Adenosine production strain as well as construction method and application thereof

Abstract

The invention provides an adenosine production strain as well as a construction method and application thereof. After a gene for coding UDP-N-acetyl muracoyl-L-alanine-D-glutamic acid-2, 6-diamino dimer ligase in bacillus subtilis or bacillus amyloliquefaciens is modified (strengthened), the adenosine production capacity of the strain is enhanced compared with that of an unmodified strain. After the coding gene of the UDP-N-acetyl muramyl-L-alanine-D-glutamic acid-2, 6-diamino dimer ligase is introduced into a P43 promoter, the transcriptional level of MurE is improved by 46%, and the adenosine productivity is improved by 10.2%; the 252nd amino acid is mutated into isoleucine except valine, and the productivity of leucine and adenosine is improved by 5.1% and 7.7% respectively.

Description

Technical Field

[0001] The invention relates to the fields of bioengineering and microbial fermentation, and in particular to an adenosine production strain and a construction method and application thereof. Background Art

[0002] Nucleoside is a general term for a class of glycosides. Nucleoside is a component of nucleic acid and nucleotide. Nucleoside is formed by the condensation of D-ribose or DZ-deoxyribose with pyrimidine base or purine base. Nucleoside is generally a colorless crystal, insoluble in common organic solvents, easily soluble in hot water, with a melting point of 160-240°C. Nucleosides generated from D-ribose are called ribonucleosides, which participate in the composition of RNA, and nucleosides generated from D-α-deoxyribose are called deoxyribonucleosides, which participate in the composition of DNA. D-ribose condenses with adenine, guanine, cytosine, thymine or uracil to generate the corresponding adenine ribonucleoside, guanine ribonucleoside, cytosine ribonucleoside, thymine ribonucleoside and uracil ribonucleoside, which are respectively referred to as adenosine (A), guanosine (G), cytidine (C), thymidine (T) and uridine (U).

[0003] Guanosine (guanosine) and inosine (inosine) play a wide range of roles in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively. Disodium guanylate and disodium inosinate are used in combination as food flavor enhancers, and are widely used in condiments such as chicken essence and soy sauce. In the pharmaceutical field, guanosine and inosine can be used as pharmaceutical intermediates for a variety of antiviral drugs, such as acyclovir, triazole nucleoside, and sodium guanosine triphosphate, which all require guanosine as a synthetic raw material. Inosine is an important precursor of inosinic acid, and inosinic acid can be used as a precursor for the synthesis of adenosine (AMP) and guanylate (GMP), which is suitable for leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, etc. caused by various reasons. In addition, it can also treat central retinitis and optic atrophy.

[0004] Adenosine is adenine nucleoside, and its chemical name is 6-amino-9-β-D-ribofuranosyl-9-hydrogen purine. It is the product of adenine nucleotide dephosphorylation and is an important nucleotide derivative. Adenosine is an endogenous nucleoside that is found throughout human cells. It can directly enter the myocardium and generate adenosine acid through phosphorylation, and participate in myocardial energy metabolism. It also participates in dilating coronary vessels and increasing blood flow. Adenosine has physiological effects on the cardiovascular system and many other systems and tissues of the body. In addition to being used as a specific drug for treating the heart, adenosine is also an important intermediate for the synthesis of adenosine triphosphate (ATP), adenine, adenosine acid, and adenosine arabinoside, and is widely used in the pharmaceutical and other industries.

[0005] At present, microbial fermentation is the main method for producing nucleosides, and the main microorganisms used include Bacillus subtilis, Bacillus amyloliquefaciens or Bacillus pumilus. In the process of selecting and transforming the growing strains, ultraviolet mutagenesis and diethyl sulfate mutagenesis breeding are used to selectively select high-yielding strains of nucleosides; or according to the metabolic pathways and regulatory mechanisms of nucleotides in bacteria, the genetic background and characteristics of the strains are deeply understood, and the strains are purposefully transformed through metabolic engineering methods to obtain production strains with excellent traits and high nucleoside production. However, the fermentation performance of nucleoside strains is still poor, and the conversion rate of nucleosides is still low, which cannot meet the needs of large-scale industrial production. Summary of the invention

[0006] The purpose of the present invention is to provide an adenosine production strain and a construction method and application thereof.

[0007] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a modified microorganism, wherein the activity of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diamino dimer ligase is enhanced compared to an unmodified microorganism, and the microorganism has an enhanced adenosine production capacity compared to an unmodified microorganism.

[0008] In the present invention, the reference sequence number of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase on NCBI is NP_389401.1.

[0009] Further, the activity enhancement of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase in the microorganism is achieved by selecting from the following 1)-3), or an optional combination:

[0010] 1) by changing the promoter of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0011] 2) enhanced by changing the amino acid sequence of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0012] 3) Enhanced by changing the nucleotide sequence encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase.

[0013] Furthermore, methods such as mutagenesis, site-directed mutagenesis or homologous recombination can be used to enhance the expression of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase.

[0014] In a specific embodiment of the present invention, the enhancement of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase activity is achieved by the following A or B:

[0015] A. operably linking the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase to a P43 promoter;

[0016] B. Mutating the amino acid at position 252 of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase to an amino acid other than valine (preferably mutating valine to isoleucine or leucine).

[0017] The microorganism can be Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli, etc. For example, the starting strain is B. subtilis 168, B. subtilis A5 (the construction method of strain B. subtilis A5 is shown in CN110257315B).

[0018] In a second aspect, the present invention provides a method for constructing an adenosine-producing strain, the method comprising: using genetic engineering means to strengthen the coding gene of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase in a microorganism having nucleoside production ability.

[0019] The strengthening can be achieved by selecting from the following a) to c), or any combination thereof:

[0020] a) enhancing by changing the promoter of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0021] b) enhanced by changing the amino acid sequence of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0022] c) enhanced by changing the nucleotide sequence encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase.

[0023] The enhancement method can be selected from at least one of mutagenesis, site-directed mutagenesis, homologous recombination, and the like.

[0024] Preferably, strengthening is achieved by ①, ② or ③ as follows:

[0025] ① operably linking the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase to the P43 promoter;

[0026] ② The 252nd amino acid of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is mutated from valine to isoleucine;

[0027] ③ The 252nd amino acid of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is mutated from valine to leucine;

[0028] In a third aspect, the present invention provides an adenosine-producing strain constructed according to the method.

[0029] In a fourth aspect, the present invention provides the use of the microorganism or the adenosine-producing strain constructed according to the method in the fermentation production of adenosine or adenosine derivatives or in increasing the fermentation yield of adenosine or adenosine derivatives.

[0030] The adenosine derivatives of the present invention include but are not limited to adenosine triphosphate (ATP), adenine, adenylic acid, and adenosine arabinoside.

[0031] In a fifth aspect, the present invention provides a method for producing adenosine, the method comprising the following steps:

[0032] i) culturing the microorganism or the adenosine-producing strain constructed according to the method to obtain a culture;

[0033] ii) collecting the produced adenosine from the culture obtained in step i).

[0034] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0035] The present invention provides a Bacillus subtilis or Bacillus amyloliquefaciens, wherein the gene encoding UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diamino dimer ligase is modified (enhanced), so that the ability of the strain to produce adenosine is enhanced compared with that of an unmodified strain. After the gene encoding UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diamino dimer ligase is introduced into an artificially synthesized P43 promoter, the transcription level of MurE is increased by 46%, and the adenosine production capacity is increased by 10.2%; the 252nd amino acid is mutated to isoleucine and leucine other than valine, and the adenosine production capacity is increased by 5.1% and 7.7% respectively. DETAILED DESCRIPTION

[0036] The present invention aims to provide a method for constructing an adenosine-producing strain and application thereof.

[0037] The present invention adopts the following technical solution:

[0038] The present invention provides a modified microorganism, wherein the activity of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is enhanced compared to an unmodified microorganism, and the microorganism has enhanced adenosine production capacity compared to an unmodified microorganism, including murE promoter enhancement (such as promoter replacement), start codon replacement, point mutation, etc.

[0039] In the present invention, the reference sequence number of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase on NCBI is NP_389401.1, which is encoded by the murE gene, Gene ID: 937567.

[0040] At present, there is no report on the ability of microorganisms to produce adenosine by modifying UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase. The present invention is the first to modify the enzyme in Bacillus subtilis or Bacillus amyloliquefaciens to obtain a corresponding mutant that can efficiently produce adenosine, and successfully create a microorganism that can efficiently produce adenosine.

[0041] Further, the activity enhancement of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase in the microorganism is achieved by selecting from the following 1)-3), or an optional combination:

[0042] 1) by changing the promoter of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0043] 2) enhanced by changing the amino acid sequence of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0044] 3) Enhanced by changing the nucleotide sequence encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase.

[0045] Furthermore, the expression of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is enhanced by using mutagenesis, site-directed mutagenesis or homologous recombination.

[0046] In a specific embodiment of the present invention, the enhancement of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase activity is achieved by the following AC:

[0047] A. The gene encoding UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase was introduced into the artificially synthesized P43 promoter;

[0048] B. the amino acid 252 of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is mutated to an amino acid other than valine, preferably isoleucine;

[0049] C. The 252nd amino acid of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is mutated to an amino acid other than valine, preferably leucine.

[0050] The microorganism can be Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli, etc. For example, the starting strain is B. subtilis 168, B. subtilis A5 (the construction method of strain B. subtilis A5 is shown in CN110257315B).

[0051] The present invention also provides a method for constructing an adenosine-producing strain, which comprises: using genetic engineering means to strengthen the coding gene of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diamino dimer ligase in a microorganism with nucleoside production ability.

[0052] The strengthening is selected from the following a)-c), or an optional combination thereof:

[0053] a) enhancing by changing the promoter of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0054] b) enhanced by changing the amino acid sequence of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0055] c) enhanced by changing the nucleotide sequence encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase;

[0056] The enhancement method can be selected from at least one of mutagenesis, site-directed mutagenesis, homologous recombination, and the like.

[0057] Preferably, strengthening is achieved by ① or ② or ③ as follows:

[0058] ① The gene encoding UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase was introduced into the artificially synthesized P43 promoter;

[0059] ② The 252nd amino acid of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase was mutated from valine to isoleucine;

[0060] ③The 252nd amino acid of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase mutated from valine to leucine.

[0061] The present invention also provides a recombinant bacterium constructed according to the method.

[0062] The present invention also provides the use of the microorganism or the recombinant bacteria constructed according to the method in the fermentation production of adenosine or adenosine derivatives, guanosine or in increasing the fermentation yield of adenosine or adenosine derivatives, guanosine.

[0063] The adenosine derivatives of the present invention include but are not limited to adenosine triphosphate (ATP), adenine, adenylic acid, and adenosine arabinoside.

[0064] The present invention also provides a method for producing adenosine, the method comprising the following steps:

[0065] i) culturing the microorganism or the recombinant bacteria constructed according to the method to obtain a culture;

[0066] ii) collecting the produced adenosine from the culture obtained in step i).

[0067] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0068] The amino acid sequence of wild-type Bacillus subtilis UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase MurE is shown in SEQ ID NO: 1. Mutant MurE V252IThe amino acid sequence of MurE is shown in SEQ ID NO: 2 (the 252nd amino acid of MurE is mutated from valine to isoleucine). V252L The amino acid sequence of MurE is shown in SEQ ID NO:3 (the amino acid at position 252 of MurE is mutated from valine to leucine). The nucleotide sequences corresponding to the wild-type MurE and the MurE mutant are shown in SEQ ID NO:4-7, respectively (SEQ ID NO:6 and 7 encode the mutant MurE V252L ).

[0069] The DNA polymerase, DNA purification kit, restriction endonuclease, DNA ligase and other molecular biological reagents used in the present invention were purchased from Beijing Quanshijin Company (https: / / www.transgen.com / ), and other biochemical reagents used were purchased from Sangon Biotechnology (Shanghai) Co., Ltd. (http: / / www.sangon.com / ).

[0070] The names and sequences of the primers involved in the following examples are shown in Table 1. The primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. (http: / / www.sangon.com / ).

[0071] Table 1 Primer names and sequence information used in the examples of the present invention

[0072] Primer Name Primer Sequence (5′-3′) MurE-1f ACAAAATAAGGATCCTCTAGACCATATTGTATCATTTATCGG MurE-1r CTTTAGCAAGAGGGTGATGTTTGTCCGTATCAAACCTCTCAACATTCTAA P43-murE-f TTAGAATGTTGAGAGGTTTGATACGGACAAACATCACCCTCTTGCTAAAG P43-murE-r ATGTAAGCAGCTTTGTAAGTTTCATGTGTAAATTCCTCCCTTACCTTTAAT MurE-2f ATTAAAGGTAAGGGAGGAATTTACACATGAAACTTACAAAGCTGCTTACAT MurE-2r GCCAAGCTTGCATGCCTGCAGCGGCAATATCATAATCACAG <![CDATA[MurE V252I -1f]]> ACAAAATAAGGATCCTCTAGAGAATGTTCCTGTTATTATTG <![CDATA[MurE V252I -1r]]> TATGTAGAGATATGCGCAGCTGTTATCTTTTCAAAATAAGCGCTCGCCTC <h2 style=";text-align:left;direction:ltr"><![CDATA[MurE <h2 style=";text-align:left;direction:ltr"> V252I <h2 style=";text-align:left;direction:ltr"> -2f]]><h2 style=";text-align:left;direction:ltr"> GAGGCGAGCGCTTATTTTGAAAAGATAACAGCTGCGCATATCTCTACATA <![CDATA[MurE V252I -2r]]> GCCAAGCTTGCATGCCTGCAGTACTCCGGCTTCCATATCTC <![CDATA[MurE V252L -1f]]> ACAAAATAAGGATCCTCTAGAGAATGTTCCTGTTATTATTG <![CDATA[MurE V252L -1r]]> TATGTAGAGATATGCGCAGCTGTTAGCTTTTCAAAATAAGCGCTCGCCTC <h2 style=";text-align:left;direction:ltr"><![CDATA[MurE <h2 style=";text-align:left;direction:ltr"> V252L <h2 style=";text-align:left;direction:ltr"> -2f]]><h2 style=";text-align:left;direction:ltr"> GAGGCGAGCGCTTATTTTGAAAAGCTAACAGCTGCGCATATCTCTACATA <![CDATA[MurE V252L -2r]]> GCCAAGCTTGCATGCCTGCAGTACTCCGGCTTCCATATCTC <h2 style=";text-align:left;direction:ltr"><![CDATA[MurE <h2 style=";text-align:left;direction:ltr"> V252L <h2 style=";text-align:left;direction:ltr"> -3f]]><h2 style=";text-align:left;direction:ltr"> ACAAAATAAGGATCCTCTAGAGAATGTTCCTGTTATTATTG <h2 style=";text-align:left;direction:ltr"><![CDATA[MurE <h2 style=";text-align:left;direction:ltr"> V252L <h2 style=";text-align:left;direction:ltr"> -3r]]><h2 style=";text-align:left;direction:ltr"> TATGTAGAGATATGCGCAGCTGTTAACTTTTCAAAATAAGCGCTCGCCTC <![CDATA[MurE V252L -4f]]> GAGGCGAGCGCTTATTTTGAAAAGTTAACAGCTGCGCATATCTCTACATA <![CDATA[MurE V252L -4r]]> GCCAAGCTTGCATGCCTGCAGTACTCCGGCTTCCATATCTC MurE-F ATGAAACTTACAAAGCTGCTT MurE-R CTATGAATTCGTCTTATTCTT

[0073] Example 1 Construction of MurE promoter-enhanced strain

[0074] The genome of strain B. subtilis A5 (for the construction method of strain B. subtilis A5, see CN110257315B) was used as a template, and the MurE-1f / MurE-1r, MurE-2f / MurE-2r primer pairs and pfu high-fidelity DNA polymerase were used to amplify the upstream and downstream homologous arms MurE-F and MurE-R of the murE gene. The PBE43 plasmid (PBE43 plasmid was fully gene synthesized, see Effects of overexpression of key enzyme genes on guanosine accumulation in Bacillus amyloliquefaciens) was used as a template, and the P43-murE-f / P43-murE-r primer pair and pfu high-fidelity DNA polymerase were used to amplify the P43 fragment. MurE-F, MurE-R, and P43 fragments were recovered by gel fusion and amplified to obtain P43-murE fragment, which was recovered by gel fusion. The pKSU plasmid (pKSU plasmid was kindly donated by Professor Wang Shufang of Nankai University, see A markerless gene replacement method for B. amyloliquefaciens LL3 and its use ingenome reduction and improvement of poly-γ-glutamic acid production [J], Applied Microbiology and Biotechnology, 2014, 98 (21): 8963-8973. Zhang W, Gao W, Feng J, et al DOI: 10.1007 / s00253-014-5824-2) was double-digested with XbaI / PstI and recovered by gel fusion. The linearized plasmid and P43-murE fragment after enzyme digestion were assembled using an assembly kit and transformed into TransT1 competent medium. The recombinant plasmid pKSU-P43-murE was identified and screened later. The plasmid was transformed into B. subtilis A5 strain, and the transformants were screened at 30°C using LB plates containing 2.5μg / mL chloramphenicol. The obtained transformants were inoculated into 5ml LB liquid medium, cultured at 42°C and 200rpm for 12h and propagated for one generation, and diluted and coated on LB plates containing 5μg / mL chloramphenicol to obtain a primary recombinant; the primary recombinant was inoculated into 5ml LB liquid medium, cultured at 42°C and 200rpm for 12h and propagated for one generation, and diluted and coated on LB plates containing 0.8μM 5-fluorouracil (5-FU) to screen the secondary recombinant, and the MurE promoter enhanced mutant strain was screened and named A551.

[0075] Example 2 MurE V252I Construction of mutant strains

[0076] The genome of strain B. subtilis A5 was used as template and MurE V252I -1f / MurE V252I -1r,MurE V252I -2f / MurE V252I -2r primer pair, pfu high-fidelity DNA polymerase amplified the upstream and downstream homologous arms of the MurE gene. The obtained fragments were recovered by gel recovery and fused, and the MurE was amplified. V252I The fragments were recovered by gel recovery. The plasmid pKSU-MurE was constructed according to the construction method in Example 1. V252I and transformed it into B. subtilis A5 strain to obtain a mutant strain in which the amino acid at position 252 of MurE was mutated from valine to isoleucine (MurE V252I The encoding gene is SEQ ID NO: 5), named A553.

[0077] Example 3 MurE V252L Construction of mutant strains

[0078] The genome of strain B. subtilis A5 was used as template and MurE V252L -1f / MurE V252L -1r、MurE V252L -2f / MurE V252L -2r primer pair, pfu high-fidelity DNA polymerase amplified the upstream and downstream homologous arms of the MurE gene. The obtained fragments were recovered by gel recovery and fused, and the MurE was amplified. V252L The fragments were recovered by gel recovery. The plasmid pKSU-MurE was constructed according to the construction method in Example 1. V252L and transformed it into B. subtilis A5 strain to obtain a mutant strain in which the amino acid at position 252 of MurE was mutated from valine to leucine (MurE V252L The encoding gene is SEQ ID NO: 6), named A555.

[0079] According to the above method, primer pair MurE V252L -1f / MurE V252L -1r、MurE V252L -2f / MurE V252L -2r replaced by MurE V252L -3f / MurE V252L -3r, MurE V252L -4f / MurE V252L-4r, a mutant strain in which the amino acid at position 252 of MurE was mutated from valine to leucine was constructed (MurE V252L The encoding gene is SEQ ID NO:7), named A557.

[0080] Example 4 Gene transcription level test

[0081] The mutant strains A551, A553, A555, A557 obtained in Examples 1-3 above, and the starting strain B. subtilis A5 were cultured overnight in LB medium, and the cells were collected. Total RNA was extracted according to the instructions of the kit TakaRa RNAiso Plus Code No. 9108, and the kit TakaRa PrimeScript TM RT reagent Kit Code No.RR037A instructions for reverse transcription, transcribe RNA into cDNA, and finally follow the kit TakaRa TB Premix Ex Taq TM The PCR reaction system was prepared according to the IICode No.RR820A instruction manual, the primers were MurE-F / MurE-R, and the Real Time PCR reaction was performed. The data analysis results are shown in Table 2.

[0082] Table 2 Relative values ​​of transcription levels of mutant strains compared with the original strain

[0083] Relative Value of Transcription Level Increase Range B.subtilis A5 1 - A551 1.46 46％ A553 1.13 13％ A555 1.20 20％ A557 1.19 19％

[0084] From the results, it can be seen that the transcription level of MurE changed significantly after modification, and the intensity was A551>A555>A557>A553>B. subtilis A5, that is, after modification by the method described in Examples 1-3, the MurE mutants were all enhanced.

[0085] Example 5 Shake flask fermentation to produce nucleosides

[0086] 1. Take 50uL of glycerol culture stored at -80℃, inoculate it into a test tube containing 5mL LB medium (yeast powder 10g / L, peptone 5g / L, sodium chloride 10g / L, pH7.0-7.2, sterilized at 121℃ for 20min), and culture it at 37℃ and 220r / min for 16h; pick the bacterial liquid from the test tube, streak the LB sterile plate, and culture it at 37℃ for 36h to grow a single colony.

[0087] 2. Pick a single colony and inoculate it into 30 mL of seed culture medium (20 g / L glucose, 6 g / L yeast powder, 5 g / L corn steep liquor powder, 2 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, 0.02 g / L ferrous sulfate, 0.01 g / L manganese sulfate, pH 7.0-7.2, sterilized at 121°C for 20 min), and culture with reciprocating shaking at 34°C and 110 rpm for 5-6 h.

[0088] 3. Transfer the inoculum volume to 30 ml fermentation medium (glucose 80 g / L, yeast powder 3.5 g / L, potassium dihydrogen phosphate 5 g / L, ammonium sulfate 20 g / L, manganese sulfate 0.01 g / L, magnesium sulfate 5 g / L, sodium glutamate 13 g / L, corn steep liquor powder 15 g / L, calcium carbonate 25 g / L, pH 7.2-7.4, sterilize at 121°C for 20 min) at a 10% (volume ratio) inoculum volume, and culture with reciprocating shaking at 35°C and 130 rpm for 48 h.

[0089] 4. The glycosides produced in the fermentation broth were detected using a liquid chromatograph. The results are shown in Table 3.

[0090] Table 3 Shake flask fermentation results

[0091] Strain Adenosine (g / L) Inosine (g / L) Guanosine (g / L) <![CDATA[OD 562 ]]> B. subtilis A5 7.8 1.0 0.1 25.4 A551 8.6 1.2 0.2 26.7 A553 8.2 1.1 0.2 24.5 A555 8.3 1.2 0.3 25.9 A557 8.4 1.2 0.2 25.5

[0092] Example 6 Construction of MurE mutant in Bacillus subtilis 168 model strain and its ability to produce nucleosides

[0093] Using the genome of the model strain B. subtilis 168 as a template, the MurE promoter-enhanced strain B245 and the MurE V252I Mutant strain B247 (MurE V252I The coding gene is SEQ ID NO: 5), and MurE V252L Mutant strains B249 and B251 (MurE V252L The encoding genes are SEQ ID NOs: 6 and 7, respectively).

[0094] The same method as in Example 5 was used to produce nucleosides by shake flask fermentation. The experimental results are shown in Table 4.

[0095] Table 4 Bottle fermentation results

[0096] strain Adenosine (g / L) Inosine (g / L) Guanosine(g / L) <![CDATA[OD 562 ]]> B. subtilis 168 1.9 0.1 0.1 25.5 B245 2.5 0.3 0.2 26.9 B247 2.2 0.2 0.1 25.1 B249 2.4 0.2 0.3 25.7 B251 2.3 0.3 0.2 26.0

[0097] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A modified microorganism, characterized in that The microorganism has enhanced activity of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase compared to an unmodified microorganism, and the microorganism has enhanced adenosine production capacity compared to an unmodified microorganism; The reference sequence number of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase on NCBI is NP_389401.

1.

2. The microorganism according to claim 1, characterized in that The activity enhancement of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase in microorganisms is achieved by selecting from the following 1)-3), or an optional combination: 1) by changing the promoter of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase; 2) enhanced by changing the amino acid sequence of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase; 3) The activity is enhanced by changing the nucleotide sequence encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase.

3. The microorganism according to claim 2, characterized in that The expression of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is enhanced by using mutagenesis, site-directed mutagenesis or homologous recombination.

4. The microorganism according to claim 1, characterized in that The enhancement of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase activity is achieved by A or B as follows: A. operably linking the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase to a P43 promoter; B. Mutating the amino acid at position 252 of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase to an amino acid other than valine.

5. The microorganism according to claim 4, characterized in that The amino acid at position 252 of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is mutated from valine to isoleucine or leucine.

6. The microorganism according to any one of claims 1 to 5, characterized in that The microorganism is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

7. A method for constructing an adenosine-producing strain, characterized in that: The method comprises: using genetic engineering means to strengthen the coding gene of UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase in a microorganism having nucleoside production ability; The strengthening is selected from the following a)-c), or an optional combination thereof: a) enhancing by changing the promoter of the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase; b) enhanced by changing the amino acid sequence of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase; c) enhanced by changing the nucleotide sequence encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase; The reference sequence number of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase on NCBI is NP_389401.

1.

8. The method according to claim 7, characterized in that The enhancement method is selected from at least one of mutagenesis, site-directed mutagenesis, and homologous recombination; Preferably, strengthening is achieved by ①, ② or ③ as follows: ① operably linking the gene encoding the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase to the P43 promoter; ② The 252nd amino acid of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is mutated from valine to isoleucine; ③ The 252nd amino acid of the UDP-N-acetylmuramoyl-L-alanine-D-glutamate-2,6-diaminodimer ligase is mutated from valine to leucine; The microorganism is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

9. An adenosine-producing strain constructed according to the method of claim 7 or 8.

10. Use of the microorganism according to any one of claims 1 to 5 or the adenosine-producing strain according to claim 9 in fermentation production of adenosine or adenosine derivatives or in increasing the fermentation yield of adenosine or adenosine derivatives; The adenosine derivatives include adenosine triphosphate, adenine, adenylic acid, and adenosine arabinoside.