Gene detection kit for in vitro diagnosis of arrhythmic right ventricular cardiomyopathy

Abstract

The invention provides a gene detection kit for in vitro diagnosis of arrhythmic right ventricular cardiomyopathy, and belongs to the technical field of biological detection. The gene variation combination provided by the invention has extremely close relevance with the arrhythmic right ventricular cardiomyopathy, and can be effectively applied to screening potential carriers of the arrhythmic right ventricular cardiomyopathy, so that the existence of diseases can be found in an early stage. The kit provided by the invention is used for family investigation, and genetic risks possibly existing in family members can be further confirmed, so that early discovery and intervention of diseases are realized, the survival rate of patients is effectively improved, the economic burden of the patients and families thereof is relieved, and the life quality of the patients is also favorably improved.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a gene detection kit for in vitro diagnosis of arrhythmogenic right ventricular cardiomyopathy. Background Art

[0002] Arrhythmogenic right ventricular cardiomyopathy (ARVC), also known as arrhythmogenic right ventricular dysplasia, is a type of genetically related cardiomyopathy, mainly related to heterozygous or combined mutations of desmosome protein genes. The lesions mainly affect the right ventricle, and some patients may also affect the left ventricle. Its pathological anatomical changes are loose and separated myocardial cells, which eventually undergo apoptosis and necrosis and are replaced by fiber and (or) adipose tissue infiltration to varying degrees. It is the pathological basis of arrhythmogenic syncope, ventricular tachycardia, and sudden cardiac death. Arrhythmias are often early clinical manifestations of arrhythmogenic right ventricular cardiomyopathy. Inverted T waves in leads V1-V4 during sinus rhythm are common electrocardiographic changes in arrhythmogenic right ventricular cardiomyopathy. Echocardiography and right ventricular angiography are of high value in diagnosing arrhythmogenic right ventricular cardiomyopathy. Electrocardiographic changes cannot be used to differentiate it from various cardiomyopathies such as ischemic cardiomyopathy and myocardial amyloid degeneration. Due to the lack of specificity in clinical manifestations, the diagnosis of arrhythmogenic right ventricular cardiomyopathy is somewhat difficult.

[0003] Arrhythmogenic right ventricular cardiomyopathy is commonly diagnosed through right ventricular structural and functional abnormalities, left bundle branch block ventricular tachycardia, endomyocardial biopsy, and heart disease genomic panel testing. Patients' manifestations vary greatly, and it is difficult to make a clear diagnosis based on symptoms. Endomyocardial biopsy is a diagnostic method with high specificity and sensitivity, but because it is an invasive examination, many patients find it difficult to accept.

[0004] In recent years, genetic testing has played an important role in the diagnosis of arrhythmogenic right ventricular cardiomyopathy and has received increasing clinical attention.

[0005] Chinese patent CN113652422A discloses a JUP gene mutant and its application. Compared with the wild-type JUP gene, the gene mutation has a c.958C>T mutation, which provides a new mutation point for cardiomyopathy, especially arrhythmogenic right ventricular cardiomyopathy.

[0006] At present, genome sequencing is widely used at home and abroad to detect arrhythmogenic right ventricular cardiomyopathy. The main genes detected are PKP2, DSP, DSG-2, DSC2, JUP, TMEM43, DES and PLN. Whole exome sequencing or genome sequencing is usually used to determine whether there are mutations in related genes. The whole exome sequencing process is relatively complicated, and the interpretation of sequencing results requires the support of bioinformatics professionals. The detection process of genome sequencing is relatively simple, and the interpretation of sequencing results is relatively easy. Both technologies have the disadvantages of being relatively expensive and having a long analysis cycle. The establishment of a low-cost and short-analysis cycle detection method will help screen and diagnose carriers of arrhythmogenic right ventricular cardiomyopathy.

[0007] Therefore, how to provide more rapid-contact test kits for detecting carriers and patients of arrhythmogenic right ventricular cardiomyopathy remains a technical problem that needs to be urgently solved by those skilled in the art. Summary of the invention

[0008] The purpose of the present invention is to provide a gene detection kit for in vitro diagnosis of arrhythmogenic right ventricular cardiomyopathy, which provides an effective means for diagnosing arrhythmogenic right ventricular cardiomyopathy.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides SNP markers associated with arrhythmogenic right ventricular cardiomyopathy, including PKP2c.498 and / or KCNA5 c.1727;

[0011] The mutation type of PKP2 c.498 is C>G

[0012] The mutation type of KCNA5 c.1727 is C>T.

[0013] In the present invention, the "PKP2" and "KCNA5" are gene names; the "c.498" and "c.1727" are position numbers, the base before the ">" is the base before the change, and the base after the ">" is the base after the change.

[0014] The present invention also provides a primer set for amplifying the above-mentioned SNP marker, comprising a primer pair 1 and a primer pair 2;

[0015] The nucleotide sequences of the primer pair 1 are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0016] The nucleotide sequences of the primer pair 2 are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0017] The present invention also provides the use of the above SNP marker in preparing arrhythmogenic right ventricular cardiomyopathy diagnosis product.

[0018] The present invention also provides the use of the above-mentioned SNP marker in the preparation of a risk assessment product for arrhythmogenic right ventricular cardiomyopathy.

[0019] The present invention also provides the use of the primer set in preparing arrhythmogenic right ventricular cardiomyopathy diagnosis product.

[0020] The present invention also provides the use of the primer set in preparing a risk assessment product for arrhythmogenic right ventricular cardiomyopathy.

[0021] The present invention also provides a kit for in vitro diagnosis of arrhythmogenic right ventricular cardiomyopathy, characterized in that it contains a detection reagent for amplifying the above SNP marker.

[0022] The present invention also provides a kit for in vitro diagnosis of arrhythmogenic right ventricular cardiomyopathy, characterized in that it contains the above primer set.

[0023] The present invention also provides a kit for in vitro diagnosis of arrhythmogenic right ventricular cardiomyopathy, characterized in that it contains a detection reagent for amplifying a mutant target sequence 1 and amplifying a mutant target sequence 2;

[0024] The nucleotide sequence of the mutant target sequence 1 is shown in SEQ ID NO.5;

[0025] The nucleotide sequence of the mutant target sequence 2 is shown in SEQ ID NO.6.

[0026] The present invention also provides the use of the above-mentioned kit in preparing a product for assessing the risk of arrhythmogenic right ventricular cardiomyopathy.

[0027] Beneficial effects of the present invention:

[0028] There is an extremely close correlation between the gene variation combination provided by the present invention and arrhythmogenic right ventricular cardiomyopathy, and can be effectively used to screen potential carriers of arrhythmogenic right ventricular cardiomyopathy, so as to discover the presence of the disease at an early stage. The kit provided by the present invention is used for family surveys to further confirm the genetic risks that may exist in family members, thereby achieving early detection, intervention or risk assessment of the disease. This method of early diagnosis and early treatment plays a vital role in improving the survival rate of patients, because it can effectively intervene before the disease develops to a serious stage. In addition, through early detection and treatment, the mortality rate of patients can be significantly reduced, the economic burden of patients and their families can be reduced, and it also helps to improve the quality of life of patients. Therefore, the present invention is of great significance in improving the survival rate of patients with arrhythmogenic right ventricular cardiomyopathy, reducing the mortality rate, improving the quality of life of patients and reducing the burden on families. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The sequencing results of the PKP2 gene c.498C site and the KCNA5 gene c.1727C site in the proband's family;

[0030] Figure 2 This is the pedigree of the proband;

[0031] Figure 3 The protein structure changes and visualization analysis diagrams caused by the PKP2 gene c.498C>G site mutation and the KCNA5 gene c.1727C>T site mutation;

[0032] Figure 4 The kit of the present invention verifies the sequencing results. DETAILED DESCRIPTION

[0033] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0034] Example

[0035] A male patient: A dynamic electrocardiogram examination in an external hospital showed: paroxysmal sinus bradycardia, ventricular premature beats, short bursts of ventricular tachycardia, and ST-T changes. Emergency cardiac color Doppler ultrasound showed that the left ventricular end-diastolic diameter was 55mm and the ejection fraction was 39%. The preliminary diagnosis was arrhythmia-related cardiomyopathy. The patient's external hospital examination of coronary angiography and thyroid function showed no abnormalities. The patient's parents were healthy and denied consanguineous marriage and family history of genetic diseases. The patient is an only child, and his cousins ​​currently have no similar clinical manifestations. The patient has one son and one daughter, both of whom are in good health.

[0036] The results of whole exome sequencing showed that the proband had PKP2 c.498C>G (p.Tyr166*) heterozygous mutation and KCNA5 c.1727C>T (p.Ala576Val) heterozygous mutation; the proband's father had PKP2 c.498C>G (p.Tyr166*) heterozygous mutation, and the KCNA5 gene was wild type; the proband's mother and daughter had KCNA5 c.1727C>T (p.Ala576Val) heterozygous mutation, and the PKP2 gene was wild type; the proband's son had PKP2 c.498C>G (p.Tyr166*) heterozygous mutation. The sequencing results of the PKP2 gene c.498C site and the KCNA5 gene c.1727C site in the proband's family are as follows Figure 1 The proband's pedigree is shown in Figure 2 shown.

[0037] The pathogenicity of these two variant sites was evaluated according to the guidelines of the American College of Medical Genetics and Genomics (ACMG): the result was possible pathogenicity. The combined heterozygous variants of PKP2 c.498C>G (p.Tyr166*) and KCNA5 c.1727C>T (p.Ala576Val) are the main causes of arrhythmogenic right ventricular cardiomyopathy.

[0038] Therefore, it was preliminarily concluded that the proband had arrhythmogenic right ventricular cardiomyopathy due to the combined heterozygous variants of PKP2 c.498C>G (p.Tyr166*) and KCNA5c.1727C>T (p.Ala576Val).

[0039] Pathogenicity assessment of the PKP2 gene c.498C>G site variant and the KCNA5 gene c.1727C>T site variant:

[0040] The PKP2 c.498C>G (p.Tyr166*) mutation causes the PKP2 protein to be truncated at amino acid 166 and terminate translation. The calculation result of the MutationTaster database is pathogenic. Visual analysis shows that the protein is truncated after the mutation. The truncated protein has 5 α-helical structures and 5 disordered loop regions, which is significantly different from the mutant protein structure (see Figure 3 Left). The KCNA5c.1727C>T (p.Ala576Val) mutation caused the replacement of alanine at position 576 of the KCNA5 protein with valine. The MutationTaster database calculated that it was pathogenic. Visual analysis showed that there was an interaction between amino acid 576 of the wild-type protein and the surrounding amino acids. The valine at position 576 of the mutant protein lost its interaction with the surrounding amino acids (see Figure 3 Right). Changes in protein structure affect protein function and thus cause disease.

[0041] Candidate pathogenicity site detection:

[0042] This embodiment provides a kit for detecting two SNP sites in the exon region of the PKP2 and KCNA5 genes. The kit can be used for rapid diagnosis of arrhythmogenic right ventricular cardiomyopathy and screening of arrhythmogenic right ventricular cardiomyopathy carriers through human whole blood genome PCR reaction, Sanger sequencing and analysis.

[0043] Reagents: This kit includes PCR primers for amplifying two SNP sites and one Indel, 2× Master Mix (CWbio), ddH2O

[0044] This kit includes two SNP sites (SNP1-2), and their corresponding genomic positions, base changes, amino acid changes, and mutation types are shown in Table 1 below:

[0045] Table 1 SNP site information

[0046] Variant site Genomic location Reference transcript Base changes Amino acid changes Mutation type SNP1 chr12:33031316 NM_001005242.2 c.498C>G Tyr166Ter Misunderstanding SNP2 chr12:5155040 NM_002234.4 c.1727C>T Ala576Val Misunderstanding

[0047] The reference genome is Human GRCh37 / hg19, the PKP2 genome position is chr12:32,943,679-33,049,774, and the reference transcript number is NM_001005242.2; the KCNA5 genome position is Chromosome 12:5,153,085-5,155,949, and the reference transcript number is NM_002234.4.

[0048] This example provides PCR primers for amplifying the gene fragments of these two variant sites, as shown in Table 2 below:

[0049] Table 2 Primer information

[0050]

[0051]

[0052] SNP1 (after mutation):

[0053] GACTGGAGATTTCTCCTGACAGCAGCCCGGAGAGGGCTCACTACACGCACAGCGATTA GCAGTACAGCCAGAGAAGCCAGGCTGGGCACACCCTGCACCACCAAGAAAGCAGGCGGGCCGCCCTCCTAGTGCCACCGAGATATGCTC, as shown in SEQ ID NO.5.

[0054] SNP2 (after mutation):

[0055] CTGGACAGAGGAGTCCAGCGGAAGGTCAGCGGGAGCAGGGGATCCTTCTGCAAGGCTGGGGGGACCTGGAGAATGCAGACAGTG T CCGAAGGGGCAGCTGCCCCTAGAGAAGTGTAACGTCAAGGCCAAGAGCAACGTGGACTTGCGGAGGT, as shown in SEQ ID NO. 6.

[0056] The underlined ones are the mutation sites.

[0057] The amplification system for detection was as follows: 10-100 ng peripheral blood genomic DNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 12.5 μL PCR Taq Mix (Tiangen), and the rest was supplemented with ddH2O to 25 μL.

[0058] Amplification conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 62°C for 25 s, extension at 72°C for 25 s, enhanced extension at 72°C for 5 min, denaturation annealing-extension set for 35 cycles. Prepare 1.5% agarose gel, take 2 μL of PCR product and run DNA gel electrophoresis to detect whether amplification is successful. The DNA sequence of the PCR product was detected by Sanger sequencing, and the results are shown in 4.

[0059] Interpretation of results:

[0060] 1. Conventional PCR technology was used to amplify the peripheral blood genomic DNA of the proband and his parents, and the fragments containing SNP1 and SNP2 were amplified. Sanger sequencing showed that the proband was a combined heterozygous variation of SNP1 and SNP2, the father was a SNP1 carrier, and the mother was a SNP2 carrier.

[0061] 2. The present invention analyzes the whole exome data of 340 families with genetic diseases and uses Sanger sequencing for verification. The results show that there are 6 families carrying the SNP1 locus alone; there are 3 families carrying the SNP2 locus alone, and there are 2 families carrying both the SNP1 and SNP2 loci. Using the kit for detection, the combined heterozygous carrying the SNP1 and SNP2 loci were clinically diagnosed as arrhythmogenic right ventricular cardiomyopathy. At the same time, the children born to the probands carried the SNP1 or SNP2 loci respectively, and all showed symptoms of arrhythmogenic right ventricular cardiomyopathy during follow-up, and were determined to be carriers of SNP1 or SNP2.

[0062] 3. Interpretation of the correlation between genotype and phenotype

[0063] a. Those who carry any heterozygous variant of SNP1 or SNP2 are carriers;

[0064] b. Patients with homozygous mutations in either SNP1 or SNP2 are patients with arrhythmogenic right ventricular cardiomyopathy;

[0065] c. Patients who carry the combined heterozygous variants of SNP1 and SNP2 are patients with arrhythmogenic right ventricular cardiomyopathy.

[0066] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP marker associated with arrhythmogenic right ventricular cardiomyopathy, characterized in that: Includes PKP2c.498 and / or KCNA5 c.1727; The mutation type of PKP2 c.498 is C>G The mutation type of KCNA5 c.1727 is C>T.

2. A primer set for amplifying the SNP marker according to claim 1, characterized in that: including primer pair 1 and primer pair 2; The nucleotide sequences of the primer pair 1 are shown in SEQ ID NO.1 and SEQ ID NO.2; The nucleotide sequences of the primer pair 2 are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. Use of the SNP marker according to claim 1 in the preparation of a diagnostic product for arrhythmogenic right ventricular cardiomyopathy.

4. Use of the SNP marker according to claim 1 in preparing a product for assessing the risk of arrhythmogenic right ventricular cardiomyopathy.

5. Use of the primer set according to claim 2 in preparing a diagnostic product for arrhythmogenic right ventricular cardiomyopathy.

6. Use of the primer set according to claim 2 in preparing a product for assessing the risk of arrhythmogenic right ventricular cardiomyopathy.

7. A kit for in vitro diagnosis of arrhythmogenic right ventricular cardiomyopathy, characterized in that: A detection reagent comprising amplifying the SNP marker according to claim 1.

8. A kit for in vitro diagnosis of arrhythmogenic right ventricular cardiomyopathy, characterized in that: Contains the primer set according to claim 2.

9. A kit for in vitro diagnosis of arrhythmogenic right ventricular cardiomyopathy, characterized in that: A detection reagent comprising an amplified mutant target sequence 1 and an amplified mutant target sequence 2; The nucleotide sequence of the mutant target sequence 1 is shown in SEQ ID NO.5; The nucleotide sequence of the mutant target sequence 2 is shown in SEQ ID NO.

6.

10. Use of the kit according to any one of claims 7 to 9 in the preparation of a product for assessing the risk of arrhythmogenic right ventricular cardiomyopathy.

Images