A nanocarrier for gene editing of aquatic animals and a gene editing method

By using TNP nanoparticles to encapsulate Cas9 mRNA and sgRNA, the problems of low efficiency and low survival rates in gene editing in aquatic animals are solved, and efficient and safe gene editing is achieved, which is suitable for rapid improvement of a variety of aquatic animals.

CN119286942BActive Publication Date: 2025-07-04SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411826906.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-12
Publication Date
2025-07-04
Estimated Expiration
2044-12-12

AI Technical Summary

Technical Problem

Existing gene editing technologies have problems such as low efficiency, low embryo survival and complex operation in aquatic animals, especially in large-scale commercial breeding, which is difficult to meet the needs of rapid improvement.

Method used

The TNP nanoparticles with good biocompatible properties are used as carriers to encapsulate Cas9 mRNA and sgRNA and delivered to aquatic animal embryos through non-invasive methods, optimizing the size, surface charge and chemical properties of the nanoparticles to improve transfection efficiency and specificity.

Benefits of technology

It significantly improves the efficiency and accuracy of gene editing, enhances embryo survival rate, simplifies the operation process, is suitable for a variety of aquatic animals, supports customized gene editing, and adapts to the needs of rapid improvement in the commercial environment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119286942B_ABST
    Figure CN119286942B_ABST
Patent Text Reader

Abstract

The present invention discloses a nano-vector for gene editing of aquatic animals, comprising a) TNP nanoparticles and b) Cas9 mRNA and sgRNA. The application of the TNP nanoparticles as an mRNA delivery vector is also disclosed, as well as a gene editing method based on the nano-vector. This method encapsulates Cas9 mRNA and sgRNA using biocompatible TNP nanoparticles, achieving an efficient and low-damage gene editing delivery method. The nano-vector is delivered non-invasively into the embryos of aquatic animals, optimizing transfection efficiency and gene editing specificity. In addition, this method can improve gene editing efficiency and precision, enhance embryo survival rate, and is simple, safe, and widely applicable to operation. It can also support customized gene editing, contributing to promoting the application of gene editing in the genetic improvement of aquatic germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a nano - carrier for gene editing of aquatic animals and a gene editing method. Background Art

[0002] With the rapid development of the global aquaculture industry, the demand for genetic improvement of key traits such as disease resistance, growth rate, and meat quality improvement is continuously increasing. Currently, traditional breeding methods such as selective breeding can no longer fully meet the industry's demand for rapid and precise improvement. Especially when facing new disease threats and environmental adaptability challenges, the market demand for high - quality aquatic products has promoted the exploration of more advanced gene editing technologies. However, traditional gene editing technologies, especially physical delivery methods such as microinjection, although achieving the purpose of gene editing to a certain extent, have been significantly limited in their application due to their high technical complexity, strict operation requirements, large damage to embryos, and low survival rate. The high dependence and low adaptability of microinjection technology, especially in commercial aquaculture scenarios where a large number of samples need to be processed, have become the main obstacles to its popularization.

[0003] Facing these challenges, the development of a new gene delivery technology that is both efficient and low - damage has become an urgent task. The introduction of Lipid Nanoparticles (LNP) technology provides a feasible solution to solve this problem. LNP technology encapsulates gene editing tools such as Cas9 protein and single - guide RNA (sgRNA) in nanoscale lipid particles, protecting the RNA from degradation by in - vivo enzymes and effectively delivering it into the target cells. Compared with microinjection technology, the LNP delivery system is non - invasive, greatly reducing the damage to embryos caused by physical puncture, thus improving the safety of the operation and the survival rate of embryos.

[0004] In addition, the high delivery efficiency and excellent cell - penetrating properties of the LNP delivery system make it highly specific and efficient in gene editing. By precisely controlling the size, surface charge, and lipid composition of LNP particles, its delivery performance can be further optimized, enhancing its targeting in specific cell types. Another significant advantage of LNP technology lies in its scalability. It is suitable for large - scale production and application, capable of meeting the demand for rapid and large - scale gene editing in commercial aquaculture. This feature makes the LNP delivery system particularly suitable for popularization in the aquaculture industry, helping to rapidly improve the production traits of aquatic animals, such as enhancing disease resistance, improving growth rate, and meat quality, without sacrificing genetic diversity.

[0005] Current gene editing technologies, including LNP and Cas9 tools, although showing high gene editing efficiency in cells and some animal models, face certain limitations when applied to aquatic animals. First, traditional physical delivery methods (such as microinjection) are complex and require high technical skills, especially when dealing with a large number of aquatic animal embryos, with low efficiency. In addition, such physical delivery methods are prone to cause mechanical damage to embryos, resulting in a decrease in survival rate and increasing the risk of experimental failure. Second, although LNP technology can improve delivery efficiency, it has not been fully optimized in aquatic animals, especially in the application of different aquatic species. It may be necessary to adjust the particle size, surface modification, etc. of the particles to ensure accurate and efficient delivery.

[0006] Therefore, although directly using LNP and Cas9 has improved the gene editing efficiency to a certain extent, in the aquaculture environment, the existing delivery systems cannot completely solve the problems of low efficiency and embryo survival rate.

[0007] The improvement of the present invention aims to optimize the design and delivery path of the nanocarrier according to the special biological environment and application requirements of aquatic animals, ensuring that the gene editing tool can reach the target cells more efficiently and reducing damage to embryos. In addition, the present invention also focuses on solving the practical operation problems in large-scale applications, providing a gene editing solution that is easier to operate, highly adaptable and feasible in a commercial environment. This can not only improve the editing efficiency but also significantly increase the survival rate of embryos, meeting the needs of rapid improvement in aquaculture. Summary of the Invention

[0008] The object of the present invention is to provide a nanocarrier for gene editing of aquatic animals.

[0009] The present invention also aims to provide a method for gene editing of Cas9 in aquatic animals based on the above nanocarrier.

[0010] The above first object of the present invention can be achieved by the following technical solution: A nanocarrier for gene editing of aquatic animals, comprising a) TNP nanoparticles and b) Cas9 mRNA and sgRNA.

[0011] Preferably, the TNP nanoparticles in a) are prepared by the following method:

[0012] (1)Put maleimide-functionalized poly(ethylene glycol) Mal-PEG-OH, D, L-lactide D, L-LA and glycolide GA into a reaction vessel, add a magnetic stir bar and heat to 130~150 °C in an oil bath. Stir continuously until all the solids in the reaction vessel are dissolved. Subsequently, under stirring conditions, add stannous octoate Sn(Oct)2 dropwise and continue stirring for 2~5 h. After the reaction is completed, concentrate the product and precipitate it in a methanol-ether mixture. Filter by suction and dry to obtain light yellow Mal-PEG- b -PLGA;

[0013] (2)Take Mal-PEG- b -PLGA and add it to a round-bottomed container. Then add a magnetic stir bar and dimethyl sulfoxide DMSO to dissolve Mal-PEG- b -PLGA. Then, under stirring conditions, add ultrapure water and continue stirring to prepare Mal-NP nanoparticles;

[0014] (3)Dialyze the Mal-NP nanoparticles in ultrapure water overnight to remove dimethyl sulfoxide DMSO. Collect the nanoparticle solution in the dialysis bag and transfer it to a round-bottomed container. Add the cell-penetrating peptide TAT and stir under nitrogen protection. After the reaction is completed, collect the particle solution and centrifuge. Collect the precipitate of the lower layer of particles and lyophilize to obtain the TAT-modified TAT-Mal-NP material, abbreviated as TNP nanoparticles.

[0015] Preferably, in step (1), the molar ratio of maleimide-functionalized poly(ethylene glycol) Mal-PEG-OH, D, L-lactide D, L-LA to glycolide GA is 0.2:10.8~11.5:5.0~5.2.

[0016] More preferably, in step (1), the molar ratio of maleimide-functionalized poly(ethylene glycol) Mal-PEG-OH, D, L-lactide D, L-LA to glycolide GA is 0.2:11.111:5.173.

[0017] More preferably, in step (1), add a magnetic stir bar and heat to 130 °C in an oil bath.

[0018] More preferably, in step (1), after adding stannous octoate Sn(Oct)2 dropwise under stirring conditions, continue stirring for 3 h.

[0019] Preferably, in step (1), the volume ratio of methanol to ether in the methanol-ether mixture is 1:9~11.

[0020] More preferably, in step (1), the volume ratio of methanol to ether in the methanol-ether mixture is 1:10.

[0021] Preferably, in step (2), the Mal-PEG- b- The dosage relationship between PLGA and the dimethyl sulfoxide (DMSO) is 145 - 155 mg: 15 - 25 mL.

[0022] More preferably, in step (2), the Mal-PEG- b - The dosage relationship between PLGA and the dimethyl sulfoxide (DMSO) is 150 mg: 20 mL.

[0023] Preferably, in step (2), 80 - 120 mL of ultrapure water is slowly added under stirring conditions and continuously stirred for 1.5 - 2.5 h to prepare Mal-NP nanoparticles.

[0024] More preferably, in step (2), 100 mL of ultrapure water is slowly added under stirring conditions and continuously stirred for 2 h to prepare Mal-NP nanoparticles.

[0025] Preferably, in step (3), the mass ratio of the Mal-NP nanoparticles to the cell-penetrating peptide TAT is 14 - 16: 1.5 - 2.5.

[0026] More preferably, in step (3), the mass ratio of the Mal-NP nanoparticles to the cell-penetrating peptide TAT is 15: 2.

[0027] The cell-penetrating peptide TAT is a kind of targeting ligand, which can enhance the affinity between the nanocarrier and the aquatic animal embryo cells by using the targeting ligand, and improve the accuracy of gene editing and the flexibility of operation through specific concentration control. It has a high affinity with the surface of the aquatic animal embryo cell membrane and can fuse with or embed into the aquatic animal embryo cell membrane to enhance the interaction between the nanocarrier and the aquatic animal embryo cells.

[0028] Preferably, in step (3), the average particle size range of the TNP nanoparticles is 50 - 200 nanometers.

[0029] The core of the present invention is to use specially designed TNP nanoparticles, which have good biocompatibility and low immunogenicity, and can effectively reduce the physical and chemical damage to the embryo. By precisely controlling the size, surface charge and chemical properties of the nanoparticles, the affinity with the embryo membrane is optimized, thereby improving the transfection efficiency and specificity.

[0030] The present invention also provides the application of the above TNP nanoparticles as an mRNA delivery vector.

[0031] When applying, the TNP material can be first dissolved in chloroform, and then a chloroform solution of (2,3-dioleoyl-propyl)-trimethylamine DOTAP and an ultrapure aqueous solution of mRNA are added to obtain a mixed material solution. The mixed material solution is ultrasonically treated for the first time in an ice bath. After the ultrasonic treatment is completed, DEPC water is added and mixed evenly. Subsequently, the centrifuge tube is placed in an ice bath for a second ultrasonic treatment. After the ultrasonic treatment is completed, the obtained particle solution is the TNP nanoparticles encapsulating the mRNA substance, wherein the TNP nanoparticles are high-molecular nanocarriers for delivering gene substances such as mRNA.

[0032] The nanocarrier for gene editing of aquatic animals provided by the present invention can solve the problems of low efficiency and low embryo survival rate existing in the current gene editing technology for aquatic animals. By using the biocompatible TNP nanocarrier, it can effectively encapsulate Cas9 mRNA and sgRNA and deliver them to the embryos of aquatic animals (such as zebrafish, tiger prawns, etc.) in a non-invasive manner.

[0033] Preferably, the preparation method of the nanocarrier for gene editing of aquatic animals of the present invention includes the following steps: mixing an ultrapure aqueous solution of Cas9mRNA and sgRNA with TNP and DOTAP, and preparing the nanocarrier for gene editing of aquatic animals through two ultrasonic processes.

[0034] The second object of the present invention can be achieved by the following technical solution: A method for Cas9 gene editing of aquatic animals based on the above nanocarrier, including the following steps:

[0035] 1) Prepare TNP nanoparticles containing Cas9 mRNA and sgRNA;

[0036] 2) Deliver the nanoparticles to the embryos of the target aquatic animal;

[0037] 3) Edit the target gene in the embryo.

[0038] Preferably, the Cas9 mRNA and sgRNA in step 1) are encapsulated in the TNP nanoparticles by physical adsorption, chemical binding or biocompatible embedding technology.

[0039] As a preferred embodiment of the present invention, the preparation of TNP nanoparticles containing Cas9 mRNA and sgRNA in step 1) includes the following steps: First, dissolve the TNP nanoparticles in chloroform, then add a chloroform solution of (2,3-dioleoyl-propyl)-trimethylammonium DOTAP and an ultrapure aqueous solution of Cas9 mRNA and sgRNA to obtain a mixed material solution. Subject the obtained mixed material solution to the first ultrasound in an ice bath. After the ultrasound ends, add ultrapure water and mix well, then perform the second ultrasound in an ice bath, and then perform concentration treatment to obtain TNP nanoparticles containing Cas9 mRNA and sgRNA.

[0040] Preferably, during the first ultrasound, it is set to ultrasound for 5 s, stop for 2 s, the ultrasound time is 1 min, and the power is 80 W.

[0041] Preferably, during the second ultrasound, it is set to ultrasound for 10 s, stop for 2 s, the ultrasound time is 1 min, and the power is 80 W.

[0042] The delivery system of the present invention can further improve the accuracy of gene editing and the flexibility of operation by adjusting the concentration of the nanocarrier.

[0043] Preferably, in step 2), the method of delivering the nanoparticles into the embryos of the target aquatic animals is soaking, injection or electroporation.

[0044] Preferably, the target aquatic animals in step 2) are zebrafish or tiger prawns.

[0045] Preferably, the editing of the target gene in step 3) aims to improve the disease resistance, growth rate or meat quality of aquatic animals.

[0046] Preferably, it further includes step 4) to verify the effect of the gene editing. Verifying the effect of the gene editing includes using PCR or sequencing.

[0047] Therefore, the present invention selects specific Cas9 mRNA and sgRNA for different species of aquatic animals, and customizes the nanocarrier for each specific editing target (such as disease resistance, growth rate or pigmentation). It also provides a rapid screening method for evaluating the editing effect, allowing rapid identification and optimization of successful gene editing events at the initial stage.

[0048] The present invention has the following advantages:

[0049] (1) Improve gene editing efficiency and accuracy: By using a specially designed nanocarrier, the method of the present invention significantly improves the delivery efficiency of the CRISPR / Cas9 system and the targeting of gene editing. This method can reduce discrete gene editing events, thereby improving the overall success rate and accuracy of gene editing;

[0050] (2) Enhanced embryo survival rate: Compared with traditional microinjection techniques, the TNP nanocarrier provides a gentler gene delivery method, significantly reducing the risk of embryo damage and thus improving the overall survival rate of embryos.

[0051] (3) Ease and safety of operation: The present invention simplifies the gene editing operation process and reduces the dependence on highly skilled operators. At the same time, due to the biocompatibility and low immunogenicity of the nanocarrier, potential biosafety risks are reduced.

[0052] (4) Wide applicability: This method can be widely applied to various aquatic animals, including small or sensitive species that are difficult to operate with traditional microinjection methods.

[0053] (5) Support for customized gene editing: By adjusting the properties of the nanocarrier, it can be tailored for specific gene editing targets and different aquatic animal species, providing a highly flexible gene editing solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] The present invention will be further described below with reference to the drawings in conjunction with the embodiments.

[0055] Figure 1 In [the figure], A is the synthetic route diagram of the Mal-PEG-b-PLGA polymer material in Example 1; B is the gel permeation chromatogram of the Mal-PEG-b-PLGA polymer material and the Mal-PEG-OH raw material in Example 1; C is the nuclear magnetic resonance hydrogen spectrum of the Mal-PEG-b-PLGA polymer material in Example 1.

[0056] Figure 2 In [the figure], A is the schematic diagram of the process for preparing TNP nanoparticles encapsulating mRNA by the double emulsion method in Example 1; B is the particle size diagram of the TNP nanoparticles detected by dynamic light scattering in Example 1; C is the encapsulation efficiency diagram of the TNP for mRNA detected by the RiboGreen kit in Example 1; D is the particle size diagram of the TNP nanoparticles in seawater for 24 h in Example 1; E is the dispersion monitoring diagram in Example 1; F is the agarose gel detection diagram of the encapsulation efficiency of plasmid systems by TNP nanocarriers with different mass ratios in Example 1.

[0057] Figure 3 It is the co-incubation of zebrafish eggs and rhodamine red particles encapsulated by the TNP nanocarrier in Example 2, and the red fluorescence of the zebrafish eggs is observed after 8 h, 24 h, and 48 h of incubation to test the fusion effect of the TNP nanoparticles and the zebrafish egg membrane.

[0058] Figure 4In Example 2, zebrafish eggs were co-incubated with EGFP-mRNA encapsulated in TNP nanoparticles. After 8 hours and 48 hours of incubation, the green fluorescence of the zebrafish eggs was observed to test the expression effect of EGFP-mRNA delivered by TNP nanoparticles in zebrafish eggs.

[0059] Figure 5 In Example 3, zebrafish eggs were co-incubated with Cas9mRNA and Tyr-sgRNA encapsulated in TNP nanoparticles. After 72 hours of incubation, genomic DNA was extracted for NGS second-generation sequencing, and the sequencing mutation results were presented. Detailed implementation manners

[0060] The present invention will be further described below in conjunction with specific embodiments. The following embodiments and drawings are only for illustrative purposes and should not be construed as limiting the present invention. Unless otherwise specified, the reagent raw materials used in the following embodiments are conventional commercially available or commercially obtained biological reagent raw materials. Unless otherwise specified, the methods and equipment used in the following embodiments are the methods and equipment commonly used in the art.

[0061] The following embodiments are further descriptions of the present invention rather than limitations on the present invention.

[0062] Example 1

[0063] The present invention will be further described below in conjunction with specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0064] Example 1 Preparation of Nanoparticles and Encapsulation

[0065] 1. Synthesis of Polymer Materials

[0066] First, synthesize maleimide-functionalized poly(ethylene glycol)-poly(lactide-co-glycolide) (Mal-PEG 5k - b -PLGA 10k ).

[0067] The specific synthesis steps are as follows: Transfer maleimide-functionalized poly(ethylene glycol) (Mal-PEG 5k (5k refers to the molecular weight of PEG)-OH) and lactide (D, L-LA) and glycolide (GA) that have been dehydrated by azeotropic distillation with toluene and freeze-dried overnight to a glove box (H2O < 0.1 ppm, O2 < 0.1 ppm). Weigh Mal-PEG 5k-OH (1 g, 0.2 mmol), D, L-LA (1.6 g, 11.111 mmol), and GA (0.6 g, 5.173 mmol) were added into a pre-baked 50 mL round-bottom flask to remove water vapor. A magnetic stir bar was added and the mixture was heated to 130 °C in an oil bath and continuously stirred until all the solids in the flask were dissolved. Subsequently, 2 drops (20 mg, 0.049 mmol) of stannous octoate (Sn(Oct)2) were added dropwise under stirring and the reaction was continued for 3 h. After the reaction, the concentrated product was precipitated in a methanol / ether mixture (1 / 10, v / v), filtered by suction and dried to obtain pale yellow Mal-PEG 5k - b -PLGA 10k (10k refers to the molecular weight of Mal-PEG 5k - b -PLGA). The product was collected, weighed and its chemical structure was determined by 1 1H NMR

[0068] Furthermore, 150 mg of Mal-PEG 5k - b -PLGA 10k was added into a 250 mL round-bottom flask, a magnetic stir bar was added, 10 mL of dimethyl sulfoxide (DMSO) was added to dissolve the above polymer material, and 100 mL of ultrapure water was slowly added under stirring and continuously stirred for 2 h to prepare Mal-NP nanoparticles respectively.

[0069] Mal-NP was dialyzed overnight in ultrapure water to remove DMSO. The nanoparticle solution in the dialysis bag was collected and transferred to a round-bottom flask. TAT (transmembrane peptide, 20 mg, 0.016 mmol) was weighed and added into the round-bottom flask and the reaction was stirred for 12 h under nitrogen protection. TAT was modified on the surface of Mal-NP through a click chemical reaction between the thiol group in the cysteine residue at the end of TAT and maleimide. After the reaction, the particle solution was collected and centrifuged at 30000 g for 2 h to collect the lower layer of particle precipitate. After freeze-drying, the TAT-modified TAT-PEG- b -PLGA material (abbreviated as TNP) was obtained.

[0070] Collect the supernatant after high-speed centrifugation. Use the Ellman's kit (pH 8.0, 70 μg / mL, in 100 mM PB buffer containing 1 mM ethylenediaminetetraacetic acid (EDTA)) to react DTNB with the free thiol groups at the TAT termini that have not reacted in the supernatant for 15 min. Then, measure the absorbance of the reaction solution at 412 nm to calculate the bonding efficiency between TAT and the Mal group.

[0071] In this example, the synthesis route of the Mal-PEG-b-PLGA (TNP) polymer material is as Figure 1 shown in A of Figure 1 . The gel permeation chromatograms of the Mal-PEG-b-PLGA polymer material and the Mal-PEG-OH raw material are as b shown in B of b . The peak elution time of Mal-PEG- b -PLGA is earlier than that of the raw material Mal-PEG-OH, indicating the successful synthesis of the Mal-PEG- Figure 1 -PLGA block polymer material. Further, according to the nuclear magnetic resonance hydrogen spectrum of the Mal-PEG- b -PLGA polymer material shown in C of

[0072] 2. Prepare rhodamine B (RhoB)-labeled TNP nanoparticles:

[0073] Weigh 25 mg of TAT-PEG- b-PLGA (TNP) and 1 mg of rhodamine B-labeled PLGA (PLGA refers to poly(lactide-co-glycolide) homopolymer, the same below) (RhoB-PLGA) were co-dissolved in 400 μL of chloroform, and (2,3-dioleoyl-propyl)-trimethylammonium (DOTAP, 2 mg, 100 μL, chloroform) was added thereto; a 50 mL centrifuge tube was taken and added with DEPC water (400 μL, ultrapure water); then the above mixed material solution was added to the bottom of the centrifuge tube. The centrifuge tube was placed in an ice bath for the first sonication, and the sonication probe was immersed in the liquid surface. It was set to sonicate for 5 s, stop for 2 s, with a sonication time of 1 min and a power of 80 W; after sonication, 5 mL of DEPC water was added and mixed well; then the centrifuge tube was placed in an ice bath for the second sonication, which was set to sonicate for 10 s, stop for 2 s, with a sonication time of 1 min and a power of 80 W; after sonication, the liquid was transferred to a round-bottom flask, connected to a rotary evaporator, the air inlet was closed, and the vacuum pump was turned on and rotated at a low speed. After the bubbles were pumped out and the solution became clear, the round-bottom flask was immersed in a water bath, and the particle solution was concentrated to 1 - 2 mL.

[0074] 3. Preparation of TNP nanocarriers encapsulating genetic materials:

[0075] Weigh 25 mg of TAT-PEG- b-PLGA (TNP) and rhodamine B-labeled PLGA were dissolved in 400 μL of chloroform, and (2,3-dioleoyl-propyl)-trimethylamine (DOTAP, 2 mg, 100 μL, chloroform) was added thereto; a 50 mL centrifuge tube was taken and added with DEPC water (400 µL), and then EGFP-mRNA (50 µg) was added (this gene is derived from the jellyfish Aequorea victoria, which is an optimized green fluorescent protein. EGFP is often used to study gene expression efficiency and cell function because it can emit obvious green fluorescence in living organisms and can be directly observed in living cells without adding exogenous substances. This makes EGFP one of the most commonly used reporter genes in cell biology and genetic engineering.); then the above mixed material solution was added to the bottom of the centrifuge tube. The centrifuge tube was placed in an ice bath for the first ultrasound, and the ultrasound probe was immersed in the liquid surface. It was set to ultrasound for 5 s, stop for 2 s, the ultrasound time was 1 min, and the power was 80 W; after the ultrasound was completed, 5 ml of DEPC water was added and mixed evenly; then the centrifuge tube was placed in an ice bath for the second ultrasound, which was set to ultrasound for 10 s, stop for 2 s, the ultrasound time was 1 min, and the power was 80 W; after the ultrasound was completed, the liquid was transferred to a round-bottom flask, connected to a rotary evaporator, the air inlet was closed, and the air pump was turned on and rotated at a low speed. After the bubbles were pumped out and the solution became clear, the round-bottom flask was immersed in a water bath, and the particle solution was concentrated to 1-2 mL; finally, the RiboGreen kit was used to detect the encapsulation efficiency of mRNA, or agarose gel was used to detect the encapsulation efficiency of plasmid or siRNA. Further, the TNP nanoparticle solution encapsulating the gene material was transferred to an EP tube and stored at 4 °C for later use.

[0076] In this example, the schematic diagram of preparing TNP nanoparticles encapsulating gene material by double emulsion method is as Figure 2 shown in A of Figure 2 ; the particle size of TNP nanoparticles is as Figure 2 shown in B of Figure 2 ; the encapsulation efficiency of TNP for mRNA detected by the RiboGreen kit is as Figure 2 shown in C of

[0077] Figure 2 ; the monitoring of the particle size and dispersion of TNP nanoparticles in seawater for 24 h is as

[0078] shown in D and E of Figure 2 ; the encapsulation efficiency of TNP nanoparticle carriers with different mass ratios for plasmid systems detected by agarose gel is as Figure 2 shown in F of

[0077] Figure 2 The results in

[0078] show that TNP nanoparticle carriers can effectively encapsulate gene materials such as mRNA or plasmid, and have good particle stability in seawater, and have the potential for gene editing applications in aquatic species embryonic cells. Example 2 Delivery Expression Verification and Gene Editing Detailed Description

[0079] 1. Verification process of zebrafish egg membrane fusion

[0080] To verify the fusion effect of the TNP nanomaterial with the zebrafish embryo egg membrane in Example 1, the following steps can be taken:

[0081] Delivery of nanoparticles: Suspend the TNP nanoparticles labeled with RhoB-PLGA in Example 1 in a suitable medium, and then immerse the zebrafish embryos in the solution containing the nanoparticles.

[0082] Fluorescence microscopy observation: After 8 h, 24 h, and 48 h of immersion, observe the embryos using a fluorescence microscope. Check whether the nanoparticles have fused with the egg membrane and adhered to the embryo surface through the fluorescence signal of rhodamine particles.

[0083] Data analysis: Evaluate the efficiency of egg membrane fusion by comparing the fluorescence intensities of the embryos in the treatment group and the control group. High fluorescence intensity indicates good membrane fusion effect.

[0084] The results of co-incubating zebrafish eggs with rhodamine red particles encapsulated in TNP nanocarriers are as Figure 3 shown. Observe the red fluorescence of zebrafish eggs after incubating for 8 h, 24 h, and 48 h to test the fusion effect of TNP nanoparticles with the zebrafish egg membrane.

[0085] Figure 3 The experimental results in show that the nanoparticles encapsulated with rhodamine particles can effectively fuse with the zebrafish egg membrane, and this fusion is positively correlated with the concentration of the nanoparticles. As the concentration of the nanoparticles gradually increases, the red fluorescence intensity of the zebrafish egg membrane increases significantly, indicating that the higher the concentration of TNP nanoparticles, the better the fusion effect with the zebrafish egg membrane.

[0086] 2. Verification process of mRNA delivery

[0087] To verify the effect of the TNP nanomaterial in delivering EGFP-mRNA to zebrafish and Penaeus monodon embryos, the following steps can be taken:

[0088] Delivery and hatching: Suspend the nanoparticles encapsulated with EGFP-mRNA in enzyme-free water, with the suspension dilution concentrations of 0.5 μg / mL and 1 μg / mL of embedded mRNA, and then immerse the embryos in the solution for incubation.

[0089] Fluorescence microscopy observation: After 8 hours of hatching, observe the expression of green fluorescent protein in zebrafish embryos using a fluorescence microscope. The presence and intensity of the fluorescence can reflect the efficiency and expression level of mRNA delivery.

[0090] Expression analysis: The delivery effect and expression efficiency of EGFP-mRNA were evaluated by quantifying the fluorescence intensity using image analysis software. Meanwhile, biochemical experiments such as RT-PCR or Western blot could be performed to verify the protein expressed by the mRNA.

[0091] Zebrafish eggs were co-incubated with EGFP-mRNA encapsulated in TNP nanoparticles, and fluorescence microscopy observations were as Figure 4 shown. After incubation for 8 h and 48 h, the green fluorescence of zebrafish eggs was observed to test the expression effect of TNP nanoparticles delivering EGFP-mRNA in zebrafish eggs.

[0092] As Figure 4 shown, the experimental results indicated that green fluorescence signals appeared in zebrafish eggs transfected with EGFP-mRNA encapsulated in TNP nanoparticles after incubation for 8 hours and 48 hours, while no fluorescence expression was observed in the control group. This demonstrated that EGFP-mRNA was successfully expressed in zebrafish eggs. Meanwhile, with the increase in the concentration of nanoparticles encapsulating EGFP-mRNA, the green fluorescence intensity of zebrafish eggs gradually increased. The experimental results proved that TNP nanoparticles could effectively transfect EGFP-mRNA and successfully express it in zebrafish eggs, and its expression effect was closely related to the concentration of the nanoparticles.

[0093] Example 3

[0094] 1. Delivery verification in gene-edited zebrafish embryos

[0095] 1.1 Preparation of zebrafish eggs

[0096] Before implementing the method of the present invention, adult zebrafish were first prepared, obtained from the National Zebrafish Resource Center, and healthy and mature samples were used. These zebrafish had grown for approximately 120 days. To enhance mating vitality, male and female zebrafish were separated and raised one day before spawning.

[0097] Hatching was carried out using a specialized aquarium, and the water temperature was maintained between 28 - 30 °C. The lighting cycle was set to 14 hours of light and 10 hours of darkness per day to simulate day and night changes in the natural environment, so as to promote the normal physiological rhythm and reproductive behavior of zebrafish.

[0098] Usually, 30 minutes after turning on the light, the partition was removed to allow zebrafish to mate. Fertilized eggs were collected within 40 minutes after mating and immediately rinsed three times with distilled water to remove contaminants on the egg surface.

[0099] 1.2 Design of Tyr gene target

[0100] To effectively edit the zebrafish Tyr gene, it is necessary to precisely design the targeting single-guide RNA (sgRNA) of the CRISPR / Cas9 system. The following are the steps for designing the CRISPR / Cas9 target of the Tyr gene:

[0101] 1.2.1 Gene sequence acquisition:

[0102] First, the complete sequence of the zebrafish Tyr gene needs to be obtained. It can be obtained through the public database NCBI.

[0103] The zebrafish tyr gene (tyrosinase gene), the tyrosinase encoded by the tyr gene is a key enzyme involved in the synthesis of melanin. Its sequence and source sequence information are as follows: NCBI ReferenceSequence: NM_131013.3.

[0104] (a) Sequence characteristics,

[0105] * Length: 1955 base pairs;

[0106] * Type: Nucleotide;

[0107] * Strand type: Double-stranded;

[0108] * Topology: Linear;

[0109] (b) Molecular type: Nucleic acid;

[0110] Sequence description: NM_131013.3.

[0111] 2.2 Target recognition and selection:

[0112] 2.2.1 Target position: In the Tyr gene sequence, select the region with the typical PAM sequence (NGG) as the potential CRISPR target. Usually, select the target near the functional domain or key coding region to increase the possibility of phenotypic changes after editing.

[0113] 2.2.2 Specificity analysis: Use the online tool Chopchop for the specificity analysis of the target. These tools can evaluate the uniqueness of the selected target in the genome and reduce the risk of off-target editing.

[0114] 2.2.3 sgRNA design:

[0115] Sequence design: Design the sgRNA according to the selected target sequence. The sgRNA usually includes a 20-nucleotide targeting sequence adjacent to the PAM sequence.

[0116] Optimization: Optimize the sgRNA sequence, which may include increasing the GC content to enhance stability and binding efficiency, or introducing modifications into the sequence to improve resistance to nuclease degradation.

[0117] The designed sequence is: ggactggaggacttctgggg (as shown in SEQ ID NO: 1).

[0118] 2.2.4 sgRNA synthesis: Synthesize sgRNA according to the optimized design. When synthesizing mRNA, chemical modifications need to be introduced. The introduction of N1-methylpseudouridine specifically includes:

[0119] During the synthesis of mRNA, select specific uracil sites for chemical modification, replacing uridine (U) with N1-methylpseudouridine (m1Ψ). This modification helps reduce the chance of mRNA being recognized by the human endogenous immune system. The m1Ψ modification reduces the ability of mRNA to activate pattern recognition receptors such as RIG-I.

[0120] Introduce m1Ψ during in vitro transcription using a transcriptase to ensure the uniformity and high efficiency of the modification.

[0121] Synthetic sequence:

[0122] mG*mG*mA*rCrUrGrGrArGrGrArCrUrUrCrUrGrGrGrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU (as shown in SEQ ID NO: 2).

[0123] 2.2.5 Synthesize NLS-Cas9-NLS (nuclear localization) mRNA:

[0124] The NLS sequence is a publicly known sequence.

[0125] (a) Sequence characteristics,

[0126] * Length: 4272 base pairs;

[0127] * Type: Nucleotide;

[0128] * Strand type: Single-stranded;

[0129]

[0130] Chemical modifications need to be introduced during the synthesis of Cas9-mRNA. The introduction of N1-methylpseudouridine specifically includes:

[0131] During the synthesis of mRNA, specific uracil sites are selected for chemical modification, replacing uridine (U) with N1-methylpseudouridine (m1Ψ). This modification helps reduce the chance of mRNA being recognized by the human endogenous immune system. The m1Ψ modification reduces the ability of mRNA to activate pattern recognition receptors such as RIG-I.

[0132] m1Ψ is introduced during in vitro transcription using a transcriptase to ensure the uniformity and high efficiency of the modification.

[0133] Addition of the polyadenylate tail:

[0134] A Poly(A) tail is added to the 3'-untranslated region of mRNA, with a length generally of 100 - 250 adenosine units. This structure can not only protect mRNA from degradation by external enzymes but also enhance its translation efficiency.

[0135] At the 5' end, a modified 5' cap structure (such as m^7G cap) is added, which is achieved through a co-transcriptional mechanism to further enhance the stability and efficiency of mRNA.

[0136] Purification and verification of modified mRNA,

[0137] Purification process:

[0138] Chromatography techniques are used with an RNA purification column to remove unreacted nucleotides, enzymes, and other impurities from the reaction mixture.

[0139] The modified mRNA is further purified through an ion exchange column or an affinity chromatography column to ensure obtaining a high-purity product.

[0140] Verification of the integrity and efficiency of the modification:

[0141] Gel electrophoresis technology is used to analyze the modified mRNA, and the success of the modification is preliminarily verified by comparing the mobility differences before and after modification.

[0142] Mass spectrometry analysis is used to further confirm the presence and modification rate of various modifications on mRNA to ensure the accuracy and consistency of each step of modification.

[0143] Terminal sequencing analysis is performed to precisely check the sequence of the modified mRNA to ensure there are no unexpected sequence changes or mismatches.

[0144] The above synthetically modified Cas9 mRNA and Tyr-sgRNA were co-embedded. Through a similar double-emulsification process as above, DEPC water containing 50 µg Cas9 mRNA + 30 µg Tyr-sgRNA and the Mal-PEG-b-PLGA / DOTAP hybrid material were subjected to two ultrasonic processes to prepare TNP / Cas9-mRNA&Tyr-sgRNA nanoparticles.

[0145] 4. Delivery methods and verification

[0146] The immersion method was used to deliver the nanocarriers. The specific operation was to place zebrafish embryos into a solution containing nanocarriers (TAT-PEG- b -PLGA material embedding Cas9 mRNA and Tyr-sgRNA), allowing the nanoparticles to naturally contact the embryos and be taken up by embryonic cells. During the delivery process, the concentration of the nanocarriers needed to be precisely controlled, usually in the range of 1 to 100 μg / mL, and the specific concentration depended on the acceptance ability of the embryos and cell types. In addition, the immersion time was also a key parameter, generally ranging from 1 - 12 h, and was adjusted according to different embryonic development rates.

[0147] To maximize transfection efficiency and reduce cytotoxicity, physical methods such as gentle agitation or low-speed centrifugation could be used during the delivery process to help the nanoparticles distribute and contact embryonic cells more evenly. The advantage of this method lies in its non-invasiveness and repeatability, making it suitable for large-scale operations.

[0148] Execution of gene editing

[0149] After the nanocarriers were delivered to embryonic cells, Cas9 protein and sgRNA would be released intracellularly. The Cas9 protein and sgRNA formed a complex, which specifically bound to the target DNA through the sequence guidance of sgRNA. Subsequently, the Cas9 enzyme cleaved the double-stranded DNA at the designated position, initiating the DNA repair mechanism of the cells. During this process, mutations could be introduced or specific gene errors could be corrected through repair pathways mediated by homologous recombination (HDR) or non-homologous end joining (NHEJ).

[0150] 5. Detailed description of effect verification

[0151] The effect verification of the method of the present invention is a crucial step to ensure the correctness and effectiveness of gene editing. The following is a detailed expansion of each step in 4:

[0152] 5.1. Sample collection

[0153] In aquaculture animal embryos subjected to gene editing, sample collection is carried out at specific time points after gene editing (usually more than 72 hours after editing, depending on the species and the development rate of the embryos). Using delicate micromanipulation tools, a small amount of tissue samples are gently extracted from each edited embryo under a microscope, or the whole embryo is extracted without affecting embryo development. To prevent sample contamination and DNA degradation, all operations should be carried out in a sterile environment, and the samples should be quickly transferred to an appropriate preservation solution or directly subjected to DNA extraction.

[0154] 5.2. Gene editing verification

[0155] After extracting DNA from the collected samples, the target gene region is amplified by polymerase chain reaction (PCR) using specific primers. The amplified DNA fragment should include the site expected to be edited by CRISPR / Cas9. Specific designed primers are used to perform PCR amplification on the target editing region of the Tyr gene. This step is to ensure that sequencing covers all potential editing sites, and primer design needs to include the region near the PAM sequence and possible editing regions.

[0156] Sequencing library preparation: Use the PCR products to construct a sequencing library. During this process, appropriate adapters and index tags will be added to enable multiplex sequencing on the Illumina platform.

[0157] Sequencing library preparation,

[0158] Accurate library construction is the key to the success of high-throughput sequencing.

[0159] End modification and adapter ligation: The PCR amplification products are first subjected to end modification, usually including adding an A tail and adapter ligation. During this process, specific adapter sequences are ligated to both ends of the PCR products. These adapters contain sequences for Illumina sequencing and index tags, allowing multiple samples to be processed in parallel in the same sequencing reaction.

[0160] Library purification and verification: After adapter ligation, gel electrophoresis or magnetic bead purification methods are used to remove unligated adapters and overly small PCR products. The purified library is analyzed for its concentration and size distribution by qPCR and capillary electrophoresis to ensure that the library quality meets the requirements of high-throughput sequencing.

[0161] Data processing and analysis,

[0162] The processing and analysis of high-throughput sequencing data are the core steps in determining the gene editing effect.

[0163] Data quality control: Use software such as CASAVA to process the raw sequencing data and perform basic quality control, including removing low-quality reads and trimming adapter sequences, to ensure the accuracy of data analysis.

[0164] Sequence alignment: Use software such as MAFFT or BWA to align the cleaned reads with the reference genome to accurately identify sequence changes in the edited regions. The alignment results help determine specific editing events mediated by CRISPR / Cas9, such as single nucleotide variations, insertions, or deletions.

[0165] Analysis of editing efficiency and specificity: Calculate the mutation frequency at the editing sites based on the alignment results to evaluate the editing efficiency. At the same time, check for potential off-target sites to ensure the specificity and accuracy of the editing.

[0166] The analysis of the sequencing results includes comparing the gene sequences before and after editing, with particular attention to the gene regions targeted by the sgRNA guided by the Cas9 enzyme. Analyze whether there are expected insertions, deletions, or substitution mutations (indels), and the types and frequencies of these changes. By calculating the editing efficiency (i.e., the ratio of the number of successfully edited embryos to the total number of embryos) and verifying specific editing (i.e., checking for off-target editing), the accuracy and effectiveness of gene editing can be evaluated.

[0167] Zebrafish eggs were co-incubated with Cas9 mRNA encapsulated in TNP nanocarriers and Tyr-sgRNA as Figure 5 shown. After 72 hours of incubation, genomic DNA was extracted for NGS second-generation sequencing, and the sequencing mutation results were presented.

[0168] Through NGS (next-generation sequencing) analysis of zebrafish larvae, the results further revealed significant gene editing changes in the target region of the zebrafish Tyr gene. Specifically, a single-base deletion and a large number of SNP (single nucleotide polymorphism) mutations were detected in the target region, indicating that the gene editing tool successfully induced genetic variations. The analysis data showed that the editing efficiency of the Tyr gene reached 36%, meaning that approximately 36% of the gene sequences in the analyzed zebrafish larvae underwent the expected editing or mutation. Figure 5 These results in [[ ]] indicate that EGFP-mRNA encapsulated in TNP nanocarriers not only successfully entered zebrafish cells and was expressed intracellularly, but also was able to effectively induce mutations and deletions at the targeted gene.

[0169] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments only. Those of ordinary skill in the art can achieve the purpose of the present invention based on the content disclosed above. Any improvements and modifications made based on the concept of the present invention fall within the protection scope of the present invention. The specific protection scope shall be subject to what is recorded in the claims.

Claims

1. A nanocarrier for gene editing of aquatic animals, characterized in that, Comprising a) TNP nanoparticles and b) Cas9 mRNA and sgRNA; The TNP nanoparticles in a) are obtained by the following preparation method: (1) Take maleimide-functionalized polyethylene glycol Mal-PEG-OH, lactide D,L-LA, and glycolide GA and add them to a reaction vessel. Add a magnetic stir bar and heat in an oil bath to 130 - 150 °C. Continuously stir until all the solids in the reaction vessel are dissolved. Subsequently, under stirring conditions, add stannous octoate Sn(Oct)2 and continue stirring for 2 - 5 h. After the reaction is completed, concentrate the product and precipitate it in a methanol-ether mixture. Filter by suction and dry to obtain pale yellow Mal-PEG-b-PLGA; (2) Take Mal-PEG-b-PLGA and add it to a round-bottomed container. Then add a magnetic stir bar and dimethyl sulfoxide DMSO to dissolve Mal-PEG-b-PLGA. Then, under stirring conditions, add ultrapure water and continue stirring to prepare Mal-NP nanoparticles; (3) Dialyze the Mal-NP nanoparticles in ultrapure water overnight to remove dimethyl sulfoxide DMSO. Collect the nanoparticle solution in the dialysis bag and transfer it to a round-bottomed container. Add the cell-penetrating peptide TAT and stir under nitrogen protection. After the reaction is completed, collect the particle solution and centrifuge. Collect the precipitate of the lower layer of particles and lyophilize to obtain the TAT-modified TAT-Mal-NP material, abbreviated as TNP nanoparticles; In step (1), the molar ratio of maleimide-functionalized polyethylene glycol Mal-PEG-OH, lactide D,L-LA, and glycolide GA is 0.2:10.8 - 11.5:5.0 - 5.2; In step (3), the mass ratio of the Mal-NP nanoparticles to the cell-penetrating peptide TAT is 14 - 16:1.5 - 2.5; In step (3), the average particle size range of the TNP nanoparticles is 50 - 200 nanometers; Mix the ultrapure aqueous solutions of Cas9 mRNA and sgRNA with TNP nanoparticles and DOTAP, and prepare a nanocarrier for aquatic animal gene editing through two ultrasonic processes.

2. Use of the TNP nanoparticles described in claim 1 as an mRNA delivery vector for aquatic animals; the aquatic animals are zebrafish or tiger prawns.

3. A gene editing method based on the nanocarrier described in claim 1, characterized in that, Comprising the following steps: 1) Mix the ultrapure aqueous solutions of Cas9 mRNA and sgRNA with TNP nanoparticles and DOTAP, and prepare a nanocarrier for aquatic animal gene editing through two ultrasonic processes; 2) Deliver the nanocarrier into the embryos of the target aquatic animals; 3) Edit the target gene in the embryos; The target aquatic animals in step 2) are zebrafish or tiger prawns; The method of delivering the nanocarrier into the embryos of the target aquatic animals in step 2) is soaking.

Citation Information

Patent Citations

  • Cell-penetrating peptide modified nanoparticle and its preparation method

    CN102988295A

  • Delivery systems and kits for gene editing

    US20170152507A1

  • Gene modulation with crispr system type i

    WO2020092725A1