Fluorescent biosensor for detecting miR-21 based on primer exchange reaction and exonuclease

Abstract

The invention discloses a fluorescent biosensor for detecting miR-21 based on primer exchange reaction and exonuclease. The fluorescent biosensor comprises a primer exchange reaction system driven by DNA polymerase and an exonuclease reaction system, according to the invention, the primer exchange reaction driven by DNA polymerase and the chain digestion participated by exonuclease III are combined for the first time, so that the kit shows ultrahigh signal amplification capability, can rapidly and simply quantify the concentration of target nucleic acid, and shows a relatively great application prospect in the fields of biomedicine and clinical diagnosis and treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection, and in particular to a fluorescent biosensor for detecting miR-21 based on primer exchange reaction and exonuclease. Background Art

[0002] MicroRNAs (miRNAs), as an endogenous non-coding RNA, are only 18-25 bases long and were first discovered in 1993. MiRNAs are widely involved in various life activities of the body, including regulating cell proliferation, migration and differentiation. Their abnormal expression is often closely related to the occurrence of various diseases. Their dysregulated expression usually occurs in various biological processes, such as cell proliferation, invasion, apoptosis, death, and also in different stages of disease development. Therefore, more and more literatures show that it can be used as a good potential disease marker and play a vital role in the diagnosis, treatment and prognosis of diseases. At present, the gold standard method for detecting this microRNA is still real-time fluorescence quantitative PCR. However, this method has great disadvantages. First, PCR is a high-temperature denaturation and annealing process. The repeated changes in temperature lead to strict requirements for experimental instruments. Therefore, this equipment is often very expensive and is not feasible in most economically underdeveloped areas. Second, the PCR process is unstable and time-consuming and labor-intensive, and the cumbersome operation brings great challenges to timely detection. Therefore, the development of a biosensor method that does not rely on complex and expensive instruments such as PCR and is simple and fast to operate has shown great application value and potential in the early diagnosis of diseases. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a fluorescent biosensor for detecting miR-21 based on primer exchange reaction and exonuclease.

[0004] In order to achieve the above object, the present invention provides the following technical solutions: A fluorescent biosensor for detecting miR-21 based on primer exchange reaction and exonuclease, wherein the fluorescent biosensor comprises a primer exchange reaction system driven by DNA polymerase and an exonuclease reaction system; The DNA polymerase-driven primer exchange reaction system includes a pre-assembled product of a hairpin H4 and a protective chain, a single-stranded DNA primer P1, dNTPs, a Bst3.0 DNA polymerase and a buffer thereof; the hairpin H4 is composed of a single-stranded DNA domain containing a protective chain and a P1 binding site and a double-stranded stem portion, the 3' end of the double-stranded stem is modified with an inverted T base to prevent non-specific extension, and the GC base pair at the end of the stem is hydroxymethylated to prevent the extension of the polymerase; the protective chain is composed of a 9-base-long foothold TCAACATCA, a blocking portion GTCTGATAAGCTA and a primer portion GTGTAGA, the 3' end of the protective chain is blocked by an inverted T base, the foothold is partially hybridized with the target miR-21, and the blocking portion is complementary hybridized with the single-stranded DNA domain of the hairpin H4; The exonuclease reaction system includes a hairpin H3, exonuclease III and a buffer thereof; the 5' end of the hairpin H3 is modified with a fluorescent group, and the 3' end base complementary to the base is modified with a fluorescent quenching group; the 3' end of the hairpin H3 protrudes with multiple bases in the form of a single-stranded DNA, which not only serves as a recognition region for the primer extension sequence P2 generated in the previous step, but also prevents non-specific digestion by exonuclease III; When the target miR-21 is present, miR-21 complementarily hybridizes with the foothold on the protection chain, and then displaces the protection chain from the hairpin H4 and the pre-assembled product of the protection chain through an entropy-driven chain displacement reaction. Then P1 binds to H4 and, with the help of Bst 3.0 DNA polymerase, replicates and extends forward using hairpin H4 as a template until it encounters a hydroxymethylation modification site and terminates. Through molecular migration between chains, the extended primer P2 is displaced from H4, and H4 returns to its original state and continues to hybridize with P1 to repeat the next round of primer exchange reaction cycle. P2 displaced from H4 complementarily hybridizes with H3 to form a double-stranded DNA structure with a blunt end at 3', thereby triggering the enzymatic digestion function of nuclease exonuclease III. Nuclease III starts from the double-stranded DNA at the 3' blunt end and digests and cuts the bases forward, thereby destroying the structure of hairpin H3, and the modified groups at both ends are away from each other, generating a fluorescent signal.

[0005] In some embodiments of the present invention, the nucleotide sequences of the miRNA-21, hairpin H4, protective strand, single-stranded DNA primer P1, primer extension sequence P2, and hairpin H3 are respectively: miR-21: UAGCUUAUCAGACUGAUGUUGA; Hairpin H4: GAGGACAGTGGCGCTCmGmGGCCTTTTGGCmCmCGACGCCACTGTCCTCTCTACACTAGCTTATCAdT; Protection chain:TCAACATCAGTCTGATAAGCTAGTGTAGAdT; Single-stranded DNA primer P1: GTGTAGA; Primer extension sequence P2: GTGTAGAGAGGACAGTGGCGCTC; Hairpin H3: FAM-ATCTCTTATTGGGCCTTTTTGGCCCAATAAGAGAT-(BHQ1)-CCACTGTCCTCTCTACAC.

[0006] In some embodiments of the present invention, the detection method includes the following steps: first, a sample containing the target miR-21 to be detected is mixed with a DNA polymerase-driven primer exchange reaction system and incubated for the first time, and the DNA polymerase activity is inactivated after the reaction is completed; then, it is added to a nuclease exonuclease reaction system and incubated for a second time, and the nuclease exonuclease activity is inactivated after the reaction is completed; finally, the fluorescence value is detected.

[0007] In some embodiments of the present invention, the concentrations of the components in the reaction system of the fluorescent biosensor are: 100 nM of the preassembled product of H4 and the protective chain, 200 nM of the single-stranded DNA primer P1, 10 mM of dNTP, 100 nM of hairpin H2, 16 U / 20 μL of Bst3.0 DNA polymerase, 200 nM of hairpin H3, and 1 U / μL of exonuclease III.

[0008] In some embodiments of the present invention, the reaction condition for the first incubation is incubation at 37° C. for 2 h, and the reaction condition for inactivating the activity of the DNA polymerase is inactivation at 80° C. for 5 min.

[0009] In some embodiments of the present invention, the reaction condition for the second incubation is 40 min at 37° C., and the reaction condition for inactivating the exonuclease activity is heating at 70° C. for 20 min.

[0010] In some embodiments of the present invention, the parameters for detecting fluorescence values ​​are set as follows: the excitation wavelength is 480 nm, the emission wavelength is 500-600 nm, and the slits of the excitation peak and the emission peak are both 5 nm.

[0011] The beneficial effects of the present invention are as follows: the present invention successfully solves the problem of sensitive detection of low-abundance targets through cascade amplification reaction, exponentially amplifies sequences with extremely low contents, facilitates detection by conventional techniques, and provides a favorable alternative tool and option for the detection of clinical disease markers.

[0012] The advantage of the present invention also lies in that it is the first time that the primer exchange reaction driven by DNA polymerase and the chain digestion involving nuclease III are combined, so that the invention exhibits ultra-high signal amplification capabilities, can quickly and easily quantify the concentration of target nucleic acid, and shows great application prospects in the fields of biomedicine and clinical diagnosis and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 This is a design diagram of the technical principle of the present invention.

[0014] Figure 2 The feasibility of the present invention was verified by non-denaturing gel electrophoresis.

[0015] Figure 3 The feasibility of the present invention is verified by fluorescence spectroscopy.

[0016] Figure 4 For sensitivity analysis.

[0017] Figure 5 For specific analysis. DETAILED DESCRIPTION

[0018] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0019] All oligonucleotide sequences in the present invention were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. and the nucleic acid sequences were purified by high performance liquid chromatography. Bst 3.0 DNA polymerase and its buffer (10×rCutSmart buffer), exonuclease III and its buffer (buffer 1) were ordered from New England Biolabs (Beijing). 20 bp DNA marker and 10× loading buffer were purchased from TakaRa Biological Company (Chengdu Microgram). Fluorescence signals were collected using a fluorescence spectrophotometer (Hitachi, Japan). Non-denaturing polyacrylamide gel electrophoresis (nPAGE) was performed on a Bio-Rad electrophoresis analyzer (Bio-Rad, USA), and the results were visualized on a Bio-rad ChemDoc XRS (Bio-Rad, USA).

[0020] The principle design of the present invention is as follows Figure 1 As shown, taking miR-21 as the target to be detected, the detection process specifically includes the following steps: A reaction system was constructed, including different concentrations of target miR-21, molecular recognition elements, fluorescent probe (hairpin H3), protective chain (Protector), single-stranded DNA primer (P1: GTGTAGA), dNTP, Bst3.0 DNA polymerase and its buffer, exonuclease III and its buffer.

[0021] After completing the above reaction system, a fluorescence spectrophotometer is used to detect the fluorescence intensity, and the target miR-21 is qualitatively and quantitatively analyzed according to the strength of the fluorescence signal.

[0022] The molecular recognition element is assembled from a hairpin H4 and a protective strand; the hairpin H4 is composed of a single-stranded DNA domain containing a protective strand and a P1 binding site and a double-stranded stem. The 3' end of the double-stranded stem is modified with an inverted T base to prevent nonspecific extension, and the GC base pair at the end of the stem is hydroxymethylated to prevent extension by the polymerase.

[0023] The protector chain is composed of a 9-base-long foothold (TCAACATCA, partially hybridized with miR-21), a blocking portion (GTCTGATAAGCTA, complementary hybridized with the single-stranded DNA domain of H4) and a primer portion (GTGTAGA). The 3' end of the protector chain is blocked by an inverted T base.

[0024] The 5' end of hairpin H3 is modified with FAM fluorescent group, and the internal base of the 3' end complementary to it is modified with BHQ1 fluorescent quenching group. The 3' end of H3 has multiple protruding bases (CCACTGTCCTCTCTACAC) in the form of single-stranded DNA, which not only serves as the recognition region of the primer extension sequence P2 (GTGTAGAGAGGACAGTGGCGCTC) generated in the previous step, but also prevents non-specific digestion by exonuclease III.

[0025] In the presence of target miR-21, miR-21 hybridizes with the 9-base-long foothold DNA sequence exposed on the protective strand and then displaces the protective strand from H4 through an entropy-driven strand displacement reaction (target miR-21 and the protective strand are completely complementary). Without the blocking effect of the protective strand, H4 exposes the primer binding domain of the single-stranded DNA primer P1, resulting in the successful binding of the primer to H4. Then, with the help of DNA polymerase (Bst 3.0), the DNA primer P1 replicates and extends forward using the hairpin H4 as a template until it encounters the termination site (hydroxymethylated base pair) and stops replicating and extending forward. Through molecular migration between chains, the extended DNA primer P2 is displaced from H4, and H4 returns to its original state and continues to hybridize with the primer DNA to repeat the next round of primer exchange reaction cycle (PER Circuits). The extended primer DNA P2 displaced from H4 hybridizes with H3 to form a double-stranded DNA structure with a blunt end at 3', thereby triggering the enzymatic digestion function of nuclease exonuclease III. Exonuclease III starts from the 3' flat end of the double-stranded DNA and digests and cuts the bases forward, thereby destroying the structure of the hairpin H3, and the modified groups at both ends are away from each other, and the quenched fluorescence signal is restored. The strength of the fluorescence signal is closely related to the presence and concentration of the target miR-21, so the present invention realizes accurate quantitative detection and analysis of miR-21.

[0026] Table 1 Primer information Name Nucleic acid sequence (5'→3') H3 FAM-ATC TCT TAT TGG GCC TTT TTG GCC CAA TAA GAG AT-(BHQ1)-C CAC TGT CCT CTC TAC AC (SEQ ID NO.1) H4 GAG GAC AGT GGC GCT CmGmG GCC TTT TGG CmCmC GA CGC CAC TGT CCT CTC TAC ACT AGC TTA TCA dT (SEQ ID NO.2) Protector TCA ACA TCA GTC TGA TAA GCT AGT GTA GA dT (SEQ ID NO.3) P1 GTG TAG A miR-21 UAG CUU AUC AGA CUG AUG UUG A (SEQ ID NO.4) miR-429 UAA UAC UGU CUG GUA AAA CCG U (SEQ ID NO.5) miR-210 CUG UGC GUG UGA CAG CGG CUG A (SEQ ID NO.6) miR-203 GUG AAA UGU UUA GGA CCA CUA G (SEQ ID NO.7) miR-200b UAA UAC UGC CUG GUA AUG AUG AC (SEQ ID NO.8) miR-143 UGA GAU GAA GCA CUG UAG CUC A (SEQ ID NO.9) miR-141 UAA CAC UGU CUG GUA AAG AUG G (SEQ ID NO.10) miR-25-3p CAU UGC ACU UGU CUC GGU CUG A (SEQ ID NO.11) let-7a UGA GGU AGU AGG UUG UAU AGU U (SEQ ID NO.12) Note: m represents hydroxymethylation modification, FAM represents carboxyfluorescein, and BHQ1 represents fluorescence quenching group.

[0027] Example 1 After a lot of experiments, the inventors of the present invention have established a new fluorescence amplification platform based on primer exchange reaction and exonuclease III. The specific operation steps are as follows: In the present invention, a nucleic acid element with miRNA-21 (miR-21) recognition ability is first assembled, which is pre-assembled by a protective chain blocked by an inverted T base at the 3' end and a hairpin H4. The hairpin H4 is denatured and annealed in a buffer in advance to form a stable hairpin structure. H4 (10 μM) and the protective chain (10 μM) are hybridized in a buffer containing magnesium ions and incubated at 37°C for 2 hours, thereby blocking the primer binding site in H4. Then, a 20 μL reaction system was constructed, including 100 nM H4 and protective chain assembly products, 200 nM single-stranded DNA primer P1, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg / ml recombinant albumin, pH 7.9@25°C), different concentrations of miR-21 and enzyme-free water were incubated at 37°C for 2 hours. The mixed solution was heated at 80°C for 5 min to inactivate the polymerase. Then 5 μL of the above product was added to the reaction solution of 200 nM hairpin H3, 1 U / μL exonuclease III, 1×NEBuffer1 (10 mM Bis-Tris-Propane-HCl, 10 mM MgCl 2 , 1 mM DTT, pH 7 @ 25°C), and enzyme-free water was added to 20 μL. The reaction system was carried out at 37°C for 40 min, and the protease was inactivated after heating at 70°C for 20 min. Finally, 180 μL of enzyme-free water was added to form the sample to be tested, and the fluorescence intensity was detected using a fluorescence spectrophotometer. The intensity of the fluorescence signal is positively correlated with the concentration of miR-21, thereby achieving quantitative analysis of the target nucleic acid. When detecting the fluorescence value, the parameters were set as follows: the excitation wavelength was 480 nm, the emission wavelength was 500~600nm, and the slits of the excitation peak and emission peak were both 5 nm.

[0028] Example 2 12% non-denaturing gel electrophoresis was used to verify the progress of the cascade amplification process. Referring to Example 1, 10 μL of the loading sample was prepared, which contained 9 μL of the cascade amplification product and 1 μL of 10 × loading buffer, mixed and added to the gel electrophoresis lane. The entire electrophoresis process was carried out in a specific buffer and electrophoresed at a constant voltage of 120V for 45 minutes. Finally, the gel was stained with a red nucleic acid dye. The gel was photographed using the Bio-rad ChemDoc XRS system. The results are shown in Figure 2. Figure 2As shown, lane M: 20 bp DNA marker; lane 1: miR-21; lane 2: protection strand; lane 3: H4; lane 4: protection strand + H4; lane 5: miR-21 + protection strand; lane 6: protection strand + H4 + Bst3.0 DNA polymerase; lane 7: miR-21 + protection strand + H4 + Bst3.0 DNA polymerase; lane 8: protection strand + H4 + Bst3.0 DNA polymerase + H3 + exonuclease III; lane 9: miR-21 + protection strand + H4 + Bst3.0 DNA polymerase + H3 + exonuclease III. The concentrations of protection strand, H4, Bst3.0 DNA polymerase, H3 and exonuclease III were 100 nM, 100 nM, 16 U, 200 nM and 1 U / μL, respectively. The reaction times for primer exchange reaction and exonuclease III-assisted cleavage were 2 h and 40 min, respectively. Compared with lane 6, the target miR-21 in lane 7 successfully removed the protective strand from H4. The hybridization band of the protective strand and H4 became lighter, and the hybridization band of miR-21 and the protective strand was observed. With the help of primers and polymerase, the primer exchange reaction circuit was triggered, and a fuzzy band with a small molecular weight and fast movement appeared below lane 7. In the absence of target, H3 in lane 8 remained intact, while the assembly of the protective strand and H4 was digested and cleaved by exonuclease III. In contrast, miR-21 in lane 9 successfully triggered the primer exchange reaction, resulting in the cleavage of H3. The band corresponding to H3 in lane 9 disappeared, leaving only some digestion product fragments.

[0029] Example 3 Construct a 20 μL reaction system with reference to Example 1. Sample 1 (positive control): contains 100 nM H4 and protector assembly products, 200 nM single-stranded DNA primer (P1), 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer and 10 nM miR-21. Take 5 μL of the above product and add it to the reaction solution of 200 nM H3, 1 U / μL exonuclease III, 1×NEBuffer 1, and add enzyme-free water to make up to 20 μL. The 20 μL detection system reaction was carried out at 37°C for 40 min and heated at 70°C for 20 min.

[0030] Sample 2 (negative control): contains 100 nM H4 and protector assembly products, 200 nM single-stranded DNA primer (P1), 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer. Take 5 μL of the above product and add it to the reaction solution of 200 nM H3, 1 U / μL nuclease III, 1×NEBuffer 1, and add enzyme-free water to make up to 20 μL. The 20 μL detection system reaction was carried out at 37°C for 40 min and heated at 70°C for 20 min.

[0031] The results are as follows Figure 3 As shown, it is shown that in the presence of miR-21, a significantly enhanced fluorescence signal is generated, the negative control signal is lower, and there is an obvious signal intensity difference compared with the positive control, thereby proving the feasibility of the present invention in detecting miR-21.

[0032] Example 4: miR-21 was diluted to different concentrations using enzyme-free water and added to the reaction system described in Example 1. The final concentration gradient was 100 nM, 50 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM, 100 fM. Referring to the experimental method of Example 1, the fluorescence signals of different concentration groups were detected and recorded using a spectrophotometer. The results are shown in FIG. Figure 4 As shown, the linear range of the present invention is 100 fM -1 nM, the detection limit is 21 fM, and the fitting is FI = 64.44lgC miR-21 +332.69.

[0033] Example 5 We selected several other homologous RNAs in the miRNA family to conduct specificity experiments to evaluate the specific recognition ability of the present invention.

[0034] Sample 1: does not contain any miRNA; Sample 2: contains 100 nM let-7a; Sample 3: containing 100 nM miR-25-3P; Sample 4: contains 100 nM miR-141; Sample 5: contains 100 nM miR-143; Sample 6: contains 100 nM miR-200b; Sample 7: contains 100 nM miR-203; Sample 8: contains 100 nM miR-210; Sample 9: contains 100 nM miR-429; Sample 10: Contains 10 nM miR-21.

[0035] According to Example 1, a reaction system was established, including 100 nM H4 and protector assembly products, 200 nM single-stranded DNA primers, 10 mM dNTPs, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer and different target miRNAs (target miR-21 concentration was 10 nM, and other interfering miRNAs concentration was 100 nM). Take 5 μL of the above product and add it to the reaction solution of 200 nM H3, 1 U / μL exonuclease III, 1×NEBuffer 1, and add enzyme-free water to make up to 20 μL. The 20 μL detection system reaction was carried out at 37°C for 40 min and heated at 70°C for 20 min.

[0036] The results are as follows Figure 5 As shown, even if the concentration of other interfering RNAs is ten times higher than the target concentration, they all show inconspicuous fluorescence signals, and the fluorescence intensity is equivalent to that of the blank control, while only miR-21 can cause significant fluorescence enhancement, thus strongly proving the good specificity of the present invention.

[0037] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A fluorescent biosensor for detecting miR-21 based on primer exchange reaction and exonuclease, characterized in that: The fluorescent biosensor includes a primer exchange reaction system driven by DNA polymerase and an exonuclease reaction system; The DNA polymerase-driven primer exchange reaction system includes a pre-assembled product of a hairpin H4 and a protective strand, a single-stranded DNA primer P1, dNTPs, a Bst3.0 DNA polymerase and a buffer thereof; the hairpin H4 is composed of a single-stranded DNA domain containing a protective strand and a P1 binding site and a double-stranded stem portion, the 3' end of the double-stranded stem is modified with an inverted T base to prevent nonspecific extension, and the GC base pair at the end of the stem is hydroxymethylated to prevent extension of the polymerase; The protective strand consists of a 9-base-long foothold TCAACATCA, a blocking portion GTCTGATAAGCTA, and a primer portion GTGTAGA. The 3' end of the protective strand is blocked by an inverted T base. The foothold hybridizes with the target miR-21 portion, and the blocking portion complementarily hybridizes with the single-stranded DNA domain of the hairpin H4. The exonuclease reaction system includes a hairpin H3, exonuclease III and a buffer thereof; the 5' end of the hairpin H3 is modified with a fluorescent group, and the 3' end base complementary to the base is modified with a fluorescent quenching group; the 3' end of the hairpin H3 protrudes with multiple bases in the form of a single-stranded DNA, which not only serves as a recognition region for the primer extension sequence P2 generated in the previous step, but also prevents non-specific digestion by exonuclease III; When the target miR-21 is present, miR-21 complementarily hybridizes with the foothold on the protection chain, and then displaces the protection chain from the hairpin H4 and the pre-assembled product of the protection chain through an entropy-driven chain displacement reaction. Then P1 binds to H4 and, with the help of Bst3.0 DNA polymerase, replicates and extends forward using hairpin H4 as a template until it encounters a hydroxymethylation modification site and terminates. Through molecular migration between chains, the extended primer P2 is displaced from H4, and H4 returns to its original state and continues to hybridize with P1 to repeat the next round of primer exchange reaction cycle. P2 displaced from H4 complementarily hybridizes with H3 to form a double-stranded DNA structure with a blunt end at 3', thereby triggering the enzymatic digestion function of nuclease exonuclease III. Nuclease III digests and cuts the bases from the double-stranded DNA at the 3' blunt end, thereby destroying the structure of hairpin H3, and the modified groups at both ends move away from each other, generating a fluorescent signal.

2. The fluorescent biosensor according to claim 1, characterized in that: The nucleotide sequences of miRNA-21, hairpin H4, protective strand, single-stranded DNA primer P1, primer extension sequence P2, and hairpin H3 are respectively: miR-21: UAGCUUAUCAGACUGAUGUUGA; Hairpin H4: GAGGACAGTGGCGCTCmGmGGCCTTTTGGCmCmCGACGCCACTGTCCTCTCTACACTAGCTTATCAdT; Protection chain:TCAACATCAGTCTGATAAGCTAGTGTAGAdT; Single-stranded DNA primer P1: GTGTAGA; Primer extension sequence P2: GTGTAGAGAGGACAGTGGCGCTC; Hairpin H3: FAM-ATCTCTTATTGGGCCTTTTTGGCCCAATAAGAGAT-(BHQ1)-CCACTGTCCTCTCTACAC.

3. The fluorescent biosensor according to claim 1, characterized in that: The detection method includes the following steps: first, a sample containing the target miR-21 to be detected is mixed with a primer exchange reaction system driven by a DNA polymerase and incubated for the first time, and the DNA polymerase activity is inactivated after the reaction is completed; then, it is added to a nuclease exonuclease reaction system and incubated for a second time, and the nuclease exonuclease activity is inactivated after the reaction is completed; finally, the fluorescence value is detected.

4. The fluorescent biosensor according to claim 3, characterized in that: The concentrations of the components in the reaction system of the fluorescent biosensor are: 100 nM of the preassembled product of H4 and the protective chain, 200 nM of the single-stranded DNA primer P1, 10 mM of dNTP, 100 nM of hairpin H2, 16 U / 20 μL of Bst3.0 DNA polymerase, 200 nM of hairpin H3, and 1 U / μL of exonuclease III.

5. The fluorescent biosensor according to claim 3, characterized in that: The reaction condition for the first incubation was 37°C for 2 h, and the reaction condition for inactivating DNA polymerase activity was 80°C for 5 min.

6. The fluorescent biosensor according to claim 3, characterized in that: The reaction conditions for the second incubation were 37°C for 40 min, and the reaction conditions for inactivating the exonuclease activity were heating at 70°C for 20 min.

7. The fluorescent biosensor according to claim 3, characterized in that: When detecting the fluorescence value, the parameters were set as follows: the excitation wavelength was 480 nm, the emission wavelength was 500-600 nm, and the excitation peak and emission peak slits were both 5 nm.

Images