Application of CsABF8 gene in regulating drought resistance of plants

Abstract

The application provides application of a CsABF8 gene in regulation of drought resistance of plants and belongs to the technical field of molecular breeding.The application takes a drought-sensitive variety 'Fuyun No.6' ('FY') and a drought-tolerant variety 'Taicha No.12' ('TC') as experimental materials, performs drought stress treatment and non-targeted metabolome screening of differential metabolites, and determines that the CsABF8 gene is a potential drought-resistant target gene.The CsABF8 gene can respond to drought stress, increases the content of raffinose in tea trees by regulating CsGolS1, CsGolS2 and CsRaf6 promoters in the tea trees, and thus makes the tea trees cope with drought stress.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular breeding, and particularly relates to application of CsABF8 gene in regulation of drought resistance of plants. BACKGROUND

[0002] Camellia sinensis is an important perennial evergreen leaf economic crop. Tea yield is directly affected by water supply. Water shortage can lead to a 33% to 40% reduction in tea yield. Plant hormone Abscisic acid (ABA) plays a key role in integrating various abiotic stress signals such as drought, cold and salinity and inducing protective stress responses. When plants are subjected to drought stress, ABA accumulates rapidly, and ABA can activate transcription and post-transcriptional gene expression, regulate stomatal closure and metabolic changes, thereby resisting drought. Therefore, it is of great significance to explore drought response-related genes in tea plants and elucidate their regulatory mechanisms for breeding drought-resistant tea varieties that can efficiently utilize water resources.

[0003] However, there is no report on the involvement of CsABFs gene in drought stress response of tea plants. SUMMARY

[0004] The application aims to provide application of CsABF8 gene in regulation of drought resistance of plants, and the CsABF8 gene can be used to regulate drought resistance of tea plants.

[0005] The application provides application of CsABF8 gene in regulation of drought resistance of plants; the amino acid sequence of the protein encoded by the CsABF8 gene is shown in SEQ ID NO. 1.

[0006] Preferably, the nucleotide sequence of the CsABF8 gene is shown in SEQ ID NO. 2.

[0007] Preferably, the application includes application of negative regulation of CsABF8 gene in improvement of drought resistance of plants or application of positive regulation of CsABF8 gene in construction of a drought-sensitive plant model.

[0008] Preferably, the negative regulation includes transient silencing, and the reagent used in the negative regulation includes an antisense oligonucleotide combination targeting the CsABF8 gene; the antisense oligonucleotide combination includes a first antisense oligonucleotide shown in SEQ ID NO. 8, a second antisense oligonucleotide shown in SEQ ID NO. 9 and a third antisense oligonucleotide shown in SEQ ID NO. 10.

[0009] Preferably, the positive regulation comprises transient overexpression; the reagent used in the positive regulation comprises a CsABF8 gene overexpression vector plasmid; the CsABF8 gene overexpression vector plasmid uses pCAMBIA 1305 as a backbone plasmid and inserts the CsABF8 gene.

[0010] Preferably, the plant comprises a tea plant.

[0011] The application further provides a method for cultivating drought-resistant plants, comprising the following steps: injecting a combination solution of antisense oligonucleotides targeting a CsABF8 gene into mature leaves of a tea plant, so as to achieve transient silencing of the CsABF8 gene in the plant.

[0012] The application further provides a method for constructing a drought-sensitive plant model, comprising the following steps: introducing a CsABF8 gene overexpression vector plasmid into Agrobacterium tumefaciens to obtain a recombinant bacterium; and using the recombinant bacterium to infect a plant to obtain a drought-sensitive plant model.

[0013] The application further provides application of the CsABF8 gene in regulating the content of raffinose in plants; and an amino acid sequence of a protein encoded by the CsABF8 gene is shown in SEQ ID NO. 1.

[0014] The application further provides application of the CsABF8 gene in regulating CsGolS1 / 2 promoters and / or CsRaf6 promoters; and an amino acid sequence of a protein encoded by the CsABF8 gene is shown in SEQ ID NO. 1.

[0015] The application provides application of the CsABF8 gene in regulating drought resistance of plants; and an amino acid sequence of a protein encoded by the CsABF8 gene is shown in SEQ ID NO. 1. The application takes drought-sensitive variety 'FY' and drought-tolerant variety 'TC' as experimental materials, performs drought stress treatment and non-targeted metabolome screening of differential metabolites, and determines that the CsABF8 gene is a potential drought-resistant target gene. The CsABF8 gene can respond to drought stress, regulates CsGolS1, CsGolS2 and CsRaf6 promoters in the tea plant to increase the content of raffinose, and thus makes the tea plant cope with drought stress. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only constitute some embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor.

[0017] Figure 1 Figure for CsABF8 gene silencing experiment treatment;

[0018] Figure 2 Figure for determination of expression level of related genes after inhibition treatment and determination of raffinose content in leaves;

[0019] Figure 3 Figure for potential binding region of CsABF8 and CsGolS1, CsGolS2, CsRaf6 promoters;

[0020] Figure 4 Figure for overexpression pCAMBIA 1305-CsABF8;

[0021] Figure 5 Figure for determination of expression change of galactose pathway related genes and determination of raffinose content in leaves after overexpression pCAMBIA 1305-CsABF8;

[0022] Figure 2 and Figure 5 All data in Table 1 are at least three independent biological replicates (n≥3), *P<0.05; **P<0.01; ***P<0.001, and the asterisk represents significant difference under independent sample T-test. DETAILED DESCRIPTION

[0023] The application provides application of CsABF8 gene in regulation of drought resistance of plants; the amino acid sequence of the protein coded by the CsABF8 gene is shown in SEQ ID NO. 1, and the application specifically relates to the following:

[0024] MNFKNFGNEPPEEGGAGGGGRPLGIFPLARQTSIYSLTFDEFQSTIGGSGKDFGSMNMDELLKNIWRTEETQTVGTTSGLQGQGQGQEGVAPNGHLQRQGSLTLPRTLSQKTVDEVWRDLAKEYGGGKDGIGAVNSNQPQRQPTLGEMTLEEFLVRAGVVREELQLPHGNPNNTGFFGDLSRPNNNTALGFAFQQMGQNTGLMGNRIPESNNQNTIQSANLPLNVNGVRSTQQQQQQQQQQRGQQQQQLFPKQPNMGYANPMSIPSSTQMSSPGFRGGIVGIADSTITNNLVQSAALQGGGMGMMGLGAGAVTVATGSPAFSSDGLGKSNGDTSSVSPVPYVFNGGLRGRKSSHAVEKVVERRQRRMIKNRESAARSRARKQAYTMELEAEVAKLKEENQELRKKQMNITIINFVAGGNNGIAEKSGLGDDEHAAGRKETMPEANTDWAMVKGRDYALIIQI.

[0025] In the specific implementation of the present application, the nucleotide sequence of the CsABF8 gene is shown as SEQ ID NO. 2, specifically:

[0026]

[0027] In the embodiment of the present application, the application includes application of negative regulation of CsABF8 gene in improving drought resistance of plants or application of positive regulation of CsABF8 gene in constructing a drought-sensitive plant model.

[0028] In the embodiment of the present application, the negative regulation includes transient silencing, and the reagent for the negative regulation includes an antisense oligonucleotide combination targeting the CsABF8 gene, and the antisense oligonucleotide combination includes a first antisense oligonucleotide shown in SEQ ID NO. 8, a second antisense oligonucleotide shown in SEQ ID NO. 9 and a third antisense oligonucleotide shown in SEQ ID NO. 10.

[0029] In an embodiment of the present application, the antisense oligonucleotide combination consists of the first antisense oligonucleotide shown in SEQ ID NO. 8, the second antisense oligonucleotide shown in SEQ ID NO. 9 and the third antisense oligonucleotide shown in SEQ ID NO. 10; the first antisense oligonucleotide, the second antisense oligonucleotide and the third antisense oligonucleotide simultaneously function in the upstream, the middle and the downstream of the CsABF8 gene, and play a role in inhibiting expression of the CsABF8 gene.

[0030] In the embodiment of the present application, the positive regulation includes transient overexpression, and the reagent for the positive regulation includes a CsABF8 gene overexpression vector plasmid; the CsABF8 gene overexpression vector plasmid takes pCAMBIA 1305 as a backbone plasmid and has the CsABF8 gene inserted.

[0031] In the embodiment of the present application, the plant includes a tea tree; in the embodiment of the present application, the variety of the tea tree includes 'Taicha No. 12' or 'Shuchazao'; the tea tree includes tea seedlings; the tea seedlings include tea cuttings.

[0032] The present application also provides a method for cultivating drought-resistant plants, including the following steps:

[0033] The antisense oligonucleotide combination solution targeting the CsABF8 gene is injected into mature leaves of the tea tree, so as to realize transient silencing of the CsABF8 gene in the plant body.

[0034] In the embodiment of the present application, the plant includes a tea tree; the plant leaves include two or three leaves of the tea seedlings; the reaction concentration of the antisense oligonucleotide combination of the CsABF8 gene is 100 μM.

[0035] The present application also provides a method for constructing a drought-sensitive plant model, including the following steps:

[0036] The CsABF8 gene overexpression vector plasmid is introduced into Agrobacterium tumefaciens to obtain a recombinant bacterium; and the recombinant bacterium is used to infect plants to obtain a drought-sensitive plant model.

[0037] In the implementation of the present application, the backbone plasmid of the CsABF8 gene overexpression vector plasmid comprises pCAMBIA 1305; and the CsABF8 gene is inserted between the BamHI enzyme cutting site and the Spe I enzyme cutting site of pCAMBIA 1305.

[0038] The present application also provides application of the CsABF8 gene in regulating the content of raffinose in plants; and the amino acid sequence of the protein encoded by the CsABF8 gene is shown in SEQ ID NO. 1.

[0039] In the present application, the CsABF8 gene has the function of catalyzing the synthesis of raffinose in tea plants. In the implementation of the present application, the application comprises application of the CsABF8 gene in negatively regulating the content of raffinose in plants or application of the CsABF8 gene in positively regulating the content of raffinose in plants; and the plants are tea plants.

[0040] The present application also provides application of the CsABF8 gene in regulating CsGolS1 / 2 promoter and / or CsRaf6 promoter; and the amino acid sequence of the protein encoded by the CsABF8 gene is shown in SEQ ID NO. 1.

[0041] In the present application, after the CsABF8 gene is silenced, the expression levels of the galactose pathway related genes CsGolS1 / 2 and CsRaf6 are significantly reduced; and when the CsABF8 gene is overexpressed in tea plants, the expression levels of the target genes CsGolS1 / 2 and CsRaf6 are significantly increased. In the implementation of the present application, the application comprises application of the CsABF8 gene in negatively regulating the expression level of the genes mediated by CsGolS1 / 2 promoter and / or CsRaf6 promoter in plants or application of the CsABF8 gene in positively regulating the expression level of the genes mediated by CsGolS1 / 2 promoter and / or CsRaf6 promoter in plants; and the plants are tea plants.

[0042] In order to further illustrate the present application, the application of the CsABF8 gene in regulating the drought resistance of plants provided by the present application is described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0043] Example 1

[0044] 1. Plant materials and treatment

[0045] Two-year-old cuttings of 'Fuyun No. 6' and 'Taicha No. 12' were purchased from Quanzhou Qianhe Tea Seedling Co., Ltd., Fujian Province. Seedlings with a height of 30-35cm, intact roots, and uniform growth were selected and hydroponically cultured in the artificial climate chamber of Nongcuiyuan, Anhui Agricultural University (greenhouse conditions: natural light, temperature: 20-25℃, humidity: 35%-40%). The nutrient solution was Xiaoxi Maoyi tea tree nutrient solution (pH adjusted to 4.5-5.5). Drought stress was simulated by applying 5% (g / ml) PEG (dissolved in Xiaoxi Maoyi tea tree nutrient solution). Two- and three-leaf samples from seedlings at 0d, 1d, and 3d were collected and placed at -80℃. Some samples (control group and 3d drought treatment) underwent non-targeted metabolomics analysis, while the remaining samples underwent total RNA extraction for subsequent experiments.

[0046] The 'Shucha Zao' one-year-old cuttings were purchased from Anhui Hefei Niansheng Agricultural Ecological Co., Ltd., and grown in soil in a greenhouse. All samples were collected and immediately frozen in liquid nitrogen and stored at -80℃ until use.

[0047] 2. Determination of raffinose content in tea leaves

[0048] After thoroughly grinding tea leaves in liquid nitrogen, freeze-dry them for 2–3 days. Take approximately 300 mg of the freeze-dried tea leaf sample and soak it in 7 ml of 80% ethanol aqueous solution in an 80°C water bath for 30 min, shaking 3–5 times every 10 min, centrifuging at 12000 rpm for 5 min, collecting the supernatant and incubating in a 95°C water bath until the ethanol evaporates. Cool the remaining sugar solution to room temperature, place it at -80°C overnight, and then freeze-dry it for 2–3 days. Dissolve the dried sugar mixture in 500 μL of Watson's water, shake thoroughly to mix, centrifuge at 12000 rpm for 5 min, and collect the supernatant. The raffinose content of the tea leaves was detected using the Raffinose ELISA research kit provided by Jiangsu Enzyme Biotechnology Co., Ltd. The raffinose content was calculated using the following formula 1.

[0049] Raffinose (mg / gDW) = X × V / W × 10 -3 ×5 Equation 1;

[0050] In Equation 1, X is the sample concentration (μg / mL) determined by the standard curve, V is the sample volume (μL), and W is the sample mass (g).

[0051] 3. Cloning of the CsABF8 gene in tea plants

[0052] 3.1 Cloning of the CsABF8 gene

[0053] The CDS sequence of CsABF8 gene (as shown in SEQ ID NO. 2) was obtained by using tea tree genome website (http: / / tpia.teaplants.cn / index.html). The full-length cDNA of tea tree was used as a template, and 2xHieff PlusPCR Master Mix (With Dye) (Yixing Biotech (Shanghai) Co., Ltd.) high-fidelity enzyme premix was used for gene cloning, and the primers required for PCR amplification were CsABF8-F / R.

[0054] Primer sequence:

[0055] CsABF8-F: ATGAACTTCAAGAACTTCGG (SEQ ID NO. 3);

[0056] CsABF8-R: TCACCATGGCCCAGTCTGTG (SEQ ID NO. 4).

[0057] Table 1 reaction system

[0058]

[0059]

[0060] Table 2 PCR reaction program

[0061]

[0062] The product after the above PCR amplification was connected with pEASY-BluntZero cloning vector, and the connected vector was transferred into E. coli DH5a competent cells. After selecting single clone bacteria, colony PCR verification and sending measurement comparison, the full-length sequence of CsABF8 gene was obtained, the nucleotide sequence of CsABF8 gene is shown in SEQ ID NO. 2, and the amino acid sequence of CsABF8 transcription factor is shown in SEQ ID NO. 1.

[0063] 4, transient silencing of CsABF8 gene in tea leaves

[0064] (1) The cloned CsABF8 gene sequence of tea tree was submitted to Soligo website (https: / / sfold.wadsworth.org / cgi-bin / soligo.pl) to output the antisense oligonucleotide sequence and the sense oligonucleotide sequence of the target gene, and then input into TPIA (http: / / tpdb.shengxin.ren / index.html) website to screen out nucleotide combinations with stronger specificity as candidate sequences. The sequences were sent to Sheng Wu Bioengineering (Shanghai) Co., Ltd. for sequence synthesis, and the primer sequences were as follows:

[0065] Table 3 Silencing primer sequence of CsABF8

[0066]

[0067] (2) The synthesized sense oligonucleotide and antisense oligonucleotide sequences of the silencing primer were dissolved and diluted with ultrapure water to a final concentration of 100 μM;

[0068] (3) The tea tree cutting seedlings (water culture) with consistent growth conditions were taken, and the sODN (sODN-CsABF8-1, sODN-CsABF8-2 and sODN-CsABF8-3 mixed in equal proportions) solution and the AsODN (AsODN-CsABF8-1, AsODN-CsABF8-2 and AsODN-CsABF8-3 mixed in equal proportions) solution were injected into the back of different leaves (100 μM of the diluted sODN or AsODN solution was taken with a 1 mL syringe, the second and third leaves of the plant were gently rubbed with a syringe needle, and the silencing primer was injected until the whole leaf was injected), and then cultured normally for 6 h, followed by 15% PEG treatment for 24 h. The samples were taken and stored at -80°C for standby, and then subjected to subsequent raffinose content determination and qRT-PCR gene quantitative test. The schematic diagram is shown in Figure 1 .

[0069] Through the tea tree in vivo transient silencing experiment, the CsABF8 gene of tea tree in vivo was silenced by treating the two-three leaves of tea tree hydroponic seedlings (TC) with CsABF8 gene specific sense oligonucleotide (sODN) or antisense oligonucleotide (AsODN). The qRT-PCR results showed that, compared with the control sODN treatment, the expression level of CsABF8 gene was significantly inhibited after 6h injection. The qRT-PCR detection of galactose pathway related genes CsGolS1 / 2, CsRaf6 found that the expression levels of the above genes were significantly decreased after the CsABF8 gene was silenced. The tea trees with successful silencing were treated with drought for 24h, and it was found that the expression of CsABF8 in the control group and the experimental group was increased, indicating that CsABF8 gene responded to drought stress, but the expression of the experimental group was still lower than that of the control group, indicating that the expression of the gene was still inhibited at 24h of drought treatment. The target genes CsGolS1 and CsGolS2 showed the same change trend as CsABF8 gene after 24h of drought treatment, indicating that CsGolS1 and CsGolS2 were strongly regulated by CsABF8 gene in vivo. The raffinose content results showed that, compared with the control group, the raffinose content in the AsODN-CsABF8 treatment group was significantly reduced. After 24h of drought treatment, the raffinose content in the sODN-CsABF8 control group and the AsODN-CsABF8 treatment group was slightly increased, and was highly correlated with the expression of CsABF8 gene. The above results further confirmed that CsABF8 gene has the function of catalyzing raffinose synthesis in vivo of tea tree. See Figure 2 and Figure 3 .

[0070] Example 2

[0071] Transient overexpression of CsABF8 gene in vivo of tea tree

[0072] 1. Construction of CsABF8 gene overexpression vector

[0073] The pCAMBIA 1305 vector was double digested with restriction enzymes BamHI and Spe I to obtain a linearized vector, and recombinant primers were designed according to the sequence of CsABF8 gene, as follows:

[0074] CsABF8-1305-F: aggacagcccagatcactagtATGAACTTCAAGAACTTCGGAAATG (SEQ ID NO. 11);

[0075] CsABF8-1305-R: gcccttgctcaccatggatccTCACCATGGCCCAGTCTGTG (SEQ ID NO. 12);

[0076] According to the above amplification system and amplification procedure, the target gene fragment is obtained, the one-step cloning method is used to connect the above target gene fragment with the linearized vector, the constructed pCAMBIA 1305-CsABF8 recombinant plasmid is transferred into the E. coli DH5a competent cell, a single colony is picked for colony PCR, the correct band is picked for sequencing, and after sequence comparison, the pCAMBIA 1305-CsABF8 overexpression vector is obtained by extracting the plasmid.

[0077] 2. Tea tree transient overexpression

[0078] 1) The Agrobacterium tumefaciens GV3101 (pSoup) competent cell is taken out from the-80℃ refrigerator, thawed on ice, and then 1 μg or less of the pCAMBIA-CsABF8 overexpression vector plasmid and the pCAMBIA 1305 empty vector are added;

[0079] 2) The centrifuge tube is inserted into ice for 5 min, then frozen in liquid nitrogen for 5 min, 37℃ water bath for 5 min, and finally ice bath for 5 min;

[0080] 3) 700 μL of liquid LB medium without antibiotics is added, and placed in a 28℃ shaker at 220 r / min for 2-3 h;

[0081] 4) 100 μL of bacterial solution is taken and spread on solid medium containing 50 mg / L of rifampicin (Rif) and 100 mg / L of kanamycin (Kan) antibiotics, and incubated in a 28℃ incubator for 2-3 d;

[0082] 5) A single colony is picked for colony PCR of the target gene, and the correct band is selected for subsequent experiments after gel electrophoresis;

[0083] 6) The bacterial body carrying the pCAMBIA 1305-CsABF8 recombinant vector and the bacterial body containing the pCAMBIA 1305 empty vector are added in liquid LB containing 50 mg / L of Rif and 100 mg / L of Kan antibiotics, and cultured at 28℃ in a shaker at 220 r / min until the OD 600 = 0.8-1.0;

[0084] 7) Centrifuged at 5000 rpm for 10 min, resuspended in cell suspension MMA to OD 600 = 0.8-1.0, and dark for 2 h;

[0085] 8) Select tea seedlings with consistent growth state, and inject the above mixed solution incubated in the dark into tea tree leaves with a 1 mL syringe;

[0086] 9) After 36h incubation at room temperature, samples were taken and stored at -80℃ for further determination of raffinose content and qRT-PCR gene quantification.

[0087] The expression changes of genes related to galactose pathway and the changes of raffinose content in tea plant were observed after overexpressing empty vector pCAMBIA 1305 and pCAMBIA 1305-CsABF8 in vivo. The results showed that the expression of target genes CsGolS1 / 2, CsRaf6 increased significantly, and the raffinose content in tea leaves also increased significantly with the overexpression of CsABF8 gene in vivo. It was verified again that CsABF8 gene increased the raffinose content in tea plant by regulating the promoters of CsGolS1 / 2, CsRaf6 to make tea plant cope with drought stress. See Figure 4 and Figure 5 .

[0088] Although the above embodiments have been described in detail, they are only part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which are within the protection scope of the present application.

Claims

1. CsABF8 Application of genes in regulating raffinose content in tea plants; CsABF8 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1; The application is negative regulation. CsABF8 Application or positive regulation of genes in reducing raffinose content in tea plants CsABF8 Application of genes in increasing raffinose content in tea plants.

Images