Anti-nitrite related miRNA, precursor of miRNA, coding gene of precursor and application of precursor and coding gene

Abstract

The invention relates to the technical field of bioengineering, in particular to anti-nitrite related miRNA, a precursor of the miRNA, a coding gene of the precursor and application of the coding gene. The nucleotide sequence of the miRNA related to nitrite resistance is as shown in SEQ ID NO. 1, and the precursor sequence of the miRNA related to nitrite resistance is as shown in SEQ ID NO. 2. Experiments prove that miR-151 participates in the physiological process of responding to nitrite stress under acute nitrite stress, and overexpression of miR-151 can promote urea generation, assist detoxification metabolism of ammonia poisoning and relieve cell damage caused by acute nitrite. Starting from the internal regulation of responding to nitrite stress, the invention verifies that miR-151 plays an important role in resisting nitrite stress, and provides a scientific basis for the breeding of nitrite-resistant excellent varieties and the optimization of culture environment management.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to an anti-nitrite related miRNA, a miRNA precursor and a coding gene thereof and application thereof. Background Art

[0002] In the process of aquaculture, the nitrogen in the excrement and unconsumed feed of farmed organisms undergoes nitrification under the action of microorganisms. Especially in high-density farming environments, when there is insufficient dissolved oxygen in the water, ammonia nitrogen cannot be completely converted into non-toxic nitrates, but accumulates into toxic nitrites; the accumulation of nitrites has serious effects on farmed animals, such as inhibiting growth, damaging the immune system, causing tissue hypoxia and even death. Therefore, nitrite is an important inducer of stress response in aquatic organisms, which can lead to abnormal nonspecific defense mechanisms or immune responses. Taking shrimp as an example, as an important economic aquaculture species, nitrite has a significant impact on its physiological metabolism and immune ability, which may eventually cause disease outbreaks and bring huge economic losses to the aquaculture industry. In order to cope with the high concentration of nitrite environment, the expression of specific nitrite response genes or proteins in shrimp will change to enhance its tolerance.

[0003] At present, there have been some explorations in the field of bioengineering to deal with nitrite, such as the molecular markers related to the nitrite nitrogen resistance of Penaeus vannamei disclosed in Patent 202010300905.6 and the technical solution for screening thereof. By subjecting Penaeus vannamei to a nitrite nitrogen stress experiment, the hepatopancreas of surviving and dead Penaeus vannamei were collected as samples, and then the samples were used as templates for PCR amplification, and the amplified fragments were sequenced to obtain partial sequences of the hepatopancreas DNA genes and sequencing peak graphs. The sequence results were subjected to BLACT comparison to screen out base mutation sites, i.e., SNP sites, and finally SNP markers significantly related to the nitrite nitrogen resistance of Penaeus vannamei were obtained, which can be used for the selective breeding of Penaeus vannamei.

[0004] miRNA (microRNA) is a type of non-coding single-stranded RNA molecule encoded by endogenous genes and about 20-24 nt in length, which is widely present in animals and plants. Studies in recent years have shown that miRNAs regulate the expression abundance of genes at the post-transcriptional level by inhibiting mRNA translation or promoting its degradation, and participate in regulating many important biological processes such as the growth and development of eukaryotic organisms and stress response. At present, there have been attempts to apply miRNA in the field of aquaculture. For example, patent 202311284407.7 discloses a kind of application of a miRNA and its mimics of Penaeus vannamei in improving the immune ability of shrimp to stress. The miRNA and its mimics disclosed in this technical solution can effectively improve the immune ability of shrimp to stress. However, the application of miRNA in resistance to nitrite is still unclear, and there is an urgent need to find miRNAs related to resistance to nitrite, which is of great significance for revealing the response mechanism and regulatory network of shrimp under nitrite stress. Summary of the invention

[0005] The present invention aims to overcome the defects in the prior art that the role of miRNA in resistance to nitrite is still unclear, and the response mechanism and regulatory network under nitrite stress are still unclear. The present invention provides an anti-nitrite related miRNA, miRNA precursor and its encoding gene and application to overcome the above defects.

[0006] In order to achieve the purpose of the above invention, the present invention is implemented by the following technical solutions: In a first aspect, the present invention discloses anti-nitrite related miRNA, the nucleotide sequence of the miRNA is shown as SEQ ID NO.1.

[0007] In order to overcome the impact of nitrite, an environmental factor, RNA-seq technology was used to comprehensively analyze the differences in the expression profiles of mRNA and microRNAs (miRNAs) before and after nitrite stress, and to find genes and miRNAs related to nitrite resistance, which is of great significance for revealing the response mechanism and regulatory network of shrimp under nitrite stress. The present invention analyzes the expression profile of hepatopancreas miRNA after nitrite stress by RNA-seq high-throughput sequencing technology, and a nitrite stress response miRNA screened out is named miR-151, and its sequence is shown in SEQ ID NO.1.

[0008] In a second aspect, the present invention further discloses an anti-nitrite related miRNA precursor (pre-miRNA), the nucleotide sequence of the miRNA precursor is shown as SEQ ID NO.2.

[0009] In a third aspect, the present invention further discloses a gene related to resistance to nitrite, which can encode the miRNA of the first aspect of the present invention, or can encode the precursor of the miRNA of the second aspect of the present invention.

[0010] In a fourth aspect, the present invention further discloses an RNA molecule, which contains the gene described in the third aspect of the present invention, and the RNA molecule contains the sequence shown in SEQ ID NO. 3. The RNA molecule is a primary transcription product (pri-miRNA), with a length of 311-nt, which contains a precursor sequence, a mature body sequence and a hairpin structure, and can become a hairpin structure precursor miRNA (pre-miRNA) after being cleaved by an enzyme.

[0011] In a fifth aspect, the present invention further discloses the use of the nitrite-resistant related gene as described in the third aspect or the RNA molecule as described in the fourth aspect of the present invention in breeding nitrite-resistant animals.

[0012] Further, in the application described in the fifth aspect of the present invention, the resistance to nitrite is specifically embodied in at least one of the following I, II, and III: Ⅰ. Under nitrite environment, the cumulative mortality of organisms overexpressing miRNA such as SEQ ID NO.1 is lower than that of the target organism; II. Under nitrite environment, the total number of blood cells of the organism overexpressing the miRNA of SEQ ID NO.1 is higher than that of the target organism; III. Under nitrite environment, the hepatopancreatic vacuoles of the organism overexpressing the miRNA of SEQ ID NO.1 were lower than those of the target organism; The target organisms are invertebrate crustaceans.

[0013] Furthermore, the target organism is shrimp.

[0014] In a sixth aspect, the present invention further discloses the use of the anti-nitrite related gene as described in the third aspect or the RNA molecule as described in the fourth aspect of the present invention in helping animals resist nitrite stress damage.

[0015] In a seventh aspect, the present invention further discloses the role of the anti-nitrite related gene as described in the third aspect or the RNA molecule as described in the fourth aspect of the present invention in promoting urea production in animals.

[0016] Therefore, the present invention has the following beneficial effects: (1) The present invention discloses that under acute nitrite stress, the transcriptional levels of miR-151 and its precursors are increased, proving that miR-151 is involved in the physiological process of shrimp response to nitrite stress.

[0017] (2) The present invention found in experiments on overexpression and silencing of miR-151 that overexpression of miR-151 can promote urea production, assist in the detoxification metabolism of ammonia poisoning, alleviate acute nitrite-induced cell damage, and reduce mortality.

[0018] (3) The present invention is of great significance for enriching the types and quantities of crustacean miRNAs and deeply understanding the cellular molecular mechanisms involved in miRNAs related to shrimp resistance to nitrite stress, thereby further understanding the molecular regulatory mechanisms of shrimp resistance to adverse stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a diagram of the sequence structure characteristics and homologous evolution analysis of pri-miR-151.

[0020] Figure 2 Schematic diagram of the expression pattern of miR-151 and pri-miR-151 after nitrite stress.

[0021] Figure 3 Schematic diagram of the changes in shrimp mortality after overexpression and silencing of miR-151.

[0022] Figure 4 Schematic diagram of the changes in the total number of hemocytes in shrimp after overexpression and silencing of miR-151.

[0023] Figure 5 Schematic diagram of the changes in ammonia content in the hepatopancreas after overexpression and silencing of miR-151.

[0024] Figure 6 Schematic diagram of the changes in urea in the hepatopancreas after overexpression and silencing of miR-151.

[0025] Figure 7 H&E images of hepatopancreatic damage after overexpression and silencing of miR-151. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with specific embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art without creative work based on the embodiments in the present invention should belong to the scope of protection of the present invention. The experimental methods in the following embodiments are conventional methods unless otherwise specified. The test materials used in the following embodiments are purchased from conventional reagent stores unless otherwise specified. The quantitative experiments in the following embodiments are all set up for three repeated experiments, and the results are averaged.

[0027] Cloning and bioinformatics analysis of miR-151: 1. Vannamei shrimp were purchased from the shrimp breeding base in Panyu District, Guangdong Province, and placed in a pond for acclimatization with circulating seawater for two weeks (salinity 5%, pH 7.4, temperature 23℃-25℃), and fed with commercial feed three times a day.

[0028] 2. Randomly select three healthy shrimps (length 6.1 ± 0.6 cm, weight 5.2 ± 0.9 g) that have been adapted to the environment in step 1, and take their blood, liver, muscle, gills, heart, eyes, stomach, and intestines and freeze them in liquid nitrogen for subsequent experiments.

[0029] 3. The total RNA of each tissue extracted in step 2 was detected by Nanodrop. The absorbance 260 / 280 was 1.9. The results of 1.5% agarose gel electrophoresis showed that the brightness ratio of 28S to 18S was greater than 1:1, and there was no degradation tailing phenomenon, indicating that the extracted total RNA was of good quality.

[0030] 4. Use PrimeScript RTreagent kit with gDNA Eraser kit and total RNA from each tissue in step 3 to synthesize the first strand of cDNA. Take 1 μL of each in a PCR tube, mix well and dilute 5 times. Use this cDNA as a template and use primers composed of F1 / R1 to clone pri-miR-151 by PCR and verify it by Sanger sequencing. The mold Webserver was used to detect the hairpin structure of pre-miR-151, ClustalW2 software was used for multiple sequence alignment, and MEGA5.1 software package was used to construct a phylogenetic tree based on the sequence alignment.

[0031] Among them, the sequence of F1 is: GGCGGTCGGGTCTCTCAGTG; The sequence of R1 is GTTCTGAAGAGAGAGGGATG.

[0032] The results are as follows Figure 1 As shown in Figure 1, pri-miRNA contains a 63-nt precursor sequence (pre-miR-151), a 22-nt mature sequence (miR-151), and a hairpin structure. The mature and precursor sequences are relatively conserved in multiple species, and the phylogenetic tree shows that miR-151 is divided into two different branches: vertebrates and invertebrates.

[0033] To explore the expression pattern of miRNA-151 in nitrite stress, nitrite stress experiments were performed to show the changes in miRNA-151 and its precursors after nitrite stress.

[0034] 1. The healthy shrimps after two weeks of acclimatization were randomly divided into different groups and transferred to the nitrite environment as the experimental group and the non-nitrite environment as the control group. After different nitrite stress times (0, 6 and 12 h), the hepatopancreas tissues of three shrimps were randomly taken from each group and quickly frozen at -80 ℃ in liquid nitrogen for later use.

[0035] 2. Total RNA was extracted from the hepatopancreas samples during the above time period, and the first strand of cDNA was synthesized using the reverse transcription kit as described above. Using cDNA as a template, RT-PCR was performed using primers F2 and R2 to detect miR-151, and primers F3 and R3 were used to perform RT-PCR to detect U6 (reference gene); RT-PCR was performed using primers F4 and R4 to detect pri-mir-151, and primers F5 and R5 were used to perform RT-PCR to detect actin (reference gene). The relative expression levels of miR-151 and pri-mir-151 are shown in Figure 2 The results showed that the expression level of miR-151 decreased after 6 h of nitrite stress, and the expression level continued to increase during 0-6 h of nitrite stress.

[0036] Among them, the sequence of F2 is GGACCCCTAGACTGAAGCTCCT; The sequence of R2 is CCAGTGCGTGTCGTGGAGT; The sequence of F3 is CTCGCTTCGGCAGCACA; The sequence of R3 is AACGCTCACGAATTTGCGT; The sequence of F4 is GATTGCCTGCCAGTTTCTACA; The sequence of R4 is GTTCTTGCACTTTTCCCTTTC; The sequence of F5 is ACAAGATGTGTGACGACGAAGTA; The sequence of R5 is CCGACGATGGAGGGGAA.

[0037] To demonstrate the role of miRNA-151 in response to nitrite stress, the following experiments were performed: 1. Mortality detection of shrimp after overexpression and silencing of miR-151 1. To silence miR-151, the 5' end of the single-stranded RNA was modified with phosphothioate (PS), the 3' end was modified with phosphothioate (PS) and cholesterol, and all nucleotides were modified with 2'-O-methyl (2'-O-Me) as the Ant-151 silencing sequence F6. Ant-NC was similarly modified as the control F7. They were injected into the muscles of healthy shrimp at 10 nmoL / g. The mortality of shrimp at different time points after nitrite stress (0, 3, 6 and 12 h) was detected, and the experiment was repeated 3 times.

[0038] 2. To overexpress miR-151, the 5' end of the double-stranded RNA was modified with phosphothioate (PS), the 3' end was modified with phosphothioate (PS) and cholesterol, and the antisense nucleotides were modified with 2'-O-methyl (2'-O-Me) as ago-151 overexpression sequence F8. Ant-NC was similarly modified as control F9. They were injected into the muscles of healthy shrimp at 10 nmoL / g. The mortality of shrimp at different time points after nitrite stress (0, 3, 6 and 12h) was detected, and the experiment was repeated 3 times. Figure 3 As shown, the results showed that nitrite stress significantly increased the mortality of shrimp, overexpression of miR-151 could significantly reduce the mortality of shrimp, while silencing miR-151 significantly increased the mortality of shrimp after nitrite stress, indicating that miR-151 can play a role in improving the ability to resist nitrite.

[0039] Among them, the sequence of F6 is 5′- CCUCAAAGAGCUUCAGUCCAGU-3′; The sequence of F7 is 5′- CAGUACUUUGUGUAGUACAA-3′; The sequence of F8 is 5′- ACUGGACUGAAGCUCUUUGAGG-3′; The sequence of F9 is 5'-UUCUCCGAACGUGUCACGUUU-3'.

[0040] 2. Detection of total blood cell count in shrimp after overexpression and silencing of miR-151 The overexpression and silencing methods are as described in steps 1 and 2 of the above shrimp mortality test. Take the blood cells of shrimp at each time point after nitrite stress (0, 6 and 12 h), and mix them with anticoagulant at a ratio of 1:1 and dilute them to 2 times. Place the coverslip on the hemocytometer, use a pipette to draw 10 μL of shrimp blood and drop it in the center of the coverslip to cover the entire counting grid. Place the hemocytometer under an optical microscope to count the blood cells. Figure 4 As shown, the results showed that under nitrite stress, overexpression of miR-151 significantly counteracted the decreasing trend of total blood cell count, whereas silencing of miR-151 significantly reduced the total blood cell count.

[0041] 3. Detection of ammonia content in the hepatopancreas after overexpression and silencing of miR-151 The overexpression and silencing methods are as described in steps 1 and 2 of the above shrimp mortality test. Take the hepatopancreas of shrimp at each time point after nitrite stress (0, 6 and 12 h) and the overexpression and silencing groups, and measure the ammonia content according to the instructions of the ammonia content determination kit (Suzhou Grace Biotechnology Co., Ltd., G0436W). Use a microplate reader to measure the OD value and enter it into the calculation formula to obtain the ammonia level in the hepatopancreas. Figure 5 As shown, the results showed that under nitrite stress, overexpression of miR-151 significantly increased the ammonia content in the hepatopancreas, while silencing of miR-151 significantly decreased the ammonia content in the hepatopancreas.

[0042] 4. Detection of urea content in the hepatopancreas after overexpression and silencing of miR-151 The overexpression and silencing methods were as described in steps 1 and 2 of the above shrimp mortality test. The hepatopancreas of shrimps at different time points after nitrite stress (0, 6 and 12 h) were taken, and the urea content was determined according to the instructions of the urea content determination kit (Suzhou Grace Biotechnology Co., Ltd., G1201W). The OD value was determined using an enzyme marker and the urea level in the hepatopancreas was obtained by entering the calculation formula. Figure 6 As shown, the results showed that under nitrite stress, overexpression of miR-151 significantly increased the urea content in the hepatopancreas, while silencing of miR-151 significantly decreased the urea content in the hepatopancreas.

[0043] 5. Identification of hepatopancreatic damage after overexpression and silencing of miR-151 The overexpression and silencing methods were as described in steps 1 and 2 of the above shrimp mortality test. After nitrite stress (0, 6 and 12h), the hepatopancreas of shrimp in the overexpression and silencing groups at each time point were fixed in 4% paraformaldehyde for 24h. Then the tissue was flattened and placed in a dehydration box for dehydration and wax immersion. After embedding, it was cut into 4 μm thick sections and stained with H&E (hematoxylin-eosin), and finally dehydrated and sealed. The morphological changes in the sliced ​​tissue were observed under a microscope and images were collected. Nitrite can cause an increase in vacuolated cells and cell atrophy. Silencing minR-151 seems to accelerate this pathology. For example, vacuoles appeared 6h after nitrite stress, while vacuoles appeared in the NC group at 6h. In contrast, after miR-151 overexpression, vacuolated cells first appeared at 6h compared with the control group. As Figure 7 Shown is the identification of hepatopancreas damage after overexpression and silencing of miR-151 under nitrite environment.

[0044] Finally, it should be noted that the above experiments and embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A miRNA related to anti-nitrite, characterized in that: The nucleotide sequence of the miRNA is shown as SEQ ID NO.

1.

2. An anti-nitrite-related miRNA precursor as claimed in claim 1, characterized in that: The nucleotide sequence of the miRNA precursor is shown in SEQ ID NO.

2.

3. A gene related to nitrite resistance, characterized in that: The gene encodes the miRNA according to claim 1, or encodes the precursor of the miRNA according to claim 2.

4. An RNA molecule containing the gene as claimed in claim 3, characterized in that: The RNA molecule includes the sequence shown in SEQ ID NO.

3.

5. Use of the anti-nitrite related gene as claimed in claim 3 or the anti-nitrite related RNA molecule as claimed in claim 4 in breeding nitrite-resistant animals.

6. The use according to claim 5, characterized in that: The nitrite resistance is specifically embodied in at least one of the following I, II, and III: Ⅰ. Under nitrite environment, the cumulative mortality of organisms overexpressing miRNA such as SEQ ID NO.1 is lower than that of the target organism; II. In a nitrite environment, the total number of blood cells in the organism overexpressing the miRNA of SEQ ID NO.1 is higher than that of the target organism; III. Under nitrite environment, the hepatopancreatic vacuoles of the organism overexpressing the miRNA of SEQ ID NO.1 were lower than those of the target organism; The target organisms are invertebrate crustaceans.

7. The use according to claim 6, characterized in that: The invertebrate crustacean is a prawn.

8. Use of the anti-nitrite-related gene as claimed in claim 3 or the anti-nitrite-related RNA molecule as claimed in claim 4 in helping animals resist nitrite stress damage.

9. The role of the nitrite resistance-related gene as claimed in claim 3 or the nitrite resistance-related RNA molecule as claimed in claim 4 in promoting urea production in animals.

Images