacillus velezensis BvFA21.

[0009] The 16S rDNA sequence thereof is shown in Seq ID No. 1.

[0010] According to a second main aspect of the present application, a composition comprising the aforementioned Bacillus velezensis BVFA21 or its fermentation product or metabolite is provided.

[0011] As a preferred solution, in the aforementioned composition, the fermentation product or metabolite comprises sterile fermentation liquor containing p-methoxybenzoic acid.

[0012] According to a third main aspect of the present application, a fermentation method for promoting the production of p-methoxybenzoic acid by the aforementioned Bacillus velezensis BVFA21 is provided, which comprises the following steps:

[0013] S1, inoculating the Bacillus velezensis BVFA21 into NB culture medium, and culturing for 36h under the condition of temperature 35℃, pH 7.2, and shaking speed 180rpm to prepare seed liquid;

[0014] S2, inoculating the Bacillus velezensis BVFA21 seed liquid grown to OD 600 0.6-0.8 into fresh YSB culture medium, and fermenting for 72h under the condition of temperature 37℃, pH 7.2, and shaking speed 200rpm;

[0015] S3, collecting the fermentation liquor, centrifuging in a high-speed centrifuge at 4000rpm for 30min, filtering the supernatant twice with a microporous filter film of 0.22μm to obtain sterile fermentation liquor containing p-methoxybenzoic acid.

[0016] As a preferred solution, in the aforementioned method, the YSB culture medium comprises: sucrose 20.0 g, yeast extract 20.0 g, beef extract 15 g, MgSO4·7H2O 0.06 g, FeSO4·7H2O 0.009 g, distilled water 1000 mL, and the pH is 7.2, and the inoculation amount of the Bacillus velezensis BVFA21 seed liquid in the YSB culture medium is 3%.

[0017] According to a fourth main aspect of the present application, there is provided a use of the aforementioned Bacillus velezensis BVFA21, which comprises the use in inhibiting pathogenic bacteria, the use in inhibiting crop diseases caused by pathogenic bacteria, the use in preparing pathogenic bacteria inhibitors, and the use in preparing crop disease inhibitors caused by pathogenic bacteria.

[0018] As a preferred solution, in the aforementioned use, the antagonism of the sterile fermentation broth containing p-methoxybenzoic acid prepared from the Bacillus velezensis BVFA21 to Fusarium proliferatum is achieved.

[0019] As a preferred solution, in the aforementioned use, the use comprises spraying the sterile fermentation broth of the Bacillus velezensis BVFA21 on the fruit of the crop; and the crop is plum.

[0020] As a preferred solution, in the aforementioned use, the use comprises spraying and / or root-drenching one or more of the following on the above-ground part of the plant: the Bacillus velezensis BVFA21, the fermentation product of the Bacillus velezensis BVFA21, the metabolite of the Bacillus velezensis BVFA21, the microbial inoculant prepared from the Bacillus velezensis BVFA21 or the fermentation product or metabolite thereof, the disease inhibitor prepared from the Bacillus velezensis BVFA21 or the fermentation product or metabolite thereof, or any combination thereof.

[0021] Advantages and beneficial effects of the present application:

[0022] The technical solution of the present application first screens and obtains the Bacillus velezensis BVFA21. Experiments prove that the Bacillus velezensis BVFA21, the fermentation product of the Bacillus velezensis BVFA21, and the metabolite p-methoxybenzoic acid of the Bacillus velezensis BVFA21 can effectively control the occurrence of plum diseases and reduce the possibility of plant infection by pathogenic fungi. It is shown that the strain has a broad application prospect in the field of biological control of plant diseases, and also has a high development value in the development of biological control agents. BRIEF DESCRIPTION OF DRAWINGS

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, obtaining other drawings based on these drawings without creative effort still falls within the scope of the present invention.

[0024] Figure 1 The following is an illustration of the colony morphology of Bacillus belyssus BVFA21 in one embodiment of the present invention (A: colony morphology on NA plate; B: partial view of colony morphology on NA plate; C: Gram staining).

[0025] Figure 2 The phylogenetic tree of 16sRNA (A) and gyrA (B) of Bacillus belyss BVFA21 in one embodiment of the present invention is shown.

[0026] Figure 3 The growth curve of Bacillus belye BVFA21 in one embodiment of the present invention is shown;

[0027] Figure 4 The inhibitory effect of Bacillus belye BVFA21 on plant pathogenic fungi is shown in one embodiment of the present invention;

[0028] Figure 5 The inhibitory effect of Bacillus vesiculosus BVFA21 sterile fermentation broth on plant pathogenic fungi is shown in one embodiment of the present invention;

[0029] Figure 6 The inhibitory effect of a liquid solution of Bacillus belye BVFA21 (bold text) on plant pathogenic fungi is shown in one embodiment of the present invention (A: CK; B: 400 μg / mL; C: 200 μg / mL);

[0030] Figure 7 It shows Figure 6 Schematic diagram of the antibacterial rate of 200ug / ml and 400ug / ml crude extracts of strain BVFA21 against F. proliferatum;

[0031] Figure 8 The sample positive ion base peak diagram (BPC) of one embodiment of the present invention is shown;

[0032] Figure 9 The sample negative ion base peak diagram (BPC) of one embodiment of the present invention is shown;

[0033] Figure 10The indoor toxicity determination of p-methoxybenzoic acid on Fusarium oxysporum f. sp. cubense in one embodiment of the present application is shown (A: CK; B: 25 μg / mL; C: 50 μg / mL; D: 100 μg / mL; E: 200 μg / mL; F: 400 μg / mL).

[0034] Figure 11 The indoor in vivo efficacy of the metabolite p-methoxybenzoic acid of Bacillus velezensis BVFA21 in one embodiment of the present application is shown. DETAILED DESCRIPTION

[0035] The preferred embodiments of the present application will be described in detail below with reference to the accompanying drawings, so that the objects, features and advantages of the present application can be more clearly understood. It should be understood that the embodiments shown in the drawings are not intended to limit the scope of the present application, but only to illustrate the essential spirit of the technical solutions of the present application.

[0036] In the following description, for the purpose of explaining various disclosed embodiments, certain specific details are set forth in order to provide a thorough understanding of various disclosed embodiments. However, one skilled in the relevant arts will recognize that embodiments can be practiced without one or more of the specific details, or with other methods, components, materials, and so forth. In other instances, well-known structures, materials, or operations are not shown or described in detail in order to avoid obscuring the description of embodiments.

[0037] Reference throughout this specification to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrase "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics can be combined in any suitable manner in one or more embodiments.

[0038] The present application provides a Bacillus velezensis strain BVFA21 and a method and application of producing p-methoxybenzoic acid, as shown in the accompanying Figures 1-9 As shown in the accompanying drawings, the Bacillus velezensis strain BVFA21 described in the present application was preserved in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China, postcode: 430072, telephone: 027-68754052) on April 3, 2024, and the preservation number is CCTCC NO: M2024623.

[0039] Example 1:

[0040] The plants involved in this embodiment are as follows:

[0041] (1) Plum.

[0042] The plant pathogenic fungi involved in the present application are as follows:

[0043] (1) Fusarium proliferatum.

[0044] The culture medium and solution involved in the present application are as follows:

[0045] NA medium: beef extract 5 g / L, peptone 10 g / L, NaCl 5 g / L, agar powder 20 g / L, sterile water 1000 mL.

[0046] LB: yeast extract 5.0 g, tryptone 10.0 g, NaCl 5.0 g, distilled water 1000 ml

[0047] PDA medium: potato 200 g, glucose 20 g, agar powder 17 g, sterile water 1000 mL.

[0048] YSB medium: sucrose 20.0 g, yeast extract 20.0 g, beef extract 15 g, MgSO4·7H2O 0.06 g, FeSO4·7H2O 0.009 g, distilled water 1000 mL.

[0049] 1. Isolation of biocontrol strains

[0050] Test material: In May-July 2023, 6 healthy fruit samples of disease-resistant or disease-tolerant plants were collected from a plum orchard in Diewo Village, Zhenning Buyi and Miao Autonomous County, Anshun City, Guizhou Province (elevation 888.4 meters, 25.7847 °N, 105.8968 °E), and were numbered and stored at 4 °C for isolation.

[0051] a. In a sterile operation table, the collected healthy fruit of Prunus salicina Lindl. was washed with sterile water and placed on sterile newspaper to dry. After drying, the plum fruit was soaked in 75% alcohol for 1 min, washed with sterile water for 3-5 times, then soaked in 4% sodium hypochlorite for 4 min, and washed repeatedly with sterile water for at least three times to ensure that the sodium hypochlorite was washed clean and dried;

[0052] b. After the surface of the plum fruit was disinfected, the skin was removed with a sterile knife and cut into 0.5-1 cm2 tissue pieces. Each 1.5 ml sterile centrifuge tube with sterile grinding beads was added with 2-3 plum tissue pieces and 1 ml sterile water, and then placed in a frozen grinder for 2 min at 60 Hz.

[0053] c. After grinding, place in a constant temperature shaker at 37°C and 180 r / min for 2 h. Dilute the plum fruit tissue suspension with sterile water to 10-2, 10-3, 10-4 and other different dilution multiples. Then take 100 μL of the plum fruit tissue suspension and spread on NA culture medium plates. Incubate in a constant temperature incubator at 28°C for 2-3 days. Take 100 μL of sterile water used for the last time to wash the plum fruit and spread on NA culture medium plates to test whether the surface disinfection is complete.

[0054] d. Pick different morphological single colonies for multiple purification to obtain purified strains and number them. Inoculate the purified strains into NA slant medium and incubate at 28°C for 24 h. Store at 4°C for standby. At the same time, inoculate the purified strains into LB liquid medium and incubate at 28°C in a constant temperature shaker at 200 r / min for 24 h. Store the bacterial liquid in 25% glycerol at -80°C refrigerator.

[0055] (1) Physiological and biochemical characteristics identification

[0056] Morphological observation and physiological and biochemical identification are based on the "Common Bacteria System Identification Manual". Draw a line on the NA culture medium plate with BVFA21, as shown in FIG. 1. The bacteria can grow in large quantities at a temperature of 30°C-37°C for 12 h. The colony is opaque and white, with a dry and rough surface, an irregular round edge and wrinkles. The colony is sticky and forms a filament when picked up. Figure 1 Figure 1

[0057] (2) Molecular identification

[0058] Use the bacterial DNA extraction kit to extract the total DNA of BVFA21, and use bacterial 16S universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') to amplify the 16S rDNA sequence. Use specific primers gyrA-F (5'-CAGTCAGGAAATGCGTACGTCCTT-3') and gyrA-R (5'-CAAGGTAATGCTCCAGGCATTGCT-3') to amplify the gyrA conserved gene.

[0059] Perform agarose gel electrophoresis detection on the amplified PCR products, and send the PCR products with a single band to a sequencing company for sequencing. The sequencing results are compared using BLAST in the NCBI database. Take the strain sequence with higher homology, and use the maximum likelihood method (Maximum Likelihood, ML) of MEGA 7.0 software to construct a multi-gene phylogenetic tree combined with the 16S rDNA and gyrA sequences of BVFA21. ​​

[0060] 3. Determination of the growth curve of BVFA21

[0061] (1) Preparation of seed liquid: the activated BVFA21 strain was inoculated into a conical flask containing 100 ml of LB medium using a sterile inoculation loop, and was cultured in a 28°C shaking incubator at 180 r / min for 24 h to obtain BVFA21 seed fermentation liquid.

[0062] (2) Determination of the growth curve: 1% of the seed liquid was inoculated into a 1 L conical flask containing 500 ml of LB medium, and was cultured under the conditions of 180 r / min and 28°C, with three replicates of the treatment. The absorbance values of the fermentation liquid taken at 0 h, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 8 h, 10 h, 12 h, 14 h, 16 h, 18 h, 20 h, 22 h, 24 h, 32 h, 36 h, and 48 h were determined at a wavelength of 600 nm, and a growth curve of the strain BVFA21 was plotted. The results show that the growth curve of BVFA21 is of an “S” shape under the above culture conditions (see Fig. 1). Figure 3 As can be seen from the growth curve, the period from 0 h to 8 h is an adjustment period, during which the strain BVFA21 grows slowly; the period from 10 h to 36 h is a logarithmic growth period, during which the bacteria reproduce rapidly; the period from 36 h to 48 h is a stationary phase, during which the biomass of the strain tends to be stable but is slowly increasing; and the period after 48 h is a decline phase, during which the death rate is higher than the reproduction rate.

[0063] 4. Determination of the antibacterial activity of BVFA21 against F. proliferatum

[0064] F. proliferatum was activated on PDA medium, and 6 mm punchers were used to punch the fungus cake of the pathogenic fungus, which was inoculated in the center of a new PDA plate. 5 mm circular filter paper pieces soaked with 1 x 10 8 CFU / mL of the BVFA21 bacterial suspension were uniformly placed at a distance of 20 mm from each fungus cake of the pathogenic fungus, and the treatment was repeated three times for each pathogenic fungus. A plate without filter paper and with the pathogenic fungus inoculated in the center was used as a control. The culture dishes were inverted and cultured in a 28°C incubator for 5 days, and the growth of the pathogenic fungus was observed. The inhibition rate was calculated according to the following formula:

[0065] Inhibition rate (%) = (diameter of the pathogenic fungus in the control group - diameter of the pathogenic fungus in the treatment group) / diameter of the pathogenic fungus in the control group

[0066] x 100%

[0067] The experimental results show that BVFA21 has strong inhibitory activity against F. proliferatum (see Fig. 2), and the inhibition rate is 73.92%. Figure 4

[0068] 5. Inhibitory effect of sterile fermentation liquid of BVFA21 on F. proliferatum ​

[0069] Strain BVFA21 was inoculated in YSB medium with 1% seed liquid inoculation amount, 200 r / min rotation speed, 37°C fermentation temperature, and 3d fermentation time. The fermentation liquid of BVFA21 was centrifuged at 4000 rpm / min for 30 min, and the supernatant was collected. The supernatant was filtered with a sterile organic phase microporous filter (0.22 μm) to obtain the sterile fermentation liquid of the antagonistic strain BVFA21. The 10% and 20% sterile fermentation filtrate of the biocontrol strain BVFA21 was used to test the inhibition activity on F. proliferatum by the mycelial growth rate method. The 5mm puncher was used to punch the pathogenic fungus cake, which was inoculated in the center of the PDA plate containing the sterile fermentation liquid. The same volume of sterile water was added as a control, and the test was repeated three times. The culture dishes were inverted and cultured in a 28°C incubator for 5 days, and the growth of the pathogenic fungi was observed. The inhibition rate was calculated according to the following formula:

[0070] Inhibition rate (%) = (diameter of pathogenic fungi in the control group - diameter of pathogenic fungi in the treatment group) / diameter of pathogenic fungi in the control group

[0071] × 100%

[0072] The experimental results showed that the sterile fermentation liquid of BVFA21 also had strong inhibition activity on F. proliferatum ( Figure 5 ), and the inhibition rates of 10% and 20% sterile filtrate of BVFA21 on F. proliferatum were 71.89% and 82.75%, respectively under the optimal fermentation conditions.

[0073] 6. Inhibition effect of the concentrated sterile fermentation liquid of BVFA21 on several plant pathogenic fungi.

[0074] The BVFA21 fermentation liquid of 1L under the optimal fermentation conditions was obtained according to the above method, and the fermentation liquid was centrifuged at 4000 rpm / min for 30 min in a 50ml sterile centrifuge tube, and the supernatant was collected.

[0075] The collected supernatant was extracted with ethyl acetate. The extraction process was as follows: an equal volume of ethyl acetate was added, mixed well with the supernatant, then placed still, and the extraction liquid was collected after separation with a separatory funnel. The extraction liquid was repeated for 3 times, and the extraction liquid was combined. The rotary evaporator was set at 50°C. The weight of the rotary evaporation collection bottle was measured before rotary evaporation, and the weight of the collection bottle after the extraction liquid was evaporated was measured. The weight of the extract was obtained, and an appropriate amount of methanol was added for extraction to obtain the active crude extract.

[0076] The BVFA21 fermentation liquid of 1L was extracted with ethyl acetate, and the extractant was combined and dried to obtain 0.89g of ethyl acetate crude extract, which was dissolved with 1ml of methanol.

[0077] The mycelial growth rate method was used to determine the antibacterial effect of 200 ug / ml and 400 ug / ml active crude extract on F. proliferatum. As shown in Figure 6 , the inhibition rate was calculated according to the following formula:

[0078] Inhibition rate (%) = (diameter of pathogen in control group - diameter of pathogen in treatment group) / diameter of pathogen in control group

[0079] × 100%

[0080] The experimental results showed that the sterile fermentation broth of BVFA21 after inactivation and concentration still had antibacterial activity. Compared with the antibacterial activity of untreated sterile fermentation broth, the concentrated sterile fermentation broth with lower concentration showed better antibacterial activity. The 200 ug / ml and 400 ug / ml active crude extract of strain BVFA21 in 1 mL / L concentrated sterile fermentation broth had an inhibition rate of 54.36% and 71.68% respectively on F. proliferatum. Figure 7

[0081] 7. Identification of the antibacterial metabolites of BVFA21.

[0082] The liquid chromatography-tandem mass spectrometry (LC-MS / MS) technique was used to analyze and identify the metabolic organic compounds produced by the fermentation broth of BVFA21 strain. According to the positive and negative base peak ion chromatograms obtained by LC-MS / MS detection (as shown in Figure 8 , Figure 9 ), the experiment was completed by e-test biological company, and the non-target metabolomics detection was performed by Panrui Yunzhi Technology (Zhengzhou) Co., Ltd. The specific method is as follows:

[0083] (1) Sample collection: The seed liquid prepared by BVFA21 strain was inoculated into a 250 ml conical flask containing 100 ml YSB at a inoculation amount of 3%, and then incubated at 32°C and 200 r / min on a constant temperature shaker for 3 days to obtain the fermentation broth. The fermentation broth was centrifuged at 4000 rpm for 30 min to obtain the supernatant, which was then filtered through a 0.22 μm microporous filter and then loaded into a sterile 10 mL centrifuge tube and quickly frozen in liquid nitrogen.

[0084] ​(2) Metabolite extraction: Metabolite extraction was performed according to the experimental method of Demurtas et al. (2021). The experimental samples were thawed at 4°C, and after thawing, the samples were vortexed for 1 min and mixed evenly. An appropriate amount of sample was accurately transferred into a 2 mL centrifuge tube. 400 μL of methanol solution was added, and vortexed for 1 min. Centrifugation was performed at 12000 rpm and 4°C for 10 min. All the supernatant was taken and transferred to a new 2 mL centrifuge tube, and concentrated and dried. 150 μL of 2-chloro-L-phenylalanine (4 ppm) solution prepared with 80% methanol water was accurately added to reconstitute the sample. The supernatant was filtered through a 0.22 μm membrane, and the filtrate was added to the detection bottle for LC-MS detection.

[0085] (3) Chromatographic conditions (Zelena et al., 2009): Thermo Vanquish ultra-high performance liquid system, using HSST3 (2.1 x 100 mm, 1.8 μm) (Waters, Milford, MA, USA) chromatographic column, flow rate of 0.3 mL / min, column temperature of 40°C, sample injection amount of 2 μL. Positive ion mode, mobile phase is 0.1% formic acid acetonitrile (B2) and 0.1% formic acid water (A2), gradient elution program is: 0-1 min, 8% B2; 1-8 min, 8%-98% B2; 8-10 min, 98% B2; 10-10.1 min, 98%-8% B2; 10.1-12 min, 8% B2. Negative ion mode, mobile phase is acetonitrile (B3) and 5 mM ammonium formate water (A3), gradient elution program is: 0-1 min, 8% B3; 1-8 min, 8%-98% B3; 8-10 min, 98% B3; 10-10.1 min, 98%-8% B3; 10.1-12 min, 8% B3.

[0086] (4) Mass spectrometry conditions (Want et al., 2013): Thermo Q Exactive Focus mass spectrometry detector (Thermo Fisher Scientific, USA), electrospray ion source (ESI), positive and negative ion modes were used to collect data respectively. The positive ion spray voltage was 3.50 kV, and the negative ion spray voltage was -2.50 kV. The sheath gas was 40 arb, and the auxiliary gas was 10 arb. The capillary temperature was 325°C, and the first order full scan was performed at a resolution of 70000, the first ion scan range was m / z 100-1000, and the HCD was used for secondary fragmentation with a collision energy of 30 eV. The secondary resolution was 7500, and the signals of the first 3 ions were collected for fragmentation, while the unnecessary MS / MS information was removed by dynamic exclusion.

[0087] (5) Data preprocessing: The raw mass spectrum file was converted to mzXML file format by MSConvert tool in Proteowizard software (v3.0.8789) (Rasmussen et al., 2022). Peak detection, peak filtering, and peak alignment were performed using the RXCMS software package (Navarro-Reig et al., 2015) to obtain the substance quantitative list. The parameter settings were bw = 2, ppm = 15, peakwidth = c(5, 30), mzwid = 0.015, mzdiff = 0.01, and method = "centWave". Data correction was achieved by total peak area normalization to eliminate systematic errors.

[0088] (6) Base peak chromatogram: The components separated by chromatography continuously entered the mass spectrometer, and the mass spectrometer continuously scanned to collect data. Each scan obtained a mass spectrum, and the strongest ion in each mass spectrum was continuously plotted with ion intensity as the vertical coordinate and time as the horizontal coordinate. The resulting graph is the base peak chromatogram (BPC).

[0089] (7) Substance identification: Spectrum databases such as HumanMetabolomeDatabase (http: / / www.hmdb.ca), massbank (http: / / www.massbank.jp / ), LipidMaps (http: / / www.lipidmaps.org), mzclound (https: / / www.mzcloud.org), KEGG (https: / / www.genome.jp / kegg / ), and the metabolite standard database built by Pan Naiyun Technology (Zhengzhou) Co., Ltd. were used for retrieval and comparison (library search). The mass-to-charge ratio of the parent ion in the first mass spectrum was used to determine the molecular weight, adduct ion, and other information of the metabolite to predict the molecular formula, which was then compared and matched with the database to achieve first-level qualitative identification of the metabolite. At the same time, the metabolites with secondary spectra in the quantitative list were compared and matched with the fragment ions and other information of each secondary spectrum in the database to achieve secondary qualitative identification of the metabolites.

[0090] 8. In vivo control effect of BVFA21 metabolites on plum pathogenic bacteria

[0091] The fruit type consistent healthy plum fruit in 70% ethanol disinfection about 40s~60s after taking out, and then washed with sterile water clean, natural dry. Take 8mm in diameter of the fungus cake inoculation in no injury plum surface, BVFA21 on the protection of plum fruit and treatment effect. Protection is first sprayed 5ml EC25, EC50, EC7524h after bacteria, treatment is first bacteria 24h after spraying concentration of EC25, EC50, EC75 BVFA21 metabolites p-methoxybenzoic acid. The specific method is as follows:

[0092] Protection: 5ml concentration of EC25, EC50, EC75 p-methoxybenzoic acid is evenly sprayed on the surface of plum fruit, placed in the bottle cap, and the bottle cap is filled with sterile water soaked in sterile cotton. Do a good job in the marked into a transparent plastic box, sealed, in 24h in the artificial climate chamber, 8mm pathogenic bacteria on the plum fruit inoculation block, the inoculation of the fruit was placed in the plastic box, cultured in artificial climate chamber, observation.

[0093] Treatment: 8mm pathogenic bacteria on the plum fruit inoculation block, the fruit after inoculation of the fruit stem down, placed in the bottle cap with moisturizing cotton, placed in a transparent plastic box, sealed, in 24h in the artificial climate chamber. 5mL concentration of EC25, EC50, EC75 p-methoxybenzoic acid was sprayed on each plum fruit, and the surface of the fruit was soaked.

[0094] After the treatment of the liquid, the plum fruit was placed in a transparent plastic box and cultured in an artificial climate chamber. Each treatment 5 fruit, repeated 3 times. After 7d, the cross method was used to measure the size of the lesion diameter, and the average value was calculated to calculate the control effect, the formula was as follows:

[0095]

[0096] 9、BVFA21 p-methoxybenzoic acid on the indoor virulence of f. proliferatum

[0097] In the sterile operation platform, twenty kinds of commercial compound were dissolved in N, N-dimethyl formamide to prepare 100000μg / mL mother liquor, and then mixed with PDA medium to make the final effective concentration of 25, 50, 100, 200, 400μg mL-1. After mixing, pour the plate and cool down for standby. 5mm fungus cake of F. proliferatum was inoculated in the center of the medium, and cultured in 5℃ constant temperature incubator for 5d in the dark. After the culture was completed, the cross method was used to measure the colony diameter (mm), and the inhibition rate was calculated, the formula was as follows (5-1), each treatment was repeated 3 times. The best active substance was selected to reduce the concentration gradient and repeat the above test to calculate the inhibition rate and carry out the follow-up test.

[0098]

[0099] As Figure 10 shown, the greater the concentration of p-methoxybenzoic acid, the more obvious the inhibition effect. The regression equation is: y = 0.3132 + 2.1854x, the correlation coefficient is 0.9856, and the 95% confidence interval is 102.0075-190.7397. The test has high reliability. Its EC50 is 139.49 μg / mL.

[0100] Figure 11 The treatment and protection effects of p-methoxybenzoic acid on F. proliferatum-infected plum fruits. The lesion control rate under the protection of p-methoxybenzoic acid was higher than that under its treatment. The lesion control rates of p-methoxybenzoic acid at concentrations of EC25, EC50, and EC75 under protection were 26.27%, 47.27%, and 57.49%, respectively; and the lesion control rates under treatment were 18.36%, 40.60%, and 51.64%, respectively. The above results show that the biocontrol strain BVFA21 has a good control effect on the lesions of F. proliferatum-infected plum fruits, and the main mode of action is protection.

[0101] 10. Sequence Listing:

[0102] Seq No. 1 16S rDNA sequence and gyrA sequence of Bacillus velezensis BVFA21

[0103] SEQUENCE LISTING

[0104] <110> Guiyang University

[0105] <120> A strain of Bacillus velezensis BVFA21 and methods and applications of high-efficiency bacteriostatic substances produced by the strain

[0106] <130> 2023

[0107] <160> 1

[0108] <170> PatentIn version 3.5

[0109] <210> 1

[0110] <211> 1407

[0111] <212> DNA

[0112] <213> Bacillus velezensis

[0113] <400> 1 (16S rDNA)

[0114] >

[0115]

[0116] <210>2

[0117] <211>2460

[0118] <212>DNA

[0119] <213>Bacillus velezensis

[0120] <400>2 (gyrA)

[0121] >YBJK2-1 (gyrA)

[0122] TGAAGTAAGAGGCATGAGCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGGCGGATTTTGTACGCAATGAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACCCGCACGGTGACTCAGCGGTTTACGAATCAATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGACACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAATGGAAATCCTCCGGGACATTACGAAAGATACGATTGATTATCAAGATAACTATGACGGCGCAGAAAGAGAACCTGTCGTCATGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCATCAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGTGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACATCCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGATCCATTACGATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTATCAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACCGATCTGCGTGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACCTGTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCTCGTGACGGACAGCCGAAGACAGCCTGCCCC 976

[0123] Conclusion: The biocontrol bacteria BVFA21 isolated from the rhizosphere soil of plum has good inhibitory activity on a variety of pathogenic fungi on kiwi, passion fruit, tobacco, rice, plum and other crops, and the strain is identified as Bacillus velezensis by morphology and molecular biology.

[0124] In addition, a stable and efficient antibacterial active substance, p-methoxybenzoic acid, is detected in the metabolites of the strain BVFA21, and low concentration of p-methoxybenzoic acid has good inhibitory activity on Botryosphaeria dothidea, Phomopsis viticola, Physalospora piricola, Rhizoctonia solani, Guignardia bidwelli and Monilinia fructicola. The in vivo experiment shows that p-methoxybenzoic acid has treatment and protection effects on the infection of F. proliferatum on plum fruits. The lesion control rate under the protection effect is higher than that under the treatment effect after 7 days of inoculation. The lesion control rates of p-methoxybenzoic acid with concentrations of EC25, EC50 and EC75 under the protection effect are 26.27%, 47.27% and 57.49% respectively, and the lesion control rates under the treatment effect are 18.36%, 40.60% and 51.64% respectively. It is shown that the biocontrol strain Bacillus velezensis BVFA21 has good application value and commercial development potential in the biological control of agricultural diseases.

[0125] The Bacillus velezensis BVFA21 is screened for the first time according to the technical scheme of the present application. It is proved by experiments that the Bacillus velezensis BVFA21, the fermentation product of the Bacillus velezensis BVFA21 and the metabolite p-methoxybenzoic acid of the Bacillus velezensis BVFA21 can effectively control the occurrence of various plant diseases and reduce the possibility of plant infection by various pathogenic fungi. It is shown that the strain has broad application prospects in the field of biological control of plant diseases and also has high development value in the development of biological control agents.

[0126] The parts not described in the present application are the known technology of those skilled in the art.

[0127] The above shows and describes the basic principles and main features of the present application and the advantages of the present application. Those skilled in the art should understand that the present application is not limited by the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application, and various changes and improvements can be made without departing from the spirit and scope of the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.

Claims

1. A fermentation process for causing Bacillus velezensis (BVFA21) to produce p- methoxybenzoic acid, characterized in that, Bacillus velezensis The method comprises the following steps: ​ S1, inoculate the Bacillus velezensis BVFA21 into YSB culture medium, and culture at a temperature of 37 DEG C, a PH of 7.2, and a shaking speed of 180 rpm for 72 hours to prepare a seed liquid; S2, the Bacillus velezensis BVFA21 seed liquid with OD 600 The Bacillus velezensis BVFA21 seed liquid with OD of 1.4-1.5 is inoculated into fresh YSB culture medium, and is fermented for 72 h under the culture condition that the temperature is 37°C, the pH is 7.2, and the shaking speed is 200 rpm. S3, centrifuge the fermentation liquid in a high-speed centrifuge at 4000 rpm for 30 minutes, filter the supernatant twice with a microporous filter membrane of 0.22 μm, and obtain a sterile fermentation liquid containing p-methoxybenzoic acid; The YSB culture medium is composed of the following raw materials: sucrose 20 g, yeast paste 20 g, beef paste 15 g, MgSO4·7H2O 0.06 g, FeSO4·7H2O 0.009 g, distilled water 1000 mL, and the PH is 7.2; and the inoculation amount of the Bacillus velezensis BVFA21 seed liquid in the YSB culture medium is 1%.

Citation Information

Patent Citations

  • Bacillus velezensis, microbial agent, biopesticide and application

    CN118516288A