Application of PdAKR2A gene in improving photosynthetic rate and biomass of poplar

Abstract

The invention discloses application of a PdAKR2A gene in improving the photosynthetic rate and biomass of poplar, and belongs to the technical field of genetic engineering breeding of poplar. The overexpressed PdAKR2A gene is disclosed for the first time, the cambium cell layer number and xylem width of the poplar can be remarkably increased, the plant height and ground diameter of the poplar are further increased, and therefore the growth rate and biological yield of the poplar are increased; the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of the poplar can be obviously improved; the lignin and cellulose content of the poplar can be obviously improved; the provided PdAKR2A gene can be used as a candidate gene for cultivating a new variety of poplar which is higher in growth rate and better in quality, and has important significance on promoting sustainable development of forestry in China and relieving supply and demand tension of the wood market.

Description

Technical Field

[0001] The invention relates to the technical field of poplar genetic engineering breeding, in particular to the application of PdAKR2A gene in improving photosynthetic rate and biomass of poplar. Background Art

[0002] Wood is an important renewable resource with good strength, durability, plasticity and aesthetics. It plays an important role in our industrial production and life and has a wide range of uses. It not only occupies an important position in construction and furniture manufacturing, but is also an important raw material for making pulp, paper and liquid ethanol fuel. It can also be made into a variety of handicrafts and decorations to increase comfort and aesthetics. my country is the world's largest importer of wood and is highly dependent on imports. Although the transition of my country's forestry from traditional wood production to modern diversified forestry has alleviated the tension in the wood market to a certain extent, the market demand for high-quality wood is still huge. Therefore, it is still of great strategic significance for China to cultivate high-quality forest varieties of fast-growing and high-yield forests in a targeted manner and build high-quality artificial forests on a large scale to increase the output of high-quality wood.

[0003] Poplar is one of the main tree species in my country's artificial forests. It is also a fast-growing and high-yield tree species widely planted around the world. It has the following remarkable characteristics: 1) Short growth cycle. Poplar is one of the fast-growing tree species. It can reach a large height and diameter in a relatively short period of time, which is suitable for rapid greening and timber needs. 2) Strong adaptability and easy planting. Poplar is cold-resistant, drought-resistant, and salt-alkali-resistant. It can grow under a variety of soil conditions and has a strong ability to adapt to the environment. 3) High yield. Adult poplars can grow to more than 20 meters. In addition, poplars have straight trunks, broad crowns, and beautiful shapes. They are excellent street trees and afforestation tree species. Therefore, cultivating excellent poplar varieties and optimizing the quality of poplar wood have great research value and application prospects for promoting the sustainable development of my country's forestry industry and alleviating the tension between supply and demand in the timber market.

[0004] "84K Poplar" is a hybrid offspring of Populus alba and Populus glandularis. It is a hybrid clone of the white poplar faction bred in South Korea. It was introduced from South Korea by the Chinese Academy of Forestry in 1984. After its introduction, it has been introduced and tested in the three northern regions including the northwest for 14 years and has performed well. The promotion of the environmentally friendly white poplar faction male clone 84K Poplar, which has no flying catkins in spring, is a powerful guarantee for accelerating the construction of shelterbelts in the three northern regions, the greening of plains and the construction of farmland forest networks, and the rapid construction of the capital's green isolation belt and green barrier in the three northern regions where trunk-boring pests such as longhorn beetles are extremely serious and suitable for the development of white poplar faction poplar varieties. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the PdAKR2A gene in improving the growth rate, photosynthetic rate, cell wall components and breeding of poplars, so as to provide valuable candidate genes for cultivating new poplar varieties with faster growth rate and better quality, and to contribute to promoting the sustainable development of my country's forestry and alleviating the tension between supply and demand in the timber market.

[0006] To achieve the above object, the present invention provides an application of the PdAKR2A gene in improving the growth rate of poplars. The CDS sequence of the PdAKR2A gene is shown in SEQ ID NO.1. Compared with the wild type, the plant height and the ground stem diameter of the poplars overexpressing the PdAKR2A gene are significantly improved.

[0007] Preferably, compared with the wild type, the number of cambium cell layers and the width of xylem of poplars overexpressing the PdAKR2A gene are significantly increased.

[0008] The above-mentioned application of the PdAKR2A gene in improving the photosynthetic rate of poplars showed that, compared with the wild type, the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of poplars overexpressing the PdAKR2A gene were significantly improved.

[0009] The above-mentioned application of the PdAKR2A gene in changing the cell wall composition of poplars significantly increases the content of lignin and cellulose in poplars overexpressing the PdAKR2A gene compared to the wild type.

[0010] Application of the above-mentioned PdAKR2A gene in poplar breeding.

[0011] Application of the vector and / or strain containing the PdAKR2A gene in poplar breeding, wherein the vector includes an overexpression vector, a knockout vector, and a silencing vector, and the strain includes Escherichia coli and Agrobacterium.

[0012] Therefore, the application of the PdAKR2A gene provided by the present invention in improving the photosynthetic rate and biomass of poplar has the following specific technical effects:

[0013] (1) The present invention discloses for the first time that overexpression of the PdAKR2A gene can significantly increase the number of cambium cell layers and xylem width of poplars, thereby increasing the plant height and ground diameter of poplars, thereby increasing the growth rate and biological yield of poplars;

[0014] (2) The present invention discloses for the first time that overexpression of the PdAKR2A gene can significantly increase the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of poplar trees;

[0015] (3) The present invention discloses for the first time that overexpression of the PdAKR2A gene can significantly increase the lignin and cellulose content of poplar trees;

[0016] (4) The PdAKR2A gene provided by the present invention can be used as a candidate gene for breeding new poplar varieties with faster growth rate and better quality, which is of great significance for promoting the sustainable development of my country's forestry and alleviating the tension between supply and demand in the timber market.

[0017] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0019] Figure 1 is the PCR electrophoresis result of the transgenic positive seedlings in Example 3 of the present invention;

[0020] Figure 2 is the fluorescence quantitative PCR result of WT and transgenic positive seedlings in Example 3 of the present invention;

[0021] Figure 3 The photos (A), plant height (B), and stem diameter statistics (C) of WT and OE-2-10 plants grown in the greenhouse for 60 days in Example 4 of the present invention are shown;

[0022] Figure 4 The intercellular CO2 concentration (A), net photosynthetic rate (B), stomatal conductance (C), transpiration rate (D) and chlorophyll content (E) of WT and transgenic positive seedlings grown in the greenhouse for 60 days in Example 5 of the present invention;

[0023] Figure 5 The photographs of the cell base of the stem of WT and transgenic positive seedlings grown in the greenhouse for 60 days, the photographs of the cambium (A) and xylem width (B), the statistical results of the xylem width (C), and the statistical results of the number of cambium cell layers (D) in Example 6 of the present invention;

[0024] Figure 6 These are the results of measuring the lignin (A) and cellulose (B) contents in the stems of WT and transgenic positive seedlings grown in a greenhouse for 60 days in Example 7 of the present invention. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0026] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0027] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0028] Embodiment 1

[0029] The CDS sequence of the PdAKR2A gene (Potri.004G210100) is shown in SEQ ID NO.1 SEQ ID NO.1:

[0030]

[0031] The PdAKR2A gene overexpression vector was constructed. The specific steps are as follows:

[0032] S1.1. Total RNA was extracted from leaves of 2-month-old 84k poplar using the SPARKeasy Improved Plant RNA Kit from Shandong SPARKJ Biotechnology Co., Ltd. The obtained RNA was reverse transcribed into cDNA using the One-Step gDNA Removaland cDNA Synthesis SuperMix Reverse Transcription Kit (produced by Beijing Quanshijin Biotechnology Co., Ltd.), and the obtained cDNA was amplified by PCR. The forward primer sequence is shown in SEQ ID NO.2; the reverse primer sequence is shown in SEQ ID NO.3, and the amplification system and amplification conditions were carried out according to the instructions attached to 2xTaq Master Mix (Nanjing Novogene Biotechnology Co., Ltd.).

[0033] SEQ ID NO.2:CGACTCTAGAAAGCTTATGGCGACCACGAACAAG

[0034] SEQ ID NO.3:CGGGCCCCTGCAGAAGCCAGGAAGGCATCCTTCTCGA

[0035] S1.2, the pCAMBIA1300 vector (containing the 35S promoter) was digested with HindIII-HF restriction endonuclease (New England Biotechnology (Beijing) Co., Ltd.), and homologous recombination was used to ⅡOneStep Cloning Kit (Nanjing Novozyme Biotechnology Co., Ltd., insert the amplified fragment of the PdAKR2A gene obtained in step S1.1 into the HindIII-HF restriction site of the pCAMBIA1300 vector (for specific operations, see Tang et al., New Phytol., 2020).

[0036] S1.3, transform the recombinant vector obtained in step S1.2 into competent Agrobacterium rhizogenes EHA105 through routine operations such as ice bath and heat shock, plate, pick single colonies, perform colony PCR identification, pick the correct colonies and shake the bacteria to OD 600 The concentration of the bacterial solution is 0.6-0.8, and the bacterial solution is stored at -80℃. For specific operation methods, please refer to Xu Li's master's thesis (2022, Qingdao Agricultural University).

[0037] Embodiment 2

[0038] Genetic transformation of poplar leaves, the specific steps are as follows:

[0039] S2.1. Take out the stored bacterial solution from the -80℃ refrigerator, add it to 1mL of liquid LB medium containing 50mg / L kanamycin and rifampicin resistance, incubate at 28℃ and 220rpm for 24h to activate the strain, then take 200μL of the bacterial solution and add it to 50mL of liquid LB medium containing 50mg / L kanamycin and rifampicin resistance and culture until OD 600 It is 0.6-0.8.

[0040] S2.2, 5000rpm, centrifuge for 10 min to collect the cells, and culture the cells in a co-culture liquid medium containing 100μM / L acetosyringone (AS) in an incubator at 28℃ and 220rpm until the OD 600 It is 0.3-0.4 as the infection solution.

[0041] S2.3. Take the 2nd to 5th tender leaves from the upper end of the sterile seedlings of "84k poplar", make 3 to 4 cuts on the main vein with a sterile blade, and soak them in the invasive dye solution for about 8 minutes. Place the leaves on sterile filter paper to absorb moisture, spread them flat on the co-cultivation solid culture medium, and treat them in the dark at 28°C for 2 days.

[0042] S2.4. Transfer the leaves to a selective culture medium and culture them in the dark. When the callus grows to the size of a rice grain, cut it with a sterile blade and transfer it to a screening culture medium for bud induction for culture. When buds grow from the callus, cut the buds and insert them into a rooting culture medium for culture.

[0043] Co-culture medium: WPM 2.14 g / L, Ca(NO3)2 0.56 g / L, MES 0.5 g / L, sucrose 20 g / L, adjust pH to 5.8-6.0, sterilize at 121°C for 15 min, then add acetosyringone (AS) at a concentration of 100 mM / L; add 8 g / L agar to the solid culture medium.

[0044] Select medium: WPM 2.14g / L, Ca(NO3)20.56g / L, MES 0.5g / L, sucrose 20g / L, 2,4-D1mg / L, Kinetin 0.5mg / L, adjust pH to 5.8-6.0, autoclave at 121℃ for 15min, then add hygromycin (Hyg) 3mg / L, timentin (TMT) 300mg / L, cefoperazone (cef) 300mg / L; solid medium added with 8g / L agar;

[0045] Screening culture medium: WPM 2.14 g / L, Ca(NO3)2 0.56 g / L, MES 0.5 g / L, sucrose 20 g / L, TDZ 0.02 mg / L, adjust pH to 5.8-6.0, sterilize at 121°C under high pressure for 15 min, then add hygromycin (Hyg) 3 mg / L, timentin (TMT) 300 mg / L, cefoperazone (cef) 300 mg / L; add 8 g / L agar to the solid culture medium.

[0046] Rooting medium: 1 / 2MS2.203g / L, MES 0.5g / L, sucrose 20g / L, adjust pH to 5.8-6.0, autoclave at 121℃ for 15min; add 8g / L agar to the solid medium.

[0047] Embodiment 3

[0048] The identification and expression analysis of transgenic positive plants were performed as follows:

[0049] S3.1. Take the genetically transformed seedlings grown in the rooting medium for 2 months in Example 2, extract the DNA of the poplar leaves by the CTAB method, and perform positive identification on the poplar leaf DNA using the GFP label primer fragment, and obtain a total of 5 transgenic positive seedlings OE-2-3, OE2-10, OE2-11, OE2-12, and OE3-8.

[0050] The forward primer sequence of the GFP tag is shown in SEQ ID NO.4, the reverse primer sequence is shown in SEQ ID NO.5, and the electrophoresis results of the PCR product are shown in Figure 1 shown.

[0051] SEQ ID NO.4:ATGGTGAGCAAGGGCGAGGA

[0052] SEQ ID NO. 5: CTTGTACAGCTCGTCCATGCC.

[0053] S3.2. Use SPARKeasy Improved Plant RNA Kit (Shandong SPARKeasy Biotechnology Co., Ltd.) to extract RNA from leaves of wild-type plants (WT) and transgenic positive seedlings identified in step S3.1. The cDNA was reverse transcribed into cDNA using the Ⅲ1stStrand cDNA Synthesis Kit (Cuisheng Biotechnology (Shanghai) Co., Ltd.), and the PdUBQ gene was used as an internal reference for fluorescence quantitative PCR analysis to obtain the expression level of transgenic positive plants relative to WT. Six biological replicates were set for each sample. The results are shown in Figure 2 shown.

[0054] The forward primer sequence of the specific primer of the PdUBQ gene is shown in SEQ ID NO.6, and the reverse primer sequence is shown in SEQ ID NO.7. The forward primer sequence of the specific primer for fluorescent quantitative PCR analysis of the PdAKR2A gene is shown in SEQ ID NO.8, and the reverse primer sequence is shown in SEQ ID NO.9.

[0055] SEQ ID NO.6:AGACCTACACCAAGCCCAAGAAGAT

[0056] SEQ ID NO.7:CCAGCACCGCACTCAGCATTAG

[0057] SEQ ID NO.8:TTCTAAATCATCAGTAACCTCCTC

[0058] SEQ ID NO.9:TAACTCTTTGATGCTCGGGTC

[0059] Depend on Figure 2 It can be seen that the relative expression levels of the PdAKR2A gene in the transgenic positive plants were significantly higher than that in the WT, among which the highest relative expression level was in the OE2-10 plant, which was 19 times that of the WT.

[0060] Embodiment 4

[0061] To examine the phenotype of transgenic positive plants, the specific steps are as follows:

[0062] The wild type (WT, 84k poplar) with the same growth conditions and the transgenic positive plant OE-2-10 with the highest relative expression of PdAKR2A gene compared with the WT plant were simultaneously cultured in nutrient soil in the greenhouse under the following culture conditions: 16h / 8h photoperiod, 80μmol / m 2 / s light intensity, temperature 24-26℃, humidity 70%, the height and ground stem of each plant were measured on the 60th day of cultivation in the greenhouse. The results were as follows: Figure 3 As shown in B and C, the photos of the plants on the 60th day of greenhouse cultivation are as follows Figure 3 As shown in A, the results showed that the height and ground diameter of the transgenic positive plants were significantly different from those of the WT plants. The height of the transgenic line OE2-10 increased by 18% compared with the wild type; the stem diameter increased by 7%. The statistical results are shown in Figure 3 B and Figure 3 As shown in C.

[0063] Embodiment 5

[0064] The specific steps for determining photosynthetic indexes of transgenic positive plants are as follows:

[0065] S5.1. Determination of chlorophyll content

[0066] (1) Take the leaves of WT and OE2-10 on the 60th day of greenhouse culture in Example 4, weigh two leaves of substantially the same size for each of three trees, select one and record the fresh weight of the leaves. After grinding with liquid nitrogen, put it into a 50 mL centrifuge tube and shade it for 24 hours. Put the other leaf into a 55°C oven and dry it for 24 hours before recording the dry weight.

[0067] (2) After the self-test is completed, the chlorophyll content of the poplar leaves is measured using the T6 New Century UV-Vis spectrophotometer. After the leaves are shaded, they are ground with liquid nitrogen, and then 1 mL of the supernatant is drawn into the cuvette of the machine. The wavelengths are adjusted to 649 nm and 665 nm for measurement. After the measurement is completed, the data is recorded and the chlorophyll a content is calculated according to the formula: 13.95 × D 665 -6.88×D 649 Determine the chlorophyll a content; chlorophyll b content = 24.96 × D 649 -7.32×D 665 Determine the chlorophyll b content. The sum of the chlorophyll a content and the chlorophyll b content is the total chlorophyll content. The results are as follows Figure 4 As shown in E, the total chlorophyll content in the leaves of OE2-10 plants was 1.6 times that in the leaves of WT plants.

[0068] S5.2. Determination of photosynthetic rate

[0069] Select new fully expanded leaves from WT and OE2-10 plants that are not blocked and receive good light conditions, and use the portable photosynthetic meter measurement system "Photosynthetic Meter LI-6800" to measure the photosynthetic efficiency of poplars at 9:00-10:30 in the morning on a sunny day in a greenhouse with constant temperature and light. Repeat 10 leaves for WT and OE2-10 plants respectively. The specific steps are as follows:

[0070] The leaf chamber uses a 6800-01F fluorescent leaf chamber (round, 6 cm) for the experiment. The leaf chamber environment conditions are set according to the greenhouse light and temperature conditions. Use CO2, a steel cylinder to control a stable and consistent CO2 concentration, and connect a buffer bottle to the main engine air inlet to better ensure the cleanliness of the main engine air path. Click the Environment tab to set the environment (select On for both Flow and Fan).

[0071] (1) Set Flow:On:PumpSpeed:Auto:Flow:500 μmol m -2 s -1 :P:0.1kPa;

[0072] (2) Set H0:On:RH-air:50%~75%;

[0073] (3) Set CO2: If no CO cylinder is installed, set CO here to Of: If a CO2 cylinder is installed: CO2injector; On::CO2-s:400μmol·mol -1 ;

[0074] (4) Set Mixing fan; On; Fan Speed; 10,000 rpm;

[0075] (5) Set Temperature: Set a temperature close to 26°C according to the ambient temperature Tair;

[0076] (6) Set light intensity: For the comparison experiment of photosynthetic characteristics between treatments, it is necessary to eliminate the influence of external light changes on plant photosynthesis, so a stable light intensity needs to be set. The setting method is as follows:

[0077] 6800-0IF Yellow Light Leaf Chamber:

[0078] Set Light: Select Fuoromcter: Control Mode: Setpoint; Setpoint: 1500 μmol m -2 s -1 :Color Sepc:r90 (90% red light);

[0079] 6800-02 Red and Blue Light Case:

[0080] Set Light: Select Head Light Source: Control Mode: Setpoint: Setpoint: 1500 μmol m -2 s -1 :ColorSepc:r90 (90% red light);

[0081] (7) Click the Log Setup tab to set the log file and log options.

[0082] Set Logging Options: Keep the default, check to make sure Also log data to Excel file is selected

[0083] (8) Start measurement: Clip the blade, click the Measurement tab, enter the measurement interface, observe the graph on the left, and press different letters to see the real-time stability graphs of multiple parameters. You can also view the stability parameters set in the Stabiliy function under the LogSetup tab. When it shows 4 / 4, the data is stable. Click the Log button in the upper right corner to record the data. Replace the blade and repeat step (6) until this group of measurements is completed. After the measurement is completed, click the Logging to function under the LogSetup tab and click Close Log in the lower right corner to close the log file.

[0084] The results are as follows Figure 4 As shown in AD, the photosynthetic rate, stomatal conductance and transpiration rate of the overexpression plants were significantly increased compared with WT, and the intercellular carbon dioxide concentration was significantly reduced.

[0085] Embodiment 6

[0086] Xylem development of transgenic positive plants

[0087] After the determination of plant photosynthetic indexes in Example 5 is completed, the stem cuttings of the base of WT and OE2-10 plants are respectively fixed, dehydrated, transparent, waxed, and embedded to obtain wax blocks containing stem cuttings; the wax blocks are sliced ​​with a slicer and placed on a glass slide, and then spread and sealed with a slide spreader, and then after a dewaxing process treated with xylene and alcohol, the sliced ​​materials are stained with 1% toluidine blue (TBO), rinsed with water after 1 minute, and then observed and photographed with a ZEISS microscope. For specific steps, see Xu Li's master's thesis (2022, Qingdao Agricultural University). Results are shown in Figure 5 Part A shows the photos of the cambium in the lower stems of OE2-10 and WT poplars, Part B shows the photos of the xylem in the lower stems of OE2-10 and WT poplars, Part C shows the statistical results of the number of cambium cell layers, and Part D shows the statistical results of the xylem width.

[0088] The results showed that the number of cambium cell layers in the basal stems of PdAKR2A overexpressing plants increased by about one layer compared with WT, and the width of the xylem increased significantly; further statistics showed that the width of the xylem in PdAKR2A overexpressing plants increased by 10%.

[0089] Embodiment 7

[0090] Identification of cell wall components in transgenic positive plants

[0091] S7.1. AIR extraction

[0092] (1) After the determination of photosynthetic indexes of plants in Example 5 was completed, the fifth internode (counted from bottom to top) of the stems of WT and OE2-10 plants were respectively taken as experimental materials.

[0093] (2) The collected materials were quickly frozen in liquid nitrogen, ground into powder using a tissue crusher, and placed in a centrifuge tube for AIR extraction.

[0094] (3) Take about 1 mL of the ground sample and place it in a 2 mL centrifuge tube. Add 80% ethanol to 1.8 mL. Centrifuge at 12,000 rpm for 10 min. After centrifugation, use a pipette to gently aspirate the upper layer of liquid to avoid aspirating the precipitate.

[0095] (4) Add 1 mL of 80% ethanol to the above precipitates, centrifuge at 12,000 rpm for 10 min, and gently aspirate the upper layer of liquid with a pipette after centrifugation. Wash twice with 1 mL of anhydrous ethanol, centrifuge at 12,000 rpm for 10 min, and gently aspirate the upper layer of liquid with a pipette.

[0096] (5) Add 1 mL of a mixture of chloroform and methanol (the volume ratio of chloroform to methanol is 1:1) to the above precipitate, heat in a 37°C water bath for 40 min, centrifuge at 12,000 rpm for 10 min, discard the supernatant, and repeat the above steps of adding the mixture, water bath, and centrifugation once.

[0097] (6) The obtained precipitate is placed in a fume hood and dried to obtain pure cell wall ethanol-insoluble matter (AIR).

[0098] S7.2, Determination of total cellulose content:

[0099] ① Weigh 2 mg of the AIR sample obtained in step (i) into a glass tube, slowly add 0.5 mL of 2 M trifluoroacetic acid (TFA) to the wall, and react in a 121°C metal bath for 90 min to dissolve the hemicellulose.

[0100] ② After the reaction, the sample was cooled to room temperature, centrifuged at 5000g for 5 min, and the supernatant was carefully removed.

[0101] ③ Add 800 μL of ultrapure water to the obtained precipitate to wash the precipitate, centrifuge at 5000 g for 5 min, carefully remove the supernatant, and repeat the ultrapure water addition and centrifugation operation once.

[0102] ④ Aspirate the supernatant, add 200 μL 72% sulfuric acid and react at room temperature for 30 minutes to dissolve the cellulose in the precipitate.

[0103] ⑤ Add 800 μL of ultrapure water to the sample after the reaction, centrifuge at 12000 rpm for 5 min, and take 500 μL of supernatant for later use.

[0104] ⑥Prepare the glucose standard curve: Weigh 1 mg of glucose standard sample and dissolve it in 1 mL of ultrapure water to prepare the mother solution. Dilute it into 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 1 mg / mL solution respectively, add 150 μL of phenol (5%) and 750 μL of sulfuric acid (98%), and detect the absorbance of the above solution at 490 nm. According to the concentration of the diluted solution and the corresponding absorbance value, prepare the glucose standard curve, as shown in the figure. Figure 5 The standard curve is shown.

[0105] ⑦ Take the supernatant obtained in step ⑤, add 150 μL of phenol (5%) and mix well, and then add 750 μL of sulfuric acid (98%) and mix well.

[0106] ⑧ Take an equal amount of the mixed solution obtained in step ⑦, add it to the ELISA plate, and measure the absorbance value at 490nm. According to the glucose standard curve drawn in step ⑥, calculate the glucose content in the sample as the cellulose content.

[0107] S7.3, Determination of lignin content:

[0108] ① Weigh 1.5 mg (-) of the obtained AIR sample into a 2 mL centrifuge tube (leave one empty tube for control).

[0109] ② Gently and slowly add 100 μL of freshly prepared acetyl bromide solution (25% v / v acetyl bromide / acetic acid) along the wall of the tube.

[0110] ③ Cover the centrifuge tube and place it in a water bath at 50℃ for 2h.

[0111] ④Continue heating the reaction for 1 hour, shaking and mixing every 15 minutes.

[0112] ⑤ Place the reacted material on ice and cool to room temperature.

[0113] ⑥ Add 400 μL 2 M NaOH and 70 μL freshly prepared 0.5 M hydroxylamine hydrochloride to the cooled reaction sample and vortex to mix.

[0114] ⑦ Transfer the reacted sample to a 10mL centrifuge tube, add glacial acetic acid to 2mL, and mix well.

[0115] ⑧ Pipette 200 μL of the reaction solution into the ELISA plate, measure the absorbance at 280 nm, and calculate the lignin content according to the following formula:

[0116] Acetyl bromide soluble lignin (%ABSC) = abs (absorbance value) / coeff (coefficient) × 0.1 cm × 2 mL × 100% / weight (unit: mg).

[0117] The results are as follows Figure 6As shown, compared with WT, the contents of lignin and cellulose in the stems of PdAKR2A overexpressing plants were significantly increased, among which the lignin content in the stems of OE-2-10 transgenic positive lines increased by 12%, and the cellulose content increased by 8%.

[0118] Therefore, the present invention discloses for the first time that overexpression of the PdAKR2A gene can significantly increase the number of cambium cell layers and xylem width of poplars, thereby increasing the plant height and ground diameter of poplars, thereby increasing the growth rate and biological yield of poplars; can significantly increase the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of poplars; can significantly increase the lignin and cellulose content of poplars; the provided PdAKR2A gene can be used as a candidate gene for breeding new poplar varieties with faster growth rate and better quality, which is of great significance for promoting the sustainable development of my country's forestry industry and alleviating the tension between supply and demand in the timber market.

[0119] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Application of PdAKR2A gene in increasing the growth rate of poplar, characterized in that: The CDS sequence of the PdAKR2A gene is shown in SEQ ID NO.1; compared with the wild type, the plant height and the ground stem diameter of the poplar overexpressing the PdAKR2A gene were significantly increased.

2. The use of the PdAKR2A gene according to claim 1 in improving the growth rate of poplar, characterized in that: Compared with the wild type, the number of cambium cell layers and xylem width of poplar overexpressing the PdAKR2A gene were significantly increased.

3. The use of the PdAKR2A gene in claim 1 for increasing the photosynthetic rate of poplar, characterized in that: Compared with the wild type, the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of poplar overexpressing the PdAKR2A gene were significantly increased.

4. The use of the PdAKR2A gene in claim 1 for changing the cell wall components of poplar, characterized in that: Compared with the wild type, the lignin and cellulose contents of poplars overexpressing the PdAKR2A gene were significantly increased.

5. Use of the PdAKR2A gene of claim 1 in poplar breeding.

6. Use of the vector and / or strain containing the PdAKR2A gene of claim 1 in poplar breeding, characterized in that: The vectors include overexpression vectors, knockout vectors, and silencing vectors, and the strains include Escherichia coli and Agrobacterium.

Images