Preparation method of PSR.Syn.CD19.CD38 CAR-T cells, cells thereof and applications

Abstract

The present invention provides a method for preparing PSR.Syn.CD19.CD38 CAR-T cells, as well as the cells and their applications. The PSR.Syn.CD19.CD38 CAR-T cells refer to CAR-T cells that will induce the expression of the effector molecule anti-CD38-CAR after co-incubation with CD19 antigen-positive tumor cells. Only when the tumor cells express both CD19 and CD38 antigens can the CAR-T cells recognize and kill the tumor. The CAR-T cells of the present invention can efficiently and specifically kill tumor cells (CD19+CD38+), have a persistent killing effect, and have a safety switch for initiating the killing function. In addition, in addition to specifically killing tumors, the cells of the present invention have a high cell proliferation rate, and the large amount of secreted IL-2, IFN-γ, TNF-α, and Granzyme B can enhance the anti-tumor function, greatly improving the safety of the application of the cells of the present invention.

Description

Technical Field

[0001] The present invention relates to the field of cell therapy, and in particular to a method for preparing PSR.Syn.CD19.CD38 CAR-T cells, and the cells and applications thereof. Background Art

[0002] CAR-T cell therapy is a therapy that transfers the coding gene of a chimeric antigen receptor CAR specific to an antigen into T cells, and then re-injects the cells into a patient. The CAR expressed by the T cells recognizes the target antigen on the surface of tumor cells, activates the killing activity of the T cells, and then releases perforin, granzyme, cytokines, etc. to exert a tumor killing effect. CAR-T cells directly exert an anti-tumor killing effect without the recognition restriction of the major histocompatibility complex (MHC).

[0003] The side effects of CAR-T cell therapy include cytokine release syndrome, cytopenia, neurotoxicity syndrome, graft-versus-host disease (GVHD), "On target off tumor" toxicity, etc. Among them, "On target off tumor" toxicity is related to the single and mechanical killing recognition mode of CAR-T cells.

[0004] Roybal et al. newly developed a SynNotch system in 2016, which is an "AND GATE" circuit system and has been successfully applied to CAR-T cell therapy. The action mode of the SynNotch system: two corresponding antigens need to be simultaneously expressed on the surface of tumor cells to activate the specific killing function of SynNotch CAR-T (Syn-CAR-T) cells. Therefore, Syn-CAR-T cells can achieve the goal of intelligent recognition and killing of tumors, thereby improving the safety of CAR-T cell therapy. The SynNotch system only modifies and replaces the extracellular region, intracellular region, and downstream effector element of the wild-type Notch receptor, and retains the core regulatory region of the Notch receptor. The extracellular region (input recognition signal) can be replaced with an scfv molecule of a homologous specific antibody targeting various tumor cells (such as CD19-scfv), and the downstream effector element (output transcription signal) can be replaced with an antibody scfv molecule, cytokine, immune activation or inhibition molecule, fluorescent protein, etc. The NICD required for transcriptional regulation is replaced with an artificial transcription factor Gal4-VP64, which is a new fusion protein obtained by combining two natural transcription factors. The principle of the Gal4 / VP16-UAS expression system is that after the DNA binding domain of Gal4 binds to the upstream activation sequence (UAS), it can specifically activate the transcription of target genes, and the herpes simplex virus VP16 protein can enhance gene transcription and expression. This system has been widely used in the research of gene expression regulation.

[0005] SynNotch is a synthetic Notch receptor. The mouse Notch1 receptor is modified, with its extracellular domain replaced by a single-chain antibody (scfv of antibody A), its intracellular domain replaced by the transcriptional activation domain Gal4VP64, and only the transmembrane core domain (NC) that can be recognized and cleaved by proteases is retained. The Notch receptor protein consists of an extracellular region fragment (NECD), a transmembrane region fragment (TMD), and an intracellular region fragment (NICD). When the receptor in the extracellular region binds to the ligand, its conformation changes, exposing the cleavage site, which is recognized by metalloprotease and γ-secretase for cleavage. After cleavage, the intracellular region NICD is released. NICD can translocate into the nucleus through the nuclear localization signal NSL and act as a transcription factor, thus activating the downstream signaling pathway.

[0006] The response program of the SynNotch system represents a strategy for reconstructing T cell responses. Taking SynNotch CAR-T cells as an example, two corresponding antigens need to be expressed simultaneously on the surface of tumor cells to activate the specific killing function of CAR-T cells. Therefore, SynNotch CAR-T cells can achieve the goal of precisely recognizing and killing tumors. However, the SynNotch system is relatively large. The system control elements include the Notch receptor core region, the intracellular transcription factor Gal4VP64, the UAS recognition sequence, and the internal promoter, which are about 2.5 kb in total. The input signal molecules (such as CD19-scfv) and output signal molecules (such as BCMA-CAR) in the editable region of the system are about 2.5 kb in total. The entire system occupies about 5 kb and needs to be delivered through two lentiviral vector plasmids, namely a GAL4 induction vector and a UAS effector vector. Therefore, when transducing target cells, not only two kinds of lentiviral vectors need to be prepared, but also dual-virus transduction of target cells is required.

[0007] The SynNotch system also faces a problem. When the UAS effector vector is not activated, it does not express effector molecules, and flow cytometry cannot detect the transduction efficiency unless an additional promoter is added to express a fluorescent protein signal alone for transduction efficiency detection. Using lentiviral vectors for dual-virus transduction of T cells will cause a preparation and production problem, that is, the efficiency of preparing double-positive T cells is low, and flow cytometry sorting and enrichment are required to obtain T cells with a high double-positive rate. In addition, due to the toxicity problem of the VSV-G envelope protein of lentiviral vectors and the use of the third-generation self-inactivating lentiviral vector for packaging, it can only be transiently transfected and packaged, cannot be prepared on a large scale, has a low packaging titer, and requires enrichment and purification, which greatly limits the clinical application of Syn-CAR-T cell therapy. Due to the above reasons, the application of the SynNotch system in CAR-T cell therapy is greatly limited, and further optimization of the receptor system or vector is needed.

[0008] The problem of low preparation efficiency faced by delivering the SynNotch system through lentiviral vectors can be solved by replacing the viral vector for packaging. Commonly used viral vectors currently include γ-retroviral vectors (γ-RV). γ-RV belongs to simple retroviruses, with a diameter of about 100 nm, an envelope, and its genome is two copies of positive-strand RNA, with a genome size of about 8.3 kb. The genome only includes two LTRs, Gag-Pol, and Env. γ-RV can only transduce dividing cells and cannot transduce non-dividing cells. It can integrate into the host genome, has a high packaging titer, and inserting an exogenous target gene larger than 4 kb will greatly reduce the vector packaging titer. To further improve the safety of γ-RV and reduce the generation of replication-competent RCR, the U3 promoter of the 3' LTR of γ-RV is deleted and transformed into a self-inactivating γ-retroviral vector (SIN-RV).

[0009] The γ-RV vector has a mature large-scale stable transfection and packaging method with a high production titer. However, the retroviral vector randomly integrates into the host chromatin, posing a risk of insertional mutagenesis inducing the expression of host proto-oncogenes. The U3 enhancer of SIN-RV is deleted, reducing the carcinogenic risk and greatly improving the safety of the vector. The challenge faced by SIN-RV is the difficulty of large-scale production of viral vectors. Due to the deletion of the U3 element, a stable transfection and packaging cell line cannot be constructed and can only be obtained through transient transfection and packaging, making it difficult to scale up production. Moreover, it is very difficult to screen out cell clones that stably transfect with SIN-RV using traditional methods. Summary of the Invention

[0010] To solve the above problems, the present invention provides a method for preparing PSR.Syn.CD19.CD38 CAR-T cells. The PSR.Syn.CD19.CD38 CAR-T cells refer to CAR-T cells that will induce the expression of the effector molecule anti-CD38-CAR after co-incubation with CD19 antigen-positive tumor cells. When the tumor cells express both CD19 and CD38 antigens, the CAR-T cells can recognize and kill the tumor. The method includes: Step 1: Using the PiggyBac transposon system to construct a stably transfected SIN-γ-RV vector, that is, the PSR vector; Step 2: Expressing the SynNotch system with the PSR vector prepared in Step 1, combining the GAL4 induction vector and the UAS effector vector of the SynNotch system on one PSR vector, so that the SynNotch system is delivered by one PSR vector; constructing a plasmid of the PSR.Syn.CD19.CD38 CAR-T retroviral vector, that is, the PSR.SynNotch vector targeting CD19 and BCMA, with CD19 as the induction target and CD38 as the effector target plasmid vector; and Step 3: Transducing T cells with the plasmid of the above retroviral vector to prepare the PSR.Syn.CD19.BCMACAR-T cells.

[0011] The PiggyBac transposon (PB) system belongs to DNA transposons. Through the "cut-and-paste" mechanism, the target gene between the ITRs can be integrated into the target cell genome and stably expressed for a long time. In the PB system, the ends of the PB transposon are 13bp long inverted repeat sequences (ITRs), and the PB transposase is expressed by a separate plasmid. For the PB integration mechanism, after double plasmid transfection, the PB transposase recognizes the ITRs at both ends of the vector, excises from both ends of the ITRs to become a free PB transposon (carrying the target gene), the genomic TTAA site is cut to form sticky ends, and the PB transposon is inserted into the "TTAA" site of the genome for integration.

[0012] In one embodiment, in Step 1, the 5’LTR, 5’UTR, and 3’SIN-LTR sequences of the SIN-γ-RV vector are sequentially inserted between the 5’ITR and 3’ITR sequences of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes the Ψ element that is the packaging signal of the viral vector and the SD that is the splicing donor site. In the 3’SIN-LTR sequence, the U3 region is deleted, and only the R region and U5 region are retained.

[0013] In one embodiment, all Gag and Pol coding region sequences and the start codon ATG are deleted from the 5’UTR.

[0014] In one embodiment, when constructing the PSR.Syn.CD19.BCMA plasmid, an effector receptor UAS anti-CD38-CAR, SFFV promoter, SP signal peptide, Myc tag, an inducible receptor anti-CD19 scfv-Notch-Gal4VP64, and WPRE element are inserted between the 5’LTR and 3’SIN-LTR respectively, and the inducible receptor is expressed under the initiation of the SFFV promoter.

[0015] In one embodiment, when constructing the plasmid of the PSR.Syn.CD19.CD38 retroviral vector, two molecular tags CopGFP P2A Puro for screening monoclonal cells are inserted between the 3’SIN-LTR and 3’TIR transposon, that is, the CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells and are linked by P2A.

[0016] In one embodiment, the molecular tag is expressed under the initiation of the composite promoter hEF1α-HTLV.

[0017] In one embodiment, the present invention provides a PSR.Syn.CD19.CD38 CAR-T cell constructed by the above method.

[0018] In one embodiment, the present invention provides the use of the above PSR.Syn.CD19.CD38 CAR-T cell in the preparation of anti-tumor drugs.

[0019] In one embodiment, the present invention provides a pharmaceutical composition for treating tumors, which contains the above CAR-T cell, and a pharmaceutically acceptable carrier, diluent or excipient.

[0020] In one embodiment, the present invention provides a method for inhibiting tumor cells in vitro, including contacting the tumor cells with the above CAR-T cell or the above pharmaceutical composition, thereby inhibiting the tumor cells.

[0021] The PiggyBac transposon (PB) system belongs to DNA transposons. Through the "cut-and-paste" mechanism, the target gene between the ITRs can be integrated into the genome of target cells and stably expressed for a long time. The present invention combines the PiggyBac transposon system and SIN-RV to construct a vector (PSR) stably transfected with SIN-RV. To facilitate the rapid screening of cell clones stably transfected with SIN-RV, a fluorescent protein CopGFP and a puromycin drug selection gene are inserted during vector design. Theoretically, the packaging element of the novel PSR vector designed in the present invention is only 1.1 kb, while the packaging element of the classical MFG vector is 2.6 kb, greatly improving the vector packaging capacity. Moreover, the CopGFP and puromycin drug selection genes on the PSR vector greatly improve the screening efficiency of cell clones stably transfected with SIN-RV.

[0022] The present invention uses the PSR vector to express the SynNotch system, combines the GAL4 induction vector and the UAS effector vector on one PSR vector (single vector system). Only one PSR.SynNotch vector needs to be constructed for virus packaging, and a single virus vector transduces target cells. When the UAS effector element is not activated and does not express, the tag of the GAL4 induction element can be used to detect the transduction efficiency. The PSR.SynNotch system of the present invention not only solves the problem that it is difficult to detect the transduction efficiency of downstream effector molecules in the original double-vector system, but also solves the problem of low efficiency in preparing double-positive cells by transducing target cells with double vectors. Most importantly, a stably transfected packaging cell line can be constructed for large-scale production, which is very beneficial to the application of the SynNotch system.

[0023] To further verify the induction efficiency of the SynNotch system in the PSR.Syn vector, the present invention selects 4 tumor antigens (human BCMA antigen, human CD38 antigen, human CD19 antigen, human GPC3 antigen) as targets, and constructs PSR.SynCAR vectors respectively. To facilitate the detection of the induction efficiency of the SynNotch system, the UAS downstream effector molecule will select the fluorescent protein tagBFP. After co-culturing with the corresponding tumor cells, the activation efficiency of the SynNotch receptor in the PSR.Syn vector can be evaluated by detecting the expression efficiency of tagBFP, and the target with the optimal induction efficiency can be screened out. The results show that the induction efficiencies of the targets BCMA, CD38, and GPC3 are extremely low and are not suitable for the SynNotch system; the target CD19 has the highest induction efficiency and is most suitable for application in the SynNotch system because CD19-Syn-CAR-T cells recognize CD19 antigen-positive tumor cells, expose the cleavage site, and release the artificial transcription factor Gal4-VP64 by cleavage. Gal4-VP64 enters the nucleus through the nuclear localization signal NSL and binds to the upstream activation sequence UAS to activate the expression of downstream effector molecules.

[0024] On this basis, the present invention designs a PSR.SynNotch vector targeting CD19 antigen and CD38 antigen, with CD19 as the induction target and CD38 as the effector target. The cells of the present invention successfully prepared were co-incubated with 5 types of tumor cells (2 types of single-positive and 3 types of double-positive tumor cells) respectively to detect the induction effect. The experimental results show that the cells of the present invention have a strong intelligent type-specific induction expression function (induction efficiency greater than 70%), and the background leakage expression is low (about 0). After successfully verifying that the cells of the present invention have a strong induction expression ability, the anti-tumor function verification was started. The killing effect of the cells of the present invention on tumor cells was studied by the luciferase method, and there were 6 types of target cells. The experimental results show that at different effector-to-target ratios, the cells of the present invention have a specific killing function on double-positive tumor cells (CD19+CD38+), and have no specific killing effect on single-positive tumor cells (CD19+ or CD38+), indicating that the cells of the present invention can efficiently and specifically kill double-positive tumor cells (CD19+CD38+), and have a safety switch for initiating the killing function. Through the Incucyte real-time cell dynamic monitoring system, the experimental results show that during the co-incubation monitoring for up to 72 hours, the killing efficiency of the cells of the present invention on RPMI-CD19 cells (double-positive) and Raji-Lu tumor cells (double-positive) is higher than that of the PAN-T group, and the results indicate that the cells of the present invention have a persistent killing effect on RPMI-CD19 tumor cells and Raji-Lu tumor cells. By quantitatively detecting the cytokine content in the cell culture supernatant of the cells of the present invention by CBA method, the experimental results show that the levels of IL-2, IFN-γ, TNF-α, IL-4, IL-10, and Granzyme B secreted by the present invention group and the CAR21-T group are significantly higher than those of the PAN-T group, with statistical differences. The experimental results further indicate that the cells of the present invention have a powerful anti-tumor function (CD19+CD38+), and the induction recognition and re-killing mode can play an effective anti-tumor function. CD69 is a signal protein for early activation of T cells. By detecting the expression efficiency of CD69 on the surface of T cells, the activation differences after the cells of the present invention were incubated with different tumor cells were compared. The experimental results show that the CD69 expression efficiency (83.9%) of the cells of the present invention in the experimental group after co-incubation with CD19-positive tumor (RPMI-CD19) is similar to that of the positive control group CAR21-T group (90.1%), which is 54.9% higher than that without incubation (29.0%). The CD69 efficiency expression is lower (46.0%) after co-incubation with CD19 antigen-negative tumor (RPMI), and is similar to that of the PAN-T group (34.1%), indicating that the activation of the cells of the present invention is regulated by the SynNotch system, and can only be activated by co-incubation with double-positive tumor cells of CD19 and CD38, which is consistent with the SynNotch system regulation theory.The experiment detected the proliferation ability of T cells by the CFSE method. The experimental results showed that after CFSE staining, when the three groups of T cells were not co-incubated with tumor cells, the cell proliferation efficiency was high after 48 hours of culture, and there was no significant difference in the three groups of T cells. After incubation and culture with RPMI-CD19 cells for 48 hours, the proliferation efficiency of the present invention and CAR21-T cells was higher than that of PAN-T cells. The results show that the cell proliferation rate of the present invention under tumor cell stimulation is higher than that of PAN-T cells. In summary, the experimental results show that the cells of the present invention can efficiently and specifically kill tumor cells (CD19+CD38+), have a persistent killing effect, and have a safety switch to start the killing function. In addition, in addition to being able to specifically kill tumors, the cell proliferation rate of the present invention is high, and the proliferation rate under tumor cell stimulation is higher than that of the PAN-T group. When the cells of the present invention specifically kill tumors, a large amount of IL-2, IFN-γ, TNF-α, and Granzyme B secreted can improve the anti-tumor function, which greatly improves the safety of the application of the cells of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 It is a schematic diagram of the design of the vector PSR vector plasmid of the present invention;

[0027] Figure 2 It is a schematic diagram of the design of the PSR.Syn.BFP plasmid of the present invention;

[0028] Figure 3 This is a graph showing the transduction efficiency of Syn-CAR-T flow cytometry of the present invention;

[0029] Figure 4 This is a flow cytometry result diagram of the induction efficiency after incubation of Syn-CAR-T cells and tumor cells;

[0030] Figure 5 It is a schematic diagram of the design of the PSR.Syn.CD19.CD38 plasmid of the present invention;

[0031] Figure 6 This is a diagram showing the gel electrophoresis identification results of the PCR amplification product in the construction of the vector Syn-CAR188 of the present invention;

[0032] Figure 7It is the result graph of detecting the killing efficiency of Syn-CAR188-T on different target cells by luciferase method (n = 3), (****p < 0.0001, ns: no statistical difference); 7A: Three groups of T cells were co-incubated with K562-CD19-CD38 (double positive) for 12 h; 7B: Co-incubated with K562-CD38 (single positive) for 15 h; 7C: Co-incubated with RPMI-CD19 (double positive) for 12 h; 7D: Co-incubated with RPMI (single positive) for 8 h; 7E: Co-incubated with Raji-Lu (double positive) for 12 h; 7F: Co-incubated with K562-CD19-BCMA (single positive) for 15 h;

[0033] Figure 8 It is the graph of detecting the persistent killing effect of Syn-CAR188-T on different target cells by Incucyte method (n = 3), where 8A: Three groups of T cells were co-incubated with RPMI-CD19, and the effector-to-target ratio was 1:2; 8B: Three groups of T cells were co-incubated with Raji-Lu cells, and the effector-to-target ratio was 1:1;

[0034] Figure 9 Result graph of detecting the expression of CD69 in Syn-CAR188-T cells by flow cytometry (n = 3), where 9A: PAN-T cells were not incubated; 9B: PAN-T cells were co-incubated with RPMI-CD19; 9C: PAN-T cells were co-incubated with RPMI; 9D: CAR21-T cells were not incubated; 9E: CAR21-T cells were co-incubated with RPMI-CD19; 9F: CAR21-T cells were co-incubated with RPMI; 9G: Syn-CAR188-T cells were not incubated; 9H: Syn-CAR188-T cells were co-incubated with RPMI-CD19; 9I: Syn-CAR188-T cells were co-incubated with RPMI. Specific embodiments

[0035] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of this application.

[0036] DH5α competent cells were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. PB transposon plasmid and PB transposase plasmid were commercially purchased. Plasmids pCDH-CMV-TNFRSF17 (human), pHR_PGK_antiCD19_synNotch_Gal4VP64, pHR_Gal4UAS_tBFP_PGK_mCherry, and pCDH-CMV-TNFRSF17 (human)-EF1a-CopGFP-T2A-Puro were purchased from Wuhan Miaoling Biotechnology Co., Ltd. Other genes such as EGFP, WPRE, and SFFV were from commercialized plasmids. Pheonix-Ampho cells and PG13 cells were purchased from the American Type Culture Collection (ATCC). 293T cells were purchased from the Cell Resource Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences, Peking Union Medical College.

[0037] Pyrobest DNA polymerase was from TAKARA BIO Inc., Japan; plasmid purification kit was from QIAGEN, Germany; 50×TAE gel electrophoresis buffer; ethidium bromide (EB) nucleic acid staining solution was from Beijing Solarbio Science & Technology Co., Ltd.; 6×DNA loading buffer was from TAKARA; sodium chloride, agarose, yeast powder, tryptone, agarose, dimethyl sulfoxide (DMSO solution) were from Sigma, USA; absolute ethanol was from Beijing Chemical Industry Group Co., Ltd.; PCR product purification kit was from Nanjing Novozymes Biotech Co., Ltd.; DNA Assembly Mix Plus and puromycin hydrochloride were from Beijing Lamboid Trading Co., Ltd.; endotoxin-free midiprep plasmid extraction kit was from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Ampicillin powder was from BioRuler, USA. DMEM medium, Opti-MEM medium, fetal bovine serum (FBS), trypsin (1×EDTA), phosphate buffer (1×PBS), 100× penicillin-streptomycin solution (P / S) were from Gibco, USA; FuGene HD transfection reagent was from Promega, USA; Retronectin (recombinant human fibronectin fragment) was from Takara, Japan; trypan blue solution was from Invitrogen, USA. Polybrene virus infection enhancement reagent was from Beijing Solarbio Science & Technology Co., Ltd. Unless otherwise specified, the reagents and raw materials used in the present invention were from commercialized reagents.

[0038] Example 1 Construction of PSR.SynNotch vector and preparation of Syn-CAR-T cells targeting different antigens

[0039] I. Construction of PSR vector

[0040] The present invention utilizes the PB transposon system (PB transposon plasmid and PB transposase plasmid) to construct a stably transfected SIN-γ-RV vector (PSR), which can stably produce a self-inactivating retroviral vector. The specific design schematic diagram is as shown in Figure 1 Figure 1. Between the 5' ITR and 3' ITR sequences of the PB transposon, the 5' LTR of the SIN-γ-RV vector, the non-coding region UTR (the Ψ element is the packaging signal of the viral vector, and SD is the splicing donor site), and the 3' SIN-LTR sequence are inserted. According to the description in SCHAMBACH A, MUELLER D, GALLAM, et al. Overcoming promoter competition in packaging cells improves production of self-inactivating retroviral vectors [J]. Gene Therapy, 2006, 13(21): 1524-33, the SIN-γ-RV vector was designed based on pSRS11.SF.GFP. SFFV is the internal promoter of the PSR vector. To facilitate the insertion of the target gene in the later stage, a multiple cloning site sequence (MCS) is inserted after the SFFV promoter. To improve the packaging titer of the viral vector, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence is inserted at the C-terminus of the MCS. To facilitate the screening of stable transfected cell lines, two screening tags are designed. After the 3' SIN-LTR element, hEF1-HTLV promoter-CopGFP-T2A-Puro is inserted. Among them, the Puro gene can be used for puromycin drug screening, and the CopGFP gene can be used for the later fluorescence microscopy screening of highly expressed monoclonal cells. All Gag and Pol coding region sequences and the start codon ATG are deleted from the 5'-end packaging signal non-coding region (5'UTR), thereby further improving the vector packaging capacity and vector safety. The designed vector PSR.MCS was sent to Genewiz Biotechnology Co., Ltd. for gene synthesis.

[0041] II. Design and construction of PSR.SynNotch plasmids targeting different antigens

[0042] Since the downstream effector molecule needs to be induced by the transcription factor Gal4VP64 and cannot be placed downstream of the promoter, it should be designed upstream of the internal promoter and the Gal4-induced receptor. The plasmids of the PSR.SynNotch vectors targeting CD19 molecule, BCMA molecule, CD38 molecule, and GPC3 molecule are named PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.GPC3.BFP (p170). The schematic diagrams of the four plasmid designs are as shown inFigure 2 As shown, the effector molecule (UAS tagBFP) of the SynNotch system and the inducing receptor (SFFV_scfv Notch Gal4VP64) are respectively inserted between the 5’LTR and the 3’SIN-LTR, and the inducing receptor protein is expressed under the initiation of the SFFV promoter. Additionally, a P2A-EGFP fluorescent protein is added downstream of the GAL4VP64 protein as a detection tag for the vector receptor proteins (CD19scfv, BCMA scfv, CD38 scfv, GPC3scfv).

[0043] 5’LTR (SEQ ID NO.1): ATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTaTTCCCAATAAAgCCTCTTGCTGTTTGCATCCGAATCGTGGaCTCGCTGaTCCTTGGGAGGGTCTCCTCaGAtTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0044] 5’UTR (SEQ ID NO.2): TTGGAGACCCCTGCCCAGGGACCACCGACCCCCCCGCCGGGAGGTAAGCTGGCCAGCGGTCGTTTCGTGTCTGTCTCTGTCTTTGGGCGTGTTTGTGCCGGCATCTAGTGTTTGCGCCTGCGTCTGTACTAGTTGGCTAACTAGATCTGTATCTGGCGGTCCCGCGGAAGAACTGACGAGTTCGTATTCCCGGCCGCAGCCCCTGGGAGACGTCCCAGCGGCCTCGGGGGCCCGTTTTGTGGCCCATTCTGTATCAGTTAACCTACCCGAGTCGGACTTTTTGGAGCTCCGCCACTGTCCGAGGGGTACGTGGCTTTGTTGGGGGACGAGAGACAGAGACACTTCCCGCCCCCGTCTGAATTTTTGCTTTCGGTTTTACGCCGAAACCGCGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATTAGCGGCCCG

[0045] 3’SIN-LTR (SEQ ID NO.3): ATGAAAGACCCCACCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTGTTCtCAATAAACCCTCTTGCaGTTGCATCCGAcTCGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0046] The construction of the 4 plasmids was assembled from 4 target DNA fragments and a vector through seamless cloning. The construction of all 4 plasmids consisted of 4 DNA fragments and a vector. Among them, 3 DNA fragments and the vector fragment were the same in each plasmid, and only the template plasmid of the SFFV_scfv Notch Gal4 fragment was different. The 4 fragments of the p167 plasmid were as follows: Fragment 1 (UAS tagBFP), with the template from pHR_Gal4UAS_tBFP_PGK_mCherry (Wuhan Miaoling); Fragment 2, with the template from pHR_PGK_antiCD19_synNotch_Gal4VP64 (Wuhan Miaoling); Fragment 3 (P2A EGFP), which was a fusion fragment of EGFP and P2A, pBT2-4xUAS:P2A-EGFP (addgene#127591); Fragment 4 (WPRE), and Fragment 8 was the vector fragment after double digestion. The SFFV_scfv Notch Gal4 of the remaining 3 plasmids were Fragment 5, Fragment 6, and Fragment 7 respectively, and the templates were replaced with anti BCMA scfv, anti CD38 scfv, and anti-GPC3-scfv respectively on the basis of Fragment 2. Among them, antiBCMAscfv was from the FDA-approved bb2121 anti-BCMA antibody; anti CD38 scfv was screened by the phage display antibody library technology of this research team and had been proven to have strong killing functions in in vitro and in vivo experiments. For details, see LI X, FENG Y, SHANG F, et al. Characterization of the Therapeutic Effects of Novel Chimeric Antigen Receptor T Cells Targeting CD38 on Multiple Myeloma[J]. Frontiers In Oncology, 2021, 11:703087; anti BCMA scfv was from the commercial antibody mouse GC33 clone. Homologous arms needed to be added to the amplification primers. Among them, the primers for Fragment 2, Fragment 5, Fragment 6, and Fragment 7 were the same. The primer sequences are shown in Table 1 below. The vector plasmid was PSR.MCS, and the restriction enzymes were XhoI and NotI-HF. The PCR products and the enzyme digestion products were subjected to agarose gel electrophoresis and gel recovery.

[0047] Table 1 Design of PCR Amplification Primers for Four Targeted PSR.SynNotch Plasmids

[0048]

[0049] Note: The underlined part is the homologous arm.

[0050] Among them, the S-16-1F sequence number is SEQ ID NO.4, the S-16-1R sequence number is SEQ ID NO.5, the S-16-2F sequence number is SEQ ID NO.6, the S-16-2R sequence number is SEQ ID NO.7, the S-16-3F sequence number is SEQ ID NO.8, the S-16-3R sequence number is SEQ ID NO.9, the S-16-4F sequence number is SEQ ID NO.10, and the S-16-1R sequence number is SEQ ID NO.11.

[0051] The preparation processes of the target fragments are as follows: PCR amplification, agarose gel electrophoresis, and gel recovery. Finally, the 4 recovered target fragments are recombinantly ligated, and the ligation reaction is carried out at 50 °C for 30 min. The ligation product is transformed into competent Escherichia coli DH5α and then spread on an LB plate, cultured overnight at 37 °C, 3 - 5 positive clones are selected for enlarged culture, and the plasmid is extracted and sent to the company for sequencing. The plasmid strain with correct sequencing is selected for enlarged culture, and the plasmid is extracted and concentrated.

[0052] III. Preparation of four vectors PSR.Syn.BFP self-inactivating retroviral vectors

[0053] After the Pheonix-Ampho cells and PG13 cells are resuscitated, the cell state is good. The cell passage number is preferably within 5 generations. When the cell confluence is about 80%, the cells are digested and inoculated into a six-well plate with a cell density of 5×10 5 cells / well, 2 mL per well, and 4 wells are reserved for later flow cytometry to detect the transfection efficiency. On the second day after inoculation, when the cell confluence is 70% - 80%. Remove the culture medium and add fresh warm Opti-MEM medium drop by drop, 1.8 mL per well. Calculate the volume of the plasmid required for transfection, and 3.3 μg of plasmid is added per well. The transfection plasmids are PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), PSR.GPC3.BFP (p170), diluted with Opti-MEM medium to 200 μL / well, gently pipette to mix, and incubate at room temperature for 10 min. Add the incubated transfection complex drop by drop and evenly into the six-well plate, 200 μL per well, gently mix the six-well plate crosswise, and place it in a 37 °C, 5% CO 2 cell incubator for culture.

[0054] 24 h after transfection, remove the supernatant of the six-well plate and replace it with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and place it at 32 °C, 5% CO 2Cultured in a cell incubator. After culturing at 32°C for 24 h, gently aspirate the supernatant (virus vector supernatant at 48 h), replace it with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and continue to place it at 32°C, 5% CO 2 Cultured in a cell incubator. After culturing for 24 h, collect the cell supernatant (virus vector supernatant at 72 h). The collected supernatant is filtered and purified using a 0.45-μm disposable needle filter, and the filtered virus vector is immediately aliquoted and stored in an -80°C refrigerator.

[0055] IV. Preparation of Syn-CAR-T

[0056] Collect 10 mL of healthy volunteer venous blood, extract PBMC cells, add IL-2 and OKT-3 to activate T cells, culture with AIM-V complete medium for 48 h, and then transduce T cells with the above-prepared 4 kinds of retrovirus vector supernatants PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), PSR.Syn.GPC3.BFP (Syn-CAR170). The transduction enhancer used is retronectin.

[0057] One day before transduction, add the transduction accelerator Retronetin and incubate it in a non-treated 12-well plate, that is, add 1 mL of 1×PBS solution and 10 μL of Retronetin reagent to each well, and mix well. Store it in the dark at 4°C. 48 hours after T cell activation, observe the growth status of T cells. If the T cells grow in large clusters, the growth status is good, and virus vector transduction of T cells can be carried out. Take out the non-treated 12-well plate incubated with Retronetin, and recover the Retronetin supernatant in the 12-well plate. Add 2% BSA for neutralization for 30 minutes. Add 1×PBS solution to wash and remove the PBS solution. Add 1 mL of retroviral vector supernatant (Syn-CAR167, Syn-CAR168, Syn-CAR169, Syn-CAR170) to each well, and centrifuge at 2500 rpm for 60 minutes at 32°C. Treat T cells, take 5×106 cells / well, add 1 mL of retroviral vector supernatant and mix well, and centrifuge at 2500 rpm for 60 minutes at 32°C. After centrifugation, put it back into the cell culture incubator for incubation for at least 1 hour. After incubation, add retroviral vector supernatant again and centrifuge for 1 hour for transduction, and put it back into the incubator for incubation for at least 1 hour after centrifugation. After incubation, centrifuge the cells in each well and replace them with 1 mL of fresh AIM-V complete medium for culture, and add IL-2, 1 μL / well. Put it back into the incubator for culture. If the virus vector titer is low, transduction can be continued the next day, and the method is the same as on the first day. 48 hours after transduction, take an appropriate amount of Pan-T cells as a blank control, and use a flow cytometer to detect the transduction efficiency. The positive rate of EGFP detection is the transduction efficiency.

[0058] V. Culture of target cells

[0059] Resuscitate RPMI-CD19, K562-hBCMA, RPMI, and HepG2 from the liquid nitrogen tank respectively. RPMI-CD19, K562-hBCMA, and RPMI cells are aseptically cultured in RPMI complete medium in a cell culture incubator at 37°C and 5% CO2, and passaged with RPMI complete medium every 48 hours to make the cell density 5×10 5 cells / mL. After culturing to the logarithmic growth phase, they are used for subsequent experiments until the end of the experiment. HepG2 cells are aseptically cultured in MEM complete medium in a cell culture incubator at 37°C and 5% CO2, and passaged with MEM complete medium every 48 hours to make the cell density 5×10 5 cells / mL. After culturing to the logarithmic growth phase, they are used for subsequent experiments until the end of the experiment.

[0060] VI. Co-incubation culture of Syn-CAR-T cells and target cells

[0061] Observe the growth status of target cells and Syn-CAR-T cells. If the cell status is good, co-incubation culture can be carried out. The co-incubation culture is divided into 5 groups in total. Syn-CAR167 is co-cultured with RPMI-CD19 and RPMI respectively. Syn-CAR168 is co-cultured with K562-hBCMA. Syn-CAR169 is co-cultured with RPMI. Syn-CAR170 is co-cultured with HepG2. Perform cell counting on the target cells and Syn-CAR-T cells. The ratio of effector cells to target cells for co-incubation culture is 1:1. Take 5×10 5 cells in a 1.5 mL centrifuge tube. Centrifuge at 300 g for 5 min. Carefully remove the supernatant and resuspend with AIM-V complete medium. Mix the effector cells and target cells in each group and supplement IL-2. Place them back in the incubator for culture. After culturing for 48 h, process the cells for flow cytometry detection. The flow cytometry detection is divided into 9 groups, including 5 co-incubation groups and 4 non-incubation groups.

[0062] VII. Experimental Results

[0063] 1. Four PSR.SynNotch plasmids targeting different antigens were successfully constructed

[0064] In this experiment, the lentiviral dual-vector of the original SynNotch system was modified into a PSR (stable self-inactivating γ-retroviral vector) single-vector for transduction, namely PSR.SynNotch. To verify the induction efficiency of the PSR.SynNotch system for different antigen targets, 4 kinds of PSR.SynNotch vectors targeting antigens were designed, namely targeting CD19, BCMA, CD38, and GPC3 respectively, and the effector molecule after induction was the reporter gene tagBFP fluorescent protein. Since the downstream effector molecule needs to be induced by the transcription factor Gal4VP64 and cannot be placed downstream of the promoter, it was designed upstream of the internal promoter and the Gal4-inducible receptor. The 4 constructed plasmids PSR.Syn.CD19.BFP, PSR.Syn.BCMA.BFP, PSR.Syn.CD38.BFP, PSR.Syn.GPC3.BFP, downloaded the sequencing results from the official website of the sequencing company, and analyzed and compared the sequencing results with the biological software SnapGene. The sequencing results were correct. Therefore, 4 vector plasmids PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.Syn.GPC3.BFP (p170) were successfully constructed in this experiment.

[0065] 2. Four kinds of Syn-CAR-T cells with different targets were successfully prepared

[0066] Four successfully constructed plasmids were transiently transfected into Ampho cells. Viral vectors were harvested 48 h and 72 h after transfection, namely PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), and PSR.Syn.GPC3.BFP (Syn-CAR170). Volunteers were recruited to collect venous blood. PBMC was isolated and activated for culture for 48 h, and the harvested viral vectors were transduced into T cells. The transduction efficiency was detected by flow cytometry 48 h after transduction. Since P2A-EGFP was added as a molecular tag at the C-terminus of Gal4VP64, the positive rate of EGFP detected by flow cytometry could be used as the transduction efficiency of T cells. The flow cytometry results are as follows Figure 3 As shown, the transduction efficiencies of the four Syn-CAR-Ts were 50.0%, 30.36%, 36.36%, and 41.68% respectively. The transduction efficiency was greater than 30%, indicating that four types of Syn-CAR-T cells were successfully prepared in this experiment.

[0067] 3. Functional verification of four Syn-CAR-T cells with different targets

[0068] Target cells RPMI-CD19, K562-hBCMA, RPMI, and HepG2 were resuscitated and cultured respectively. Four Syn-CAR-T cells with different antigen targets were co-incubated with the corresponding target cells at a ratio of 1:1 for 48 h. There were a total of 5 groups of co-incubation. Syn-CAR167 was co-cultured with RPMI-CD19 and RPMI respectively, Syn-CAR168 was co-cultured with K562-hBCMA, Syn-CAR169 was co-cultured with RPMI, and Syn-CAR170 was co-cultured with HepG2 respectively. There were 4 groups without incubation, namely Syn-CAR167, Syn-CAR168, Syn-CAR169, and Syn-CAR170. The flow cytometry results are as follows Figure 4As shown in the figure. When the 4 types of Syn-CAR-T were not co-incubated with tumor cells, the effector molecule tagBFP fluorescent protein had low background leakage expression. The MFI (mean fluorescence intensity) values of the 4 types of Syn-CAR-T were 3344, 3228, 4986, and 3257 respectively, all higher than that of the Control group (2567). When the 4 types of Syn-CAR-T were co-incubated with CD19+, BCMA+, CD38+, and GPC3+ tumor cells respectively, only Syn-CAR167 had the highest induction efficiency (MFI: 17528), and the MFI value was 5.2 times that when not incubated (3344). When Syn-CAR167 was co-cultured with RPMI (CD19-), the induction efficiency was extremely low, and the MFI value was the same as that when not incubated, proving that Syn-CAR167-T cells can be specifically induced to express, and only co-incubation with CD19-positive cells can induce expression. The MFI values of the induction groups of the other 3 groups of Syn-CAR-T were similar to those of the non-induced groups, indicating that the induction efficiencies of the targets BCMA, CD38, and GPC3 were extremely low and not suitable for the SynNotch system. In summary, the target CD19 had the highest induction efficiency and was most suitable for application in the SynNotch system.

[0069] Example 2 Preparation and anti-tumor function verification of PSR.Syn.CD19.CD38 CAR-T cells

[0070] I. Construction of the novel vector PSR.Syn.CD19.CD38 plasmid

[0071] Construct a PSR.SynNotch vector targeting CD19 and CD38. CD19 is used as the induction target, and CD38 is used as the effector target, that is, after the constructed PSR.Syn.CD19.CD38 CAR-T (Syn-CAR188-T) cells are co-incubated with CD19 antigen-positive tumor cells, the effector molecule anti-CD38-CAR will be induced to express. When the tumor cells express both CD19 and CD38 antigens, Syn-CAR188-T will recognize and kill the tumor.

[0072] 1. Plasmid design

[0073] Since the downstream effector molecule needs to be induced by the transcription factor Gal4VP64 and cannot be placed downstream of the promoter, it should be designed upstream of the internal promoter and the Gal4 induction receptor. The plasmid pattern diagram of PSR.Syn.CD19.CD38 (Syn-CAR188) is as Figure 5As shown in the figure, the effector molecule UAS anti-CD38-CAR, SFFV promoter, SP signal peptide, Myc tag, Gal4-inducible receptor anti CD19 scfv-Notch-Gal4VP64, and WPRE element are inserted between the 5’LTR and 3’SIN-LTR respectively. CopGFP-P2A-Puro is inserted between the 3’SIN-LTR and 3’TIR transposon. Among them, anti-CD38 scfv is the CAR21 molecule screened by the previous phage display technology, and anti-CD38-CAR (CAR21) has been proven to have highly efficient specific anti-tumor activity both in vivo and in vitro. The Gal4-inducible receptor anti CD19 scfv is expressed under the initiation of the promoter SFFV, and a myc tag is added at the 5’ end to detect the transduction efficiency of the viral vector. CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells, which are linked by P2A and expressed under the initiation of the composite promoter hEF1α-HTLV. The total length of the gene fragment inserted between the 5’UTR and 3’SINLTR of the vector is 5500bp, which is regarded as a super-large packaging capacity, while the conventional packaging size of the γ-retroviral vector is about 4kb. The larger the designed inserted target fragment, the higher the packaging difficulty of the viral vector, and the titer of the viral vector production will decrease accordingly. From the 5’LTR to the 3’SIN-LTR, that is, the total size of the entire recombinant SIN-γ-RV is 6629bp, which does not exceed the wild-type γ-retroviral genome of 8kb, and the viral vector packaging experiment can be carried out normally.

[0074] 2. PCR amplification, seamless cloning ligation, transformation, sequencing, and plasmid extraction of the target fragment

[0075] The construction of the PSR.Syn.CD19.CD38 (Syn-CAR188) plasmid consists of a total of 4 PCR amplification fragments, including the vector fragment. Fragment 1 is UAS anti-CD38-CAR, and the template plasmid is the commercial plasmid p184; Fragment 2 is anti-CD19 scfv-Notch-Gal4VP64, and the template plasmid is from the commercial plasmid p184; Fragment 3 is hEF1-HTLV promoter-CopGFP-T2A-Puro, and the template plasmid is from the commercial plasmid MFU-BCMA. Fragment 4 is the vector fragment, and the template plasmid is from the commercial plasmid p184. The PCR primers are designed as shown in Table 2 below, and the designed primers are sent to the company for synthesis.

[0076] Table 2 Design of amplification primers for plasmid Syn-CAR188

[0077]

[0078] Note: The underlined part is the homologous arm. Among them, the sequence number of S-188-1F is SEQ ID NO.12, the sequence number of S-188-1R is SEQ ID NO.13, the sequence number of S-188-2F is SEQ ID NO.14, the sequence number of S-188-2R is SEQ ID NO.15, the sequence number of S-188-3F is SEQ ID NO.16, the sequence number of S-188-3R is SEQ ID NO.17, the sequence number of S-188-4F is SEQ ID NO.18, and the sequence number of S-188-4R is SEQ ID NO.19.

[0079] The PCR products and the enzyme-digested products were subjected to agarose gel electrophoresis and gel extraction. The gel-extracted products were directly subjected to seamless cloning ligation. The 4 DNA fragments were incubated at 50 °C for 40 min for ligation. The ligation products were transformed into competent cells, plated, and 1 - 5 single colonies were picked for scale-up culture. After identification by colony PCR, the correct clones were selected for sample submission for sequencing. After sequencing alignment analysis, a clone with correct sequencing was selected for scale-up culture for plasmid extraction and sequencing analysis alignment.

[0080] 3. Experimental Results

[0081] 3.1 Gel Electrophoresis Results of the Target Fragment

[0082] For the construction of the PSR.Syn.CD19.CD38 plasmid (Syn-CAR188), there are a total of 4 PCR amplification fragments, including the vector fragment. The theoretical sizes of Fragment 1, Fragment 2, Fragment 3, and Fragment 4 (vector fragment) are 3412 bp, 3601 bp, 1973 bp, and 3665 bp, respectively. The gel electrophoresis results are as Figure 6 shown. The band sizes of Fragment 1, Fragment 2, Fragment 3, and Fragment 4 are consistent with the theoretical sizes, and the PCR amplification products are initially identified as correct.

[0083] 3.2 Sequencing Result Analysis

[0084] For the construction of the PSR.Syn.CD19.CD38 plasmid (Syn-CAR188), there are a total of 4 PCR amplification fragments, including the vector fragment. After the gel-extracted fragments were identified as correct, seamless cloning ligation was performed, followed by transformation, picking of single colonies, identification by colony PCR, and the bacterial liquid of the correct colony clones was sent to the company for sequencing. The base sequences at the junction sites of the 4 fragments were sequenced completely correctly, the sequencing was basically completed, and the sequencing results were completely correct. The experimental results show that the novel vector PSR.Syn.CD19.CD38 plasmid was successfully constructed in this experiment and named Syn-CAR188.

[0085] II. Construction of a Stable Transfected Cell Line of the Novel Vector PSR.Syn.CD19.CD38 Viral Vector

[0086] Construct a virus vector packaging cell line stably transfected with the vector PSR.Syn.CD19.CD38 (Syn-CAR188). Since the gene loaded in the vector Syn-CAR188 is too large, with the inserted fragment being 5500 bp in total and the size from 5’LTR to 3’SINLTR being 6629 bp, the packaging ability of the virus vector will be greatly reduced. In order to obtain a virus packaging cell that stably produces virus and has a high titer, monoclonal cell screening needs to be carried out on the successfully constructed stably transfected cell line. There are 3 screening markers, CopGFP fluorescent protein, puromycin drug screening, and the Myc tag upstream of the anti-CD19 scfv fragment. Ampho cells are selected as the virus packaging cell line for Syn-CAR188. The specific process is as follows: Resuscitate Ampho cells, transfect Ampho cells, perform puromycin drug screening to obtain a stably transfected cell line, detect by flow cytometry, plate monoclonal cells, observe under a fluorescence microscope, and screen monoclonal cells.

[0087] 1. Cell resuscitation, plating, transfection and cell drug screening

[0088] Resuscitate Ampho cells and observe them. When the growth state is good and the cell density reaches 80% - 90%, subculture can be carried out. After cell counting, perform plating and culture. 24 hours after cell plating, observe the cells under a microscope. When the density reaches 80% - 90% and the cell state is good, transfection can be carried out. 48 hours after transfection, perform cell subculture. Take a part of the cells for flow cytometry detection, and use the remaining cells for subculture. Add puromycin for drug screening during subculture. Screen with the drug for a long time until the cell line is stable and highly expresses Myc and CopGFP. Detect the positive rate of cells expressing Myc and CopGFP.

[0089] 2. Monoclonal plating, monoclonal cell screening, and monoclonal cell expansion culture to harvest the virus vector supernatant. When flow cytometry detects that the cell line is stable and highly expresses Myc and CopGFP, it proves that the stable transfected cell line has been successfully constructed, and monoclonal cell plating and culture can be carried out. When the 96-well monoclonal cells are cultured for about 7 days, observe the cells in the 96-well plate under a microscope, pick out the single-cell wells, and the wells with two or more cell populations are polyclonal cell wells. Observe the 96-well plate monoclonal cells under a fluorescence microscope, pick out the wells expressing CopGFP green fluorescent protein, with bright and uniform fluorescence, and make good marks as the initial positive cells. When the density of the bright and uniform initial positive cells proliferates to more than 50%, subculture can be carried out into a 24-well plate. When the cell density in the 24-well plate reaches more than 80%, subculture can be carried out into a 6-well plate. Take another part of the cells for flow cytometry detection, add the flow antibody AF647 anti-c-Myc (Biolegend) and stain for 60 min, incubate in the dark at 4 °C. After the staining is completed, detect the positive rate of cells expressing Myc and CopGFP. Screen out the monoclonal cells with a positive rate of Myc and CopGFP greater than 70% by flow cytometry detection, and make good marks. When the cell density in the 6-well plate proliferates to more than 80%, carry out cell subculture, take a part of the cells for flow cytometry detection, and the remaining cells are subcultured at a ratio of 1 to 3. Add the flow antibody AF647 anti-c-Myc (Biolegend) for staining, and detect the positive rate of cells expressing Myc and CopGFP. Screen out the monoclonal cells with a positive rate of Myc and CopGFP greater than 70% by flow cytometry detection, and make good marks. Add the flow antibody AF647 anti-c-Myc (Biolegend) for staining, and detect the positive rate of cells expressing Myc and CopGFP. Screen out the monoclonal cells with a positive rate of Myc and CopGFP greater than 70% by flow cytometry detection (two rounds of flow cytometry detection). When the cell density in the 6-well plate proliferates to more than 80%, carry out cell subculture and expansion culture. After culturing at 32 °C for 24 h, carefully collect the cell supernatant (A188-H1).

[0090] 3. Experimental results

[0091] 3.1 Construction of the stable transfected packaging cell line of the vector PSR.Syn.CD19.CD38 (Syn-CAR188)

[0092] The constructed plasmid Syn-CAR188 and the transposase plasmid were co-transfected into the virus vector packaging cell line Ampho cells. Since the Syn-CAR188 plasmid carried the CopGFP fluorescent protein and the puromycin resistance gene, puromycin drug screening was performed 48 h after transfection. To obtain a stably transfected packaging cell line, long-term drug screening was required. The plasmid Syn-CAR188 added a Myc tag upstream of the anti-CD19 scfv. Therefore, there were two tags for flow cytometry detection of transfection efficiency after transfection, namely the CopGFP fluorescent protein and the Myc tag. The positive rates of Ampho cells expressing CopGFP at 48 h (day 2), day 10, and day 20 after transfection were 82.95%, 91.55%, and 99% respectively; the positive rates of Ampho cells expressing Myc at 48 h (day 2) and day 10 after transfection were 59.48% and 56.9% respectively. The experimental results showed that the positive rate of Ampho cells expressing CopGFP reached 99% on day 20 after transfection, proving that the Ampho packaging cell line (A188) stably transfected with the vector Syn-CAR188 had been successfully prepared in this experiment. However, at 48 h (day 2) and day 10, the positive rate of Ampho cells expressing Myc was 35% lower than that of CopGFP, which might be related to the expression efficiency of different promoters and the location of vector integration into the host genome.

[0093] 3.2. Screening of monoclonal cells stably transfected with vector PSR.Syn.CD19.CD38 (Syn-CAR188)

[0094] To obtain a virus vector packaging cell with high production titer and stable transfection, monoclonal cell screening was performed in this experiment. The stably transfected cells Syn-CAR188-Ampho (A188) were inoculated into 4 96-well plates, with 1 cell per well. Through fluorescence microscopy, 50 clones with bright and uniform green fluorescence were preliminarily screened out. When the cell density in a single well reached more than 50%, the cells were passaged to 24-well plates and 6-well plates. When passaging the 6-well plates, a part of the cells was taken for flow cytometry detection to detect the positive rates of A188 cells expressing the CopGFP fluorescent protein and the Myc tag. Monoclonal cells with positive rates greater than 70% needed to be screened out. Finally, a qualified monoclonal cell A188-47 was screened out from the initially screened 50 monoclonal cells with bright and uniform green fluorescence, and the positive rates of expressing CopGFP and the Myc tag were both greater than 70%. The positive rates were 91.26% and 86.3% respectively. After successfully screening out the monoclonal cells, the monoclonal cell A188-47 was passaged to a T75 flask for expansion culture. When the density reached more than 90%, the medium was changed and the cells were placed in a 32 °C incubator for low-temperature culture for 5 days. The cell supernatant, namely the virus vector supernatant, was harvested every 24 h.

[0095] III. Preparation and Induced Function Verification of PSR.Syn.CD19.CD38 CAR-T Cells

[0096] Prepare PSR.Syn.CD19.CD38 CAR-T cells (Syn-CAR188-T) targeting CD19 and CD38, with CD19 as the induction target and CD38 as the effector target. Syn-CAR188-T cells can only specifically kill tumor cells that simultaneously express CD19 and CD38 antigens. To verify the induced expression efficiency of Syn-CAR188-T cells, Syn-CAR188-T cells were co-cultured with tumor cells expressing different antigens (CD19 antigen, CD38 antigen), and the positive rate of anti-CD38-scfv expression in positive T cells expressing anti-CD19scfv was detected by flow cytometry. The experimental procedure was as follows: The viral vector produced by the monoclonal cell A188-47 was transduced into T cells, and after successful transduction, they were co-cultured with tumor cells, and the induction efficiency of Syn-CAR188-T cells was detected by flow cytometry.

[0097] 1. Preparation of Syn-CAR188-T Cells

[0098] Isolate human PBMC and activate and culture them with OK-T3 and IL-2. 48 h after PBMC activation and culture, add the viral vector (A188-H3) produced by the monoclonal cell A188-47 to transduce T cells. 72 h after transduction, the transduction efficiency of T cells was detected by flow cytometry, and the staining antibody was AF647 anti-c-Myc (Biolegend).

[0099] 2. Co-incubation of Syn-CAR188-T Cells with Tumor Cells

[0100] Resuscitate tumor cells expressing different antigens, RPMI-CD19, RPMI, Raji-Lu, K562-CD38, K562-CD19-CD38. Co-incubate the successfully prepared Syn-CAR188-T cells with tumor cells for 48 h, and the co-incubation culture ratio is 1:1, and the number of T cells and tumor cells is 5×10 5 cells. After the co-incubation, transfer the co-incubated T cells and tumor cells to a 1.5 mL centrifuge tube, centrifuge to remove the supernatant, resuspend and mix well with 1×PBS solution, centrifuge to remove the supernatant, add staining buffer and staining antibody and co-incubate for 60 min, incubate at 4°C in the dark. The staining antibodies are AF647 anti-c-Myc (Biolegend) and FITC-CD38FC. After staining, add staining buffer to resuspend the cells to terminate the staining, centrifuge to remove the supernatant, add staining buffer to resuspend the cells, and perform flow cytometry analysis on the machine.

[0101] 3. Experimental Results

[0102] 3.1 Preparation of Syn-CAR188-T Cells

[0103] The viral vector (A188-H3, virus supernatant harvested on the third day) produced by the prepared monoclonal cell A188-47 was transduced into T cells. At 72 h after transduction, the transduction efficiency was detected by flow cytometry. The flow cytometry results showed that the transduction efficiency of Syn-CAR188-T was 32.34%. The research results indicate that Syn-CAR188-T cells were successfully prepared in this experiment and can be used to verify the induction efficiency of co-incubation culture of Syn-CAR188-T cells with tumor cells expressing different antigens in the follow-up.

[0104] 3.2 Induction Efficiency of Syn-CAR188-T Cells on Different Tumor Cells

[0105] The successfully prepared Syn-CAR188-T cells were co-incubated with K562-CD38 cells (CD19 antigen negative, CD38 antigen positive, single-positive tumor cells), K562-CD19-CD38 cells (CD19 positive, CD38 positive, double-positive tumor cells), RPMI cells (CD19 negative, CD38 positive), RPMI-CD19 cells (CD19 positive, CD38 positive), and Raji-Lu (CD19 positive, CD38 positive) for 48 h. After the co-incubation, flow cytometry was performed. The flow cytometry staining antibodies were AF647 anti-c-Myc and FITC-CD38 Fc. The flow cytometry results were analyzed using Flowjo software, and the positive rate of T cells expressing CD38Fc-FITC was analyzed in the Myc-APC positive T cell population. The induction efficiencies of Syn-CAR188-T cells co-incubated with single-positive tumor cells K562-CD38 and RPMI were 18.3% and 1.08% respectively; the induction efficiencies co-incubated with double-positive tumor cells K562-CD19-CD38, RPMI CD19, and Raji-Lu were 73.7%, 71.9%, and 70.7% respectively; the induction efficiency without co-incubation with tumors was 0.21%. The experimental results show that the induction efficiency of Syn-CAR188-T cells is greater than 70% after co-incubation with various CD19 antigen-positive tumor cells, lower after co-incubation with CD19-negative tumor cells (18.3%, 1.08%), and the background expression without co-incubation with tumors is approximately 0, demonstrating that Syn-CAR188-T cells have a strong intelligent specific induction expression function and low background leakage expression, and can be used for further research on the specific killing effect of Syn-CAR188-T cells on tumor cells in the follow-up.

[0106] IV. Anti-tumor Function Verification of PSR.Syn.CD19.CD38 CAR-T Cells

[0107] Co-incubate PSR.Syn.CD19.CD38 CAR-T (Syn-CAR188-T) cells with tumor cells expressing different antigens (CD19 antigen, CD38 antigen). At the same time, use CAR21-T cells as the positive control group to study the anti-tumor function of Syn-CAR188-T cells. Among them, CAR21 is a CAR specifically targeting CD38 screened in the early stage, which has specific killing function against CD38 antigen-positive tumors. The killing effect of Syn-CAR188-T cells on tumor cells was mainly studied by the luciferase method, the persistent killing effect of Syn-CAR188-T cells on tumor cells was monitored by the real-time dynamic live cell imaging monitoring system Incucyte, the activation difference of Syn-CAR188-T cells after incubation with different tumor cells was studied by flow cytometry detection of the expression of CD69 on Syn-CAR188-T cells, and the proliferation effect of Syn-CAR188-T cells was studied by CFSE (live cell fluorescent dye) flow cytometry detection. The difference in cytokine secretion levels of Syn-CAR188-T cells was studied by CBA (multi-cytokine detection) flow cytometry detection.

[0108] 1. Cell Resuscitation and Culture

[0109] Resuscitate tumor cells. RPMI-CD19, RPMI, Raji-Lu, K562-CD38, K562-CD19-CD38 are all suspension cells, and the culture medium is RPMI complete medium. Prepare Syn-CAR188-T cells, CAR21-T cells and PAN-T cells and culture them.

[0110] 2. Detection of the Killing Efficiency of Syn-CAR188-T Cells on Tumor Cells by the Luciferase Method

[0111] Observed PAN-T cells, Syn-CAR188-T cells, CAR21-T cells and tumor cells under a microscope. When the cell growth state is good and the proliferation rate is normal, cell seeding can be carried out. There are a total of 5 types of target cells: RPMI-CD19, RPMI, Raji-Lu, K562-CD38, K562-CD19-CD38. It is divided into 3 groups in total: PAN-T group, Syn-CAR188-T group, CAR21-T group. There are 5 ratios of co-incubation culture of T cells and tumor cells, and the effector-to-target ratios are 2:1, 1:1, 1:2, 1:4, 1:8 respectively. For the convenience of luciferase detection, a white light-proof 96-well cell culture plate is used for the co-incubation seeding of T cells and tumor cells. Gently pipette and mix the T cells and tumor cells, and perform cell counting with trypan blue. Dilute the tumor cells to 4×10 5 cells / mL with AIM-V complete medium. Take out the white light-proof 96-well cell culture plate into the biosafety cabinet, add 50 μL of the diluted tumor cells to each well. In addition to adding tumor cells to the wells co-incubated with T cells, 3 additional maximum tumor cell release wells (without adding T cells, only tumor cells) are required.

[0112] Dilute PAN-T cells, Syn-CAR188-T cells, and CAR21-T cells with AIM-V complete medium respectively. Add the 3 groups of gradient-diluted T cells into the light-proof 96-well plate respectively, and co-incubate and culture with the target cells in an incubator. The co-incubation time of T cells and the target cells RPMI-CD19, RPMI is 8 h. The co-incubation time of T cells and the target cells Raji-Lu, K562-CD38, K562-CD19-CD38 is 12 h. After the co-incubation is completed, luciferase detection can be carried out. Detect the relative luminescence units (RLU) of each well. Killing efficiency = 1 - (RLU of experimental group - RLU of blank well) / (RLU of maximum tumor cell release well - RLU of blank well) × 100%. Each group is repeated 3 times. Use Graphpad Prim 9.5 software for statistical analysis. The experimental result data is expressed as Mean±SD. ANOVA variance analysis is used for comparing the means of multiple groups. A P value less than 0.05 indicates a statistically significant difference.

[0113] 3. Incucyte detects the persistent killing effect of Syn-CAR188-T cells on tumor cells

[0114] The Incucyte live cell imaging system can capture the real-time growth status of differently labeled cells, and shows the cell status more realistically than traditional endpoint methods, which either destroy cells or label cells. The Incucyte detection method has the advantages of being real-time and non-destructive, and can detect cells for a long time. In this experiment, the successfully prepared Syn-CAR188-T cells were co-incubated with tumor cells, and the Incucyte live cell imaging system was used to detect the cell killing effect.

[0115] It was divided into 3 groups in total: PAN-T group, Syn-CAR188-T group, and CAR21-T group. There were 5 ratios of T cells co-incubated with tumor cells, and the effector-to-target ratios were 2:1, 1:1, 1:2, 1:4, and 1:8 respectively. For the convenience of Incucyte photography detection, a transparent 96-well cell culture plate was used for plating. The total co-incubation volume was 200 μL, and the number of tumor cells per well was 2×10 4 cells. Calculate the required number of tumor cells and T cells in advance. First, dilute the tumor cells with AIM-V complete medium to 2×10 5 cells / mL, and add 100 μL of the diluted tumor cells to each well of the 96-well plate. Dilute the PAN-T cells, Syn-CAR188-T cells, and CAR21-T cells with AIM-V complete medium to the densities corresponding to the effector-to-target ratios. Add the 3 groups of T cells to the 96-well plate respectively to co-incubate and culture with the tumor cells. Set to take bright-field photos and green fluorescence photos every 2 h, and the monitoring time was 72 h. After the co-incubation and culture ended, the data analysis was performed using the Incucyte detection system software, and the experimental result data was expressed as Mean±SD.

[0116] 4. Detect cytokines secreted by Syn-CAR188-T cells against tumor cells by CBA

[0117] Cytometric bead array (CBA) is a multiplex protein quantification technique that can simultaneously detect multiple cytokines. The CBA kit used in this experiment is Human CD8 / NK Panel (13-plex), Biolegend. T cells in good growth state were co-incubated with tumor cells RPMI and SW620 cells respectively. It was divided into 3 groups in total, PAN-T group, Syn-CAR188-T group, and CAR21-T group. The effector-to-target ratio was 1:1, and the co-incubation volume was 200 μL per well. After co-incubation for 12 h, cell supernatants were collected and centrifuged at 500 g for 5 min, and then CBA detection was started. The flow cytometry detection results were uploaded to the CBA online analysis system on the Biolegend official website for data processing. The website: https: / / legendplex.qognit.com / user / login?next=home. Statistical analysis was performed using Graphpad Prim 9.5 software. The experimental result data was expressed as Mean±SD. ANOVA variance analysis was used for comparison of multiple group means. A P value less than 0.05 was considered statistically significant.

[0118] 5. Detection of CD69 on the surface of Syn-CAR188-T cells

[0119] T cells were co-incubated with RPMI-CD19 cells and RPMI cells for 12 h. The experiment was divided into 3 groups,

[0120] PAN-T group, Syn-CAR188-T group, and CAR21-T group. The effector-to-target ratio for co-incubation was 1:1. After co-incubation, staining antibodies APC / CY7-anti human CD69 and AF647 anti-c-Myc (Biolegend) were added for staining.

[0121] 6. Detection of the proliferation ability of Syn-CAR188-T cells by CFSE

[0122] The proliferation ability of Syn-CAR188-T cells was detected by the CFSE method. CFSE (Carboxyfluorescein diacetate succinimidyl ester) is a live fluorescent dye that can penetrate the cell membrane of living cells and irreversibly bind to proteins. When cells divide, the CFSE fluorescence intensity of daughter cells is halved, which can be used for cell tracing and the detection of T cell proliferation. The experiment was divided into 3 groups: the PAN-T group, the Syn-CAR188-T group, and the CAR21-T group, with an effector-to-target ratio of 1:1. First, the T cells and RPMI-CD19 tumor cells were counted. The number of T cells and RPMI-CD19 tumor cells required was calculated. The CFSE staining solution was prepared, and 2-fold of the 3 groups of T cells were taken for cell staining. After staining, centrifuge at 300g for 5 min to remove the cell staining solution, and inoculate the T cells into a 96-well plate for co-culture with the tumor cells. Another group without co-incubation with the tumor cells was added, and 100 μL of AIM-V complete medium was added to each well. The remaining stained T cells were subjected to flow cytometry. Centrifuge at 300g for 5 min to remove the supernatant, and after filtering through a cell sieve, they can be used for flow cytometry analysis. The CFSE fluorescence signal can be detected in the FITC channel. After co-incubation for 48 h, the co-incubated cells were taken out, centrifuged at 300g for 5 min, resuspended with 49 μL of flow cytometry staining buffer, stained with 1 μL of APC anti-CD3 antibody, and stained in the dark at 4°C for 60 min. After staining, centrifuge to remove the supernatant, resuspend and wash with PBS, centrifuge to remove the supernatant, resuspend with 200 μL of flow cytometry staining buffer, and after filtering through a cell sieve, they can be used for flow cytometry analysis. The stained CD3 antibody signal can be detected in the APC channel, and the CFSE fluorescence signal can be detected in the FITC channel. The flow cytometry data was analyzed using FlowJo software.

[0123] 7. Experimental results

[0124] 7.1. Detection of the killing efficiency of Syn-CAR188-T cells against tumor cells by the luciferase method

[0125] In this experiment, Syn-CAR188-T (experimental group) and CAR21-T cells (positive control group) need to be prepared. After co-incubating Syn-CAR188-T cells with tumor cells for 8 h to 15 h, a luciferase detection reagent is added for lysis reaction, and then detected using the chemiluminescence mode of a multifunctional microplate reader. There are 6 types of target cells, namely K562-CD19-CD38, K562-CD38, RPMI-CD19, RPMI, Raji-Lu, and K562-CD19-hBCMA. There are 5 effector-to-target ratios, which are 2:1, 1:1, 1:2, 1:4, and 1:8 respectively. In some co-incubation groups, there are only 4 effector-to-target ratios. The experiment is divided into 3 groups, namely the PAN-T group, the Syn-CAR188-T group, and the CAR21-T group. Among them, in the PAN-T group, untransduced T cells are co-incubated with tumor cells (negative control group), in the Syn-CAR188-T group, T cells transduced with the viral vector A188-H3 are co-incubated with tumor cells (experimental group), and in the CAR21-T group, T cells transduced with the viral vector CD38-CAR (CAR21) are co-incubated with tumor cells (positive control group). Analyze the results detected by the microplate reader, calculate the killing efficiency of effector cells according to the formula, and perform statistical analysis using Graphpad Prim 9.5 software. The experimental results are as follows Figure 7 as shown

[0126] Figure 7 A shows the results of detecting the killing efficiency after co-incubating 3 groups of T cells with K562-CD19-CD38 tumor cells for 12 h at 5 effector-to-target ratios. K562-CD19-CD38 tumor cells express CD19 and CD38 antigens and belong to double-positive tumor cells. Theoretically, both the experimental group T cells and the positive control group T cells co-incubated with double-positive tumor cells have the function of specifically killing tumors Figure 7 The experimental results in A show that at different effector-to-target ratios, the Syn-CAR188-T group has a higher killing efficiency against K562-CD19-CD38 tumor cells, and is significantly higher than the negative control PAN-T group, showing a statistical difference. Compared with the positive control CAR21-T group, it has a strong killing effect on K562-CD19-CD38 tumor cells, without obvious difference Figure 7 B shows the results of detecting the killing efficiency after co-incubating 3 groups of T cells with K562-CD38 tumor cells for 15 h. K562-CD38 tumor cells do not express CD19 antigen and express CD38 antigen, belonging to single-positive tumor cells. Therefore, theoretically, co-incubating the Syn-CAR188-T group with K562-CD38 tumor cells cannot induce the expression of anti-CD38-CAR and cannot initiate the specific killing function, while the positive control CAR21-T cells can specifically kill tumor cells expressing CD38 antigen Figure 7The results of Experiment B showed that the killing efficiency of CAR21-T cells in the positive control group against K562-CD38 tumor cells was significantly higher than that of the Syn-CAR188-T group and the PAN-T group. The killing efficiency of the Syn-CAR188-T group and the PAN-T group against K562-CD38 tumor cells was low, and there was no significant difference, which was consistent with the theoretical results. Figure 7 Figure F shows the killing efficiency test results after 3 groups of T cells were co-incubated with K562-CD19-BCMA tumor cells for 12 h. K562-CD19-BCMA tumor cells express CD19 antigen and do not express CD38 antigen. Theoretically, after Syn-CAR188-T cells are co-incubated with K562-CD19-BCMA tumor cells, anti-CD38-CAR can be induced to express, but the tumor cells do not express CD38 antigen, so the specific killing function cannot be initiated. Similarly, after CAR21-T cells are co-incubated with K562-CD19-BCMA tumor cells, the specific killing function cannot be initiated theoretically. Figure 7 The results of Experiment F showed that the killing efficiency of the 3 groups of T cells against K562-CD19-BCMA tumor cells was low, which was consistent with the theoretical results. Figure 7 Figure C shows the killing efficiency test results after 3 groups of T cells were co-incubated with RPMI-CD19 tumor cells for 12 h. RPMI-CD19 tumor cells express CD19 antigen and CD38 antigen and belong to double-positive tumor cells. Figure 7 Experiment C

[0127] The results showed that at 4 different effector-to-target ratios, the killing efficiency of the Syn-CAR188-T group and the CAR21-T group against RPMI-CD19 tumor cells was significantly higher than that of the negative control group. When the effector-to-target ratio was 2:1, the killing efficiency of the Syn-CAR188-T group and the CAR21-T group was greater than 90%. Figure 7 Figure D shows the killing efficiency test results after 3 groups of T cells were co-incubated with RPMI tumor cells for 8 h. RPMI tumor cells do not express CD19 antigen and express CD38 antigen and belong to single-positive tumor cells. Theoretically, Syn-CAR188-T cells have no specific killing function against RPMI cells, and CAR21-T cells can specifically kill RPMI cells. Figure 7 The results of Experiment D showed that at 4 different effector-to-target ratios, the killing efficiency of CAR21-T cells against RPMI tumor cells was significantly higher than that of the Syn-CAR188-T group and the PAN-T group. Figure 7 Figure E shows the killing efficiency test results after 3 groups of T cells were co-incubated with Raji-Lu tumor cells for 12 h. Raji-Lu tumor cells express CD19 antigen and CD38 antigen and belong to double-positive tumor cells. Figure 7The experimental results showed that at two different effector-to-target ratios, Syn-CAR188-T cells and CAR21-T cells had a relatively high killing efficiency against Raji-Lu tumor cells, and both were significantly higher than those of the negative control group, PAN-T group, showing statistical differences.

[0128] In summary, Syn-CAR188-T cells have specific killing functions against double-positive tumor cells (expressing both CD19 and CD38 antigens) and no specific killing effects on single-positive tumor cells (expressing only CD19 or CD38 antigen), proving that Syn-CAR188-T cells can efficiently and specifically kill tumor cells and have a safety switch for initiating the killing function.

[0129] 7.2. Detection of the persistent killing effect of Syn-CAR188-T cells on tumor cells by Incucyte

[0130] The successfully prepared Syn-CAR188-T cells were co-incubated with tumor cells RPMI-CD19 and Raji-Lu, and the Incucyte real-time live cell imaging system was used to detect the persistent killing effect of T cells. The experiment was divided into three groups: PAN-T group, Syn-CAR188-T group, and CAR21-T group. The experimental results are as follows Figure 8 shown. The abscissa represents the co-incubation time, and the ordinate represents the average fluorescence intensity of tumor cells. The lower the ordinate value at a certain time, the stronger the killing effect of T cells at that moment. Figure 8 A shows the killing detection results of the three groups of T cells co-incubated with RPMI-CD19 tumor cells for 72 h, with an effector-to-target ratio of 1:2. The experimental results showed that during the 72-h co-incubation monitoring, the killing of RPMI-CD19 tumor cells by Syn-CAR188-T cells was always higher than that of the PAN-T group, and the positive control group, CAR21-T cells, had the strongest killing effect on RPMI-CD19 tumor cells. Figure 8 B shows the killing detection results of the three groups of T cells co-incubated with Raji-Lu tumor cells for 72 h, with an effector-to-target ratio of 1:1. The experimental results showed that during the 72-h co-incubation monitoring, the killing of Raji-Lu tumor cells by Syn-CAR188-T cells was always higher than that of the PAN-T group, and the positive control group, CAR21-T cells, had the strongest killing effect on Raji-Lu tumor cells. The experimental results of Incucyte detection showed that Syn-CAR188-T cells had a persistent killing effect on both RPMI-CD19 tumor cells and Raji-Lu tumor cells.

[0131] 7.3. Detection of cytokines secreted by Syn-CAR188-T cells when anti-tumor cells by CBA

[0132] Quantitatively detect the cytokine content in the culture supernatant of Syn-CAR188-T cells by CBA method, so as to analyze the anti-tumor cell ability of Syn-CAR188-T cells. During the experiment, T cells were co-incubated with tumor cells RPMI-CD19 for 12 h, and then the supernatant was collected for detection, with the effector-to-target ratio of 2:1. The experiment was divided into 3 groups: PAN-T group, Syn-CAR188-T group, and CAR21-T group. The levels of cytokines IL-2, interferon IFN-γ, tumor necrosis factor TNF-α, cytokine IL-4, cytokine IL-10, and granzyme Granzyme B secreted by the Syn-CAR188-T group and the CAR21-T group were significantly higher than those of the PAN-T group, with statistical differences. Among them, IFN-γ, TNF-α, and Granzyme B have powerful anti-tumor functions. The experimental results further show that Syn-CAR188-T cells have powerful anti-tumor functions, and the induction recognition and re-killing mode can play an effective anti-tumor function.

[0133] 7.4. Detection of CD69 on the surface of Syn-CAR188-T cells

[0134] CD69 is a signal protein for early activation of T cells. By detecting the expression efficiency of CD69 on the surface of T cells, the activation differences of Syn-CAR188-T cells after co-incubation with different tumor cells can be compared. The experiment was divided into 3 groups: PAN-T group, Syn-CAR188-T group, and CAR21-T group. After the 3 groups of T cells were co-incubated with RPMI-CD19 and RPMI cells for 12 h, the CD69 expression results were detected by flow cytometry as follows Figure 9 shown. Figure 9 The results of A, 9B, and 9C are that when the negative control group of PAN-T cells was not incubated and co-incubated with RPMI-CD19 and RPMI, the CD69 expression efficiencies were 16.3%, 26.4%, and 34.1% respectively. Figure 9 The results of D, 9E, and 9F are that when the positive control group of CAR21-T cells was not incubated and co-incubated with RPMI-CD19 and RPMI, the expression efficiencies were 29.0%, 90.1%, and 79.4% respectively. Figure 9The results of G, 9H, and 9I are as follows: When the experimental group of Syn-CAR188-T cells were not incubated, and when co-incubated with RPMI-CD19 and RPMI respectively, the expression efficiencies were 29.0%, 83.9%, and 46.0% respectively. The experimental results showed that the CD69 expression efficiencies of PAN-T cells were relatively low when not incubated and when incubated with tumor cells (16.3%, 26.4%, 34.1%), demonstrating that tumor cells had a relatively low impact on stimulating PAN-T cells and a low activation efficiency. The CD69 expression efficiency of the positive control group of CAR21-T cells was the highest after incubation with two types of tumor cells (positive for CD38 antigen) (90.1%, 79.4%), proving that CAR21-T cells had the greatest impact and the highest activation efficiency after being stimulated by CD38 antigen-positive tumor cells. The CD69 expression efficiency (83.9%) of the experimental group of Syn-CAR188-T cells after co-incubation with CD19-positive tumors (RPMI-CD19) was similar to that of the positive control group of CAR21-T (90.1%), 54.9% higher than when not incubated (29.0%). After co-incubation with tumors negative for CD19 antigen (RPMI), the CD69 efficiency expression was relatively low (46.0%), similar to that of the PAN-T group (34.1%), proving that the activation of Syn-CAR188-T cells was regulated by the SynNotch system and could only be activated when co-incubated with CD19- and CD38-double positive tumor cells, which was consistent with the theoretical results. In summary, Syn-CAR188-T cells could be highly efficiently activated after co-incubation with CD19- and CD38-double positive tumor cells, had a low activation efficiency after co-incubation with CD19-negative tumor cells, and was similar to the blank group, and the results were consistent with the regulation theory of the SynNotch system.

[0135] 7.5. Detection of the proliferation ability of Syn-CAR188-T cells by CFSE

[0136] The proliferation ability of T cells was detected by the CFSE method in this experiment, which was divided into three groups: the PAN-T group, the Syn-CAR188-T group, and the CAR21-T group. After CFSE staining of the three groups of T cells, they were divided into two groups: the non-incubated group and the group co-incubated with tumor cells. After culturing for 48 h, the CFSE expression efficiency was detected by flow cytometry. After CFSE staining, the cell proliferation efficiency of the three groups of T cells was high after culturing for 48 h without incubation, and there was no significant difference among the three groups of T cells, proving that the proliferation of Syn-CAR188-T cells was not affected after transduction with the viral vector; after incubation with RPMI-CD19 cells for 48 h, the proliferation efficiencies of Syn-CAR188-T and CAR21-T cells were higher than those of PAN-T cells, proving that the cell proliferation rate of Syn-CAR188-T was higher than that of PAN-T cells under the stimulation of tumor cells.

[0137] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A method for preparing PSR.Syn.CD19.CD38 CAR-T cells, characterized in that: The PSR.Syn.CD19.CD38CAR-T cells refer to CAR-T cells that will induce expression of effector molecules anti-CD38-CAR after co-incubation with CD19 antigen-positive tumor cells. When tumor cells express both CD19 and CD38 antigens, they will recognize tumor-killing CAR-T cells. The method comprises: Step 1: Use the PiggyBac transposon system to construct a stable transfection SIN-γ-RV vector, namely the PSR vector; Step 2: Use the PSR vector prepared in step 1 to express the SynNotch system, merge the GAL4 induction vector and the UAS effector vector of the SynNotch system into one PSR vector, so that the SynNotch system is delivered by one PSR vector; construct a plasmid of a PSR.Syn.CD19.CD38 CAR-T retroviral vector, i.e., a PSR.SynNotch vector targeting CD19 and CD38, with CD19 as an induction target and CD38 as a plasmid vector of an effector target; Step 3: transduce the plasmid of the above retroviral vector into T cells to prepare the PSR.Syn.CD19.CD38CAR-T cells; In step 1, the 5'LTR, 5'UTR, and 3'SIN-LTR sequences of the SIN-γ-RV vector are sequentially inserted between the 5'ITR and 3'ITR sequences of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes a Ψ element for a viral vector packaging signal and a SD for a splicing donor site, and the U3 region is deleted in the 3'SIN-LTR sequence, leaving only the R region and the U5 region; When constructing the PSR.Syn.CD19.CD38 plasmid, the effector receptor UAS anti-CD38-CAR, SFFV promoter, SP signal peptide, Myc tag, inducible receptor anti-CD19 scfv-Notch-Gal4VP64, and WPRE element were inserted between the 5'LTR and 3'SIN-LTR, respectively. The inducible receptor is expressed by the SFFV promoter, and the effector receptor is upstream of the SFFV promoter and the inducible receptor.

2. The method according to claim 1, characterized in that The 5'UTR deleted all Gag and Pol coding sequences and the start codon ATG.

3. The method according to claim 1, characterized in that When constructing the plasmid of the PSR.Syn.CD19.CD38 retroviral vector, two molecular tags CopGFPP2A Puro for screening monoclonal cells were inserted between the 3'SIN-LTR and 3'TIR transposon, that is, CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells, connected by P2A.

4. The method according to claim 3, characterized in that The molecular tag is expressed by the composite promoter hEF1α-HTLV.

5. PSR.Syn.CD19.CD38 CAR-T cells constructed according to any one of claims 1-4.

6. Use of the PSR.Syn.CD19.CD38 CAR-T cells described in claim 1 in the preparation of tumor drugs.

7. A pharmaceutical composition for treating tumors, characterized in that: The pharmaceutical composition contains the CAR-T cells according to claim 5, and a pharmaceutically acceptable carrier, diluent or excipient.

8. A method for inhibiting tumor cells in vitro, characterized in that: The method comprises contacting a tumor cell with the CAR-T cell according to claim 5 or the pharmaceutical composition according to claim 7, thereby inhibiting the tumor cell.

Images