Use of circbco2 as a drug target and prognostic marker for liver cancer

Abstract

The present disclosure provides a new therapeutic target and marker, circBCO2, for inhibiting the progression of liver cancer, especially hepatocellular carcinoma. Inhibition of the expression of circBCO2 or destruction of the signal pathway regulated thereby can serve as a potential therapeutic target for inhibiting the progression of liver cancer. Meanwhile, circBCO2 can also serve as a marker, especially a prognostic marker, for HCC.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and particularly relates to application of circBCO2 as a drug target and marker for liver cancer. BACKGROUND

[0002] Hepatocellular carcinoma (HCC) is considered the third leading cause of cancer-related death worldwide. The asymptomatic nature of HCC often leads to late-stage diagnosis, which greatly limits the choice of curative treatment. Despite the progress in surgery and systemic therapy, the overall survival (OS) of HCC patients remains frustratingly low. Therefore, discovering new therapeutic targets and understanding their molecular mechanisms are crucial for prolonging the overall survival of HCC patients.

[0003] Circular RNAs (circRNAs) are unique RNA structures formed by reverse splicing of exons, introns, non-translated or antisense sequences. Compared with linear RNAs, circRNAs have a covalent closed-loop structure, which endows them with extraordinary stability, enabling them to resist degradation by external ribonucleases. The inherent stability of circRNAs enables them to perform important functions in various biological processes, particularly in the progression of cancer. CircRNAs can effectively regulate gene expression, and the most common way that circRNAs promote cancer development and progression is that they interact with key components of major signaling pathways. Emerging evidence emphasizes the involvement of circRNAs in tumorigenesis of various cancers, including HCC. A large body of evidence supports the association of circRNAs with the progression of human diseases through their interaction with signaling pathways, and the potential of their biomarkers has been proven by studies. In particular, circRNAs are often shown to intervene in tumor proliferation, migration, invasion, and metastasis, indicating their potential as diagnostic biomarkers and therapeutic targets. Therefore, there is an urgent need to develop new circRNAs as novel therapeutic targets and prognostic markers in HCC. SUMMARY

[0004] The present disclosure provides a new therapeutic target and marker circBCO2 for inhibiting the progression of liver cancer, particularly hepatocellular carcinoma, which drives the progression of liver cancer by inhibiting the downstream miR-590-5p / LANCL1 / ROS signaling pathway. Inhibition of the expression of circBCO2 or disruption of the signaling pathway it regulates can serve as a new potential therapeutic target for inhibiting the progression of HCC. Meanwhile, circBCO2 can also serve as a marker for HCC.

[0005] According to one aspect of the present disclosure, a drug target for preventing and / or treating liver cancer is provided, which comprises circBCO2.

[0006] In some embodiments, the circBCO2 drives the progression of liver cancer by inhibiting downstream miR-590-5p, LANCL1 and / or ROS signaling pathways.

[0007] In some embodiments, the liver cancer comprises hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0008] According to another aspect of the present disclosure, there is provided a method of screening a drug for preventing and / or treating lung cancer, wherein the method comprises screening the drug using the drug according to the present disclosure as a target.

[0009] In some embodiments, the liver cancer comprises hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0010] In some embodiments, the drug further comprises other active ingredients for preventing and / or treating liver cancer, including but not limited to, multi-target tyrosine kinase inhibitors (e.g., lenvatinib, regorafenib, sorafenib, etc.), VEGFR antagonists (e.g., apatinib, axitinib, etc.), VEGF / VEGFR mAbs (e.g., bevacizumab, ramucirumab, etc.).

[0011] In some embodiments, the drug further comprises a pharmaceutically acceptable excipient.

[0012] In some embodiments, the pharmaceutically acceptable excipient comprises at least one of a diluent, an excipient, a binder, a wetting agent, a surfactant, a lubricant, a disintegrant.

[0013] In some embodiments, the dosage form is selected from a gastrointestinal administration dosage form, or a non-gastrointestinal administration dosage form.

[0014] In some embodiments, the gastrointestinal administration dosage form comprises at least one of a powder, a tablet, a granule, a capsule, a sustained-release agent, a solution, a dry suspension, an effervescent tablet, an emulsion, a suspension, a syrup, a drop, a chewable tablet.

[0015] In some embodiments, the non-gastrointestinal administration dosage form comprises at least one of an injection administration dosage form, a respiratory administration dosage form, a skin administration dosage form, a mucosal administration dosage form, a cavity administration dosage form.

[0016] In some embodiments, the subject of administration of the drug is an animal.

[0017] According to yet another aspect of the present disclosure, there is provided a circBCO2 inhibitor, which comprises a substance that inhibits expression of circBCO2, inhibits activity of circBCO2, reduces content of circBCO2, silences, knocks down or knocks out a circBCO2 gene, or disrupts a signal pathway regulated by circBCO2.

[0018] In some embodiments, the signal pathway regulated by circBCO2 comprises a miR-590-5p, LANCL1 and / or ROS signal pathway.

[0019] In some embodiments, the circBCO2 inhibitor comprises at least one of a small molecule compound, a peptide, a peptidomimetic, a matrix analogue, an aptamer, an antibody, a dsRNA, a shRNA, a microRNA, a siRNA, a sgRNA.

[0020] In some embodiments, the circBCO2 inhibitor comprises a shRNA, preferably the shRNA has a sequence as set forth in SEQ ID NO: 1.

[0021] According to yet another aspect of the present disclosure, there is provided use of the circBCO2 inhibitor of the present disclosure in the manufacture of a medicament for preventing and / or treating liver cancer.

[0022] In some embodiments, the liver cancer comprises hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0023] According to yet another aspect of the present disclosure, there is provided a marker for liver cancer, which comprises circBCO2.

[0024] In some embodiments, the liver cancer comprises hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0025] In some embodiments, the marker comprises a prognostic marker.

[0026] According to yet another aspect of the present disclosure, there is provided use of the marker of the present disclosure in the manufacture of a product for diagnosing and / or prognosing liver cancer.

[0027] In some embodiments, the liver cancer comprises hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0028] In some embodiments, the product comprises a substance that detects the marker of the present disclosure at a genetic level and / or a protein level.

[0029] In some embodiments, the substance comprises a substance for at least one detection technique or method selected from the group consisting of immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance, immuno-PCR, biotin-avidin.

[0030] In some embodiments, the immunohistochemistry comprises at least one of enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, co-immunoprecipitation, immunochemiluminescence, colloidal gold immunotechnology, fluorescent immunochromatography, complement fixation assay, flow cytometry fluorescence resolution, single molecule detection technology.

[0031] In some embodiments, the substance comprises at least one of a substance specific to circBCO2, a probe specific to circBCO2, a gene chip, a protein chip, a primer specific to circBCO2.

[0032] In some embodiments, the substance specific to circBCO2 comprises at least one of an antibody specific to circBCO2, a ligand protein or polypeptide specific to circBCO2, a non-protein compound specific to circBCO2, or a nucleic acid aptamer specific to circBCO2; preferably, the product comprises a reagent, a detection plate, a test paper, a device, a system, a kit, a chip, or a nucleic acid membrane strip.

[0033] In some embodiments, the product further comprises other substances for detecting diagnosis and / or prognosis evaluation of liver cancer;

[0034] Preferably, the product further comprises a gene expression auxiliary detection reagent comprising at least one of a reaction reagent for visualizing an amplicon corresponding to a primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard for preparing a standard curve, a positive control.

[0035] In some embodiments, the product further comprises a protein expression auxiliary detection reagent comprising at least one of a color developing agent, a blocking solution, an antibody diluent, a washing buffer, a color developing termination solution, a standard for preparing a standard curve, a positive control.

[0036] In some embodiments, the sample of the product is selected from at least one of a body fluid, a tissue, a cell, an excretion of a subject to be tested.

[0037] In some embodiments, the subject to be tested comprises an animal.

[0038] According to yet another aspect of the present disclosure, there is provided a product for diagnosing and / or prognosing liver cancer, the product comprising a substance for detecting the marker of the present disclosure at the genetic level and / or the protein level.

[0039] In some embodiments, the product comprises a substance for detecting the marker of the present disclosure at the genetic level and / or the protein level.

[0040] In some embodiments, the substance comprises a substance for at least one detection technique or method selected from the group consisting of immunohistochemistry, Western blotting, Northern blotting, PCR, biochip method, nucleic acid sequencing method, amino acid sequencing method, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance technique, immuno-PCR technique, biotin-avidin technique.

[0041] In some embodiments, the immunohistochemistry comprises at least one of enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, immunoprecipitation, immunochemiluminescence, colloidal gold immunotechnology, fluorescent immunochromatography, complement fixation assay, flow cytometry fluorescence resolution, single molecule detection technique.

[0042] In some embodiments, the substance comprises at least one of a substance specific to circBCO2, a probe specifically recognizing circBCO2, a gene chip, a protein chip, a primer specifically amplifying circBCO2.

[0043] In some embodiments, the substance specific to circBCO2 comprises at least one of an antibody specifically binding to circBCO2, a ligand protein or polypeptide specifically binding to circBCO2, a non-protein compound specifically recognizing circBCO2, or a nucleic acid aptamer specifically recognizing circBCO2; preferably, the product comprises a reagent, a detection plate, a test paper, a device, a system, a kit, a chip, or a nucleic acid membrane strip.

[0044] In some embodiments, the product further comprises other substances for detecting diagnosis and / or prognostic evaluation of liver cancer;

[0045] Preferably, the product further comprises a gene expression amount auxiliary detection reagent comprising at least one of a reaction reagent for visualizing an amplicon corresponding to a primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard for preparing a standard curve, a positive control.

[0046] In some embodiments, the product further comprises a protein expression amount auxiliary detection reagent, which includes at least one of a color developing agent, a blocking solution, an antibody diluent, a washing buffer, a color developing termination solution, a standard for preparing a standard curve, and a positive control.

[0047] In some embodiments, the sample of the product is selected from at least one of a body fluid, a tissue, a cell, and excrement of a subject to be tested.

[0048] In some embodiments, the subject to be tested comprises an animal.

[0049] According to yet another aspect of the present disclosure, a system for diagnosing and / or prognosing liver cancer is provided, which comprises:

[0050] a detection component: the detection component is used for detecting the marker of the present disclosure at a gene level and / or a protein level;

[0051] a result judging component: the result judging component is used for outputting a diagnosis and / or prognosis result according to the result of the marker detected by the detection component.

[0052] The present disclosure first discovers that the circular RNA circBCO2 is a new potential therapeutic target and marker, especially a prognosis marker, for inhibiting the progression of hepatocellular carcinoma in liver cancer. Inhibiting the expression of circBCO2 or destroying the signal pathway regulated thereby can be used as a therapeutic target for inhibiting the progression of liver cancer; meanwhile, circBCO2 can also be used as a prognosis marker for diagnosing liver cancer. BRIEF DESCRIPTION OF DRAWINGS

[0053] Figure 1 The screening results of differentially expressed circRNAs in hepatocellular carcinoma are shown. Among them, A, a heat map shows the differentially expressed circular RNAs in six cases of HCC and adjacent non-tumor tissues, and the red arrow indicates circBCO2. (adjacent tissues: peritumoral tissues; tumor tissues: cancer tissues). B, a volcano plot shows 259 up-regulated and 277 down-regulated circular RNAs in HCC tissues compared with matched normal tissues, and the blue arrow indicates circBCO2.

[0054] Figure 2The expression level of circBC02 in HCC and its relationship with overall survival rate are shown. Among them, A, the expression of circBC02 in clinical samples is low in adjacent tissues and high in cancer tissues (adjacent: adjacent tissue; tumor: cancer tissue). B, the expression of circBC02 in different cell lines is low in normal cells and high in liver cancer cells (LO2: human normal liver cells; Huh7, Hep3B, HepG2, SK: liver cancer cell lines). C, the overall survival rate of hepatocellular carcinoma patients constructed by clinical follow-up data, the prognosis of patients with high expression level of circBC02 is worse.

[0055] Figure 3 It is shown that the inhibition of liver cancer progression by knocking down circBC02. Among them, A, the proliferation ability of shRNA circBC02 cells is significantly reduced compared with the control group (sh-NC group). B, the cell scratch experiment shows that the migration ability of shRNA circBC02 cells is significantly reduced compared with the control group (sh-NC group). Scale bar: 50 μm. C, cell transwell experiment shows that the migration and invasion ability of shRNA circBC02 cells is significantly reduced compared with the control group (sh-NC group). Scale bar: 50 μm. D, mouse liver H&E staining shows that the tumor growth of orthotopic model mice is inhibited after circBC02 knockdown treatment compared with the control group (sh-NC group). Scale bar: 100 μm. E, mouse liver proliferation indicator (Ki67) staining shows that the number of cell proliferation of orthotopic model mice is significantly reduced after circBC02 knockdown treatment compared with the control group (sh-NC group). Scale bar: 100 μm.

[0056] Figure 4 It is shown that the recovery of HCC progression using circBC02 regulated downstream signaling pathway key gene inhibitors or exogenous proteins. Among them, A-B, the proliferation and migration ability of cells co-incubated with circBC02 downstream pathway key gene inhibitors and exogenous proteins is significantly higher than that of the control group (sh-circBC02 group). C, the tumor growth curve of mouse subcutaneous model shows that after stimulation with circBC02 downstream pathway key gene inhibitors and exogenous proteins, the proliferation ability of tumor is reversed and significantly higher than that of the control group (sh-circBC02 group). D, tumor size picture of mouse subcutaneous model. E, tumor weight statistics chart of mouse subcutaneous model, after stimulation with circBC02 downstream pathway key gene inhibitors and exogenous proteins, the proliferation ability of tumor is reversed and significantly higher than that of the control group (sh-circBC02 group). DETAILED DESCRIPTION

[0057] The present disclosure provides a new potential therapeutic target and prognostic marker circBCO2 for inhibiting the progression of hepatocellular carcinoma, which drives the progression of HCC by inhibiting the downstream miR-590-5p / LANCL1 / ROS signaling pathway.

[0058] The present disclosure screens the differentially expressed circBCO2 through sequencing of HCC clinical samples, and analyzes the expression level of circBCO2 in HCC patients and its influence on survival rate.

[0059] The present disclosure uses shRNA circBCO2 to obtain a stable-transfected hepatoma cell line in which circBCO2 is knocked down, and studies the development of HCC in the shRNA circBCO2 stable-transfected cell line under in vivo and in vitro conditions.

[0060] The present disclosure also uses inhibitors of key genes in the downstream signaling pathway regulated by circBCO2 or exogenous proteins to study the improvement of HCC by circBCO2 in vivo and in vitro.

[0061] Example 1 Sequencing and screening of differentially expressed circRNAs in hepatocellular carcinoma

[0062] To explore the differentially expressed circRNAs in hepatocellular carcinoma (HCC), tissue samples from 6 patients with hepatocellular carcinoma (4 males and 2 females) were collected. These patients also underwent primary HCC resection and had not received preoperative treatment. The 6 human samples used in this example were from the Sun Yat-sen University Center for Cancer Prevention and Treatment (SYSUCC), and all participants provided written informed consent. Total RNA was isolated and purified by TRIzol reagent. To enrich circular RNA, DNA was removed by DNase I, and linear RNA was removed by RNase r. The library was constructed using the MGI Easy rRNA Removal Kit (1000005953, MGI) and the MGI Easy RNA Directional Library Preparation Reagent Kit (1000006386, MGI). Specifically, after linear RNA was removed by Poly A capture, the first strand of cDNA was synthesized using random oligonucleotides as primers in the M-MuLV reverse transcriptase system. Then, dUTP was used to replace dTTP during the synthesis of the second strand. After linker ligation, the synthesized second strand was degraded by UDG enzyme, leaving only the first strand of cDNA with different sequence adapters at both ends for subsequent PCR amplification. Finally, the library was obtained.

[0063] Deep sequencing of circRNAs was performed on the Illumina HiSeq4000 platform, and the raw data was processed by FastQC to ensure data quality. Sequences were mapped to the reference genome by BWA software. Then, circRNA identification was performed using CIRI software. Finally, bioinformatics analysis was performed, and the differentially expressed circRNAs that were significantly up-regulated were finally screened out, namely circBC02.

[0064] The heatmap result in the analysis result shows the differentially expressed circRNAs in the six HCC samples and their adjacent non-tumor tissues, and the red arrow represents the discovered differentially expressed circRNA-circBC02 Figure 1 A). At the same time, the volcano plot also shows the differentially expressed circRNAs in the HCC tissues, and the blue arrow indicates circBC02 Figure 1 B).

[0065] Example 2 Expression level of circBC02 in HCC and its influence on overall survival rate

[0066] To verify the expression of circBC02 in hepatocellular carcinoma and its influence on survival rate, the HCC clinical tissue samples (the human samples used in this example are from Sun Yat-Sen University Center for Cancer Prevention and Treatment (SYSUCC), and all participants have provided written informed consent) and different hepatocellular carcinoma cell lines Huh7 cells, Hep3B cells, HepG2 cells and SK cells collected were subjected to quantitative analysis (human liver normal cell line L02 was used as a control). First, total RNA was extracted from clinical tissues and HCC cells using TRIzol reagent. Then, 1 μg of RNA was converted to cDNA using PrimeScript RT Reagent Kit (RR047A, TaKaRa). Quantitative detection was performed using circRNA PCR primers (F: CTTCACCAGTTCAGAATCCA (SEQ ID NO: 4); R: CTCAAACCTGGACATG (SEQ ID NO: 5)), and survival curve was plotted for the clinical follow-up data of the patients of the HCC tissues collected in this example.

[0067] In the quantitative results, it was found that the expression of circBC02 in the clinical tissue samples showed a trend of high expression compared to the control paracancerous tissues Figure 2 A), and the expression in the hepatoma cell lines also showed a trend of high expression compared to the control normal cell lines, indicating that circBC02 was highly expressed in cancer Figure 2 B).

[0068] The impact of circBCO2 on overall survival rate was plotted by clinical follow-up data. The overall survival curve proved that high expression of circBCO2 was associated with poor prognosis (C), confirming that circBCO2 plays a pro-cancer role in hepatocellular carcinoma, suggesting that circBCO2 can be used as a prognostic marker for hepatocellular carcinoma. Figure 2 C), confirming that circBCO2 plays a pro-cancer role in hepatocellular carcinoma, suggesting that circBCO2 can be used as a prognostic marker for hepatocellular carcinoma.

[0069] Example 3 Inhibition of HCC progression after knockdown of circBCO2

[0070] 1. In vitro experiment

[0071] To study the effect of circBCO2 changes on HCC progression, in the in vitro experiment, the present embodiment knocked down circBCO2 in liver cancer cells and constructed a stable cell line. First, according to the circBCO2 loop (SEQ ID NO: 2) sequence, the corresponding RNA interference fragment (shRNA circBCO2: TTTATCAGGTACAATCATTGG (SEQ ID NO: 1) was designed, and a pHBLVCMVIE-Puro lentivirus vector was constructed. Subsequently, the lentivirus was packaged and transfected into Huh7 cell lines. After 48 h of transfection, the cells were cultured in DMEM medium (C11995500BT, Gibco) for 3 days, and one week later, puromycin was used for screening to eliminate untransfected cells to obtain a stable cell line sh-circBCO2. At the same time, a control cell line sh-NC was constructed according to the same method, wherein the sh-NC sequence is UAAGGCUAUGAAGAGAUAC (SEQ ID NO: 3).

[0072] The circBCO2 loop (SEQ ID NO: 2) sequence is:

[0073] GTACAATCATTGGTTTGATGGGATGGCGCTGCTTCACCAGTTCAGAATGGCAAAGGGCACAGTGACATACAGGAGCAAGTTTCTACAGAGTGATACATATAAGGCCAACAGTGCTAAAAACCGAATTGTGATCTCAGAATTTGGCACACTGGCTCTCCCGGATCCATGCAAGAATGTTTTTGAACGTTTCATGTCCAGGTTTGAGCTGCCTGGTAAAGCTGCAGCCATGACTGACAATACTAATGTCAACTATGTGCGGTACAAGGGTGATTACTACCTCTGCACTGAGACCAACTTTATGAATAAAGTGGACATTGAAACTCTGGAAAAAACAGAAAAGGTAGATTGGAGCAAATTTATTGCTGTGAATGGAGCAACTGCACATCCTCATTATGACCTGGATGGAACAGCATACAATATGGGGAACTCCTTTGGGCCATATGGTTTCTCCTATAAGGTTATTCGGGTTCCTCCAGAGAAGGTGGACCTTGGGGAGACAATCCATGGAGTCCAGGTGATATGTTCTATTGCTTCTACAGAGAAAGGGAAACCTTCTTACTACCATAGCTTTGGAATGACAAGGAACTATATAATTTTCATTGAACAACCTCTAAAGATGAACCTGTGGAAAATTGCCACTTCTAAAATTCGGGGAAAGGCCTTTTCAGATGGGATAAGCTGGGAACCCCAGTGTAATACGCGGTTTCATGTGGTGGAAAAACGCACTGGACAGCTCCTTCCAGGGAGATACTACAGCAAACCTTTTGTTACATTTCATCAAATCAATGCCTTTGAGGACCAGGGCTGTGTTATAATTGATTTGTGCTGTCAAGATAATGGAAGAACCCTAGAAGTTTACCAGTTACAGAATCTCAGGAAGGCTGGGGAAGGGCTTGATCAG.

[0074] Subsequently, the effect of circBC02 on HCC was detected by cck-8, scratch experiment, and transwell experiment. Specifically as follows:

[0075] The proliferation of Huh7 and Hep3B cells was detected by ccK-8. 10 μL ccK-8 reagent (CK04, Dojindo) was added to Huh7 and Hep3B cells in a 96-well plate and incubated at 37°C for 1 h. The absorbance (450 nm) was measured by a microplate reader to evaluate cell proliferation. The results are shown in Figure 3 A.

[0076] The migration ability of Huh7 and Hep3B cells was determined by scratch assay. 4 x 10 5 After 48 h of cell implantation in a six-well plate, a uniform lesion was formed by a pipette tip that was scratched. The cells were cultured in DMEM, and the wound was imaged at 0 and 24 h. The results are shown in Figure 3 B.

[0077] The invasion and migration abilities of Huh7 and Hep3B cells were evaluated by Transwell assay. 100 μL Huh7 and Hep3B cell suspension (4 x 10 5 cells / mL) was placed in the upper chamber, and 500 μL DMEM medium was added to the lower chamber to keep the liquid levels uniform. After 24 h, the cells were stained with crystal violet. In the invasion experiment, 100 μL Matrigel was pre-coated in the lower chamber for 30 min, and then the medium was added, followed by the placement of 100 μL Huh7 and Hep3B cell suspension (4 x 10 5 cells / mL) in the upper chamber. The lower chamber was inserted to keep the liquid levels uniform. After 24 h, the cells were stained with crystal violet. An inverted fluorescence microscope (Leica, Germany) was used to capture and quantify the migrated cells. The results are shown in Figure 3 C.

[0078] Figure 3 The results of A-3C show that the knockdown of circBCO2 significantly inhibited the proliferation, migration, and invasion abilities of tumors compared with the control group.

[0079] 2. In vivo experiment

[0080] An orthotopic liver cancer model of mice was constructed, and 8-week-old female nude mice were randomly divided into two groups. 1) Orthotopic liver cancer model + sh-NC group, 2) Orthotopic liver cancer model + sh-circBCO2 group. Before the operation, 1.25% afluoridine solution was injected intraperitoneally, and the mice were anesthetized and fixed according to the mouse weight of 200 μL / 25 mg. Huh7 cells (sh-circBCO2 cells and sh-NC cells prepared in the foregoing in vitro experiment of this example) were injected into the tail vein of the mice, and the injection amount was 2.5 x 10 6 cells, thereby constructing an orthotopic liver cancer model.

[0081] After 2 weeks, the mice were sacrificed according to the results of the live imaging. The mice were anesthetized by intraperitoneal injection of 1.25% afluoron solution at a dose of 200 μL / 25 mg of body weight, and then the tissues were collected and the sections were prepared. The mouse liver tissue sections were subjected to H&E staining and proliferation-specific staining (Ki67) as follows:

[0082] In the HE staining, the obtained tissue sections were first deparaffinized, then the sections were placed in hematoxylin for 3 minutes, then rinsed with running water for 30 minutes, then dehydrated with alcohol, then placed in eosin for 3 minutes, and finally dehydrated with alcohol and xylene transparent, and then sealed for imaging. The results are shown in Figure 3

[0083] In the proliferation-specific staining, the obtained tissues were fixed with formalin, embedded with paraffin, and subjected to IHC. Briefly, the embedded tissues were deparaffinized and hydrated, and the samples were subjected to high-temperature antigen retrieval. The Ki67 primary antibody (ab15580, Abeam) was incubated overnight at 4°C. After incubation with the specific secondary antibody (DAB kit) the next day, the DAB peroxidase substrate kit (K5007, Dako) was used. After DAPI (Invitrogen) was used for nuclear staining, neutral resin was used for sealing and imaging. The results are shown in Figure 3

[0084] Figure 3 The results of Figures D and 3E show that compared with the control group, knockdown of circBCO2 significantly inhibited the proliferation, migration and invasion ability of the tumor. It is confirmed that circBCO2 plays a pro-cancer role in hepatocellular carcinoma, suggesting that it can be used as a new potential therapeutic target for hepatocellular carcinoma.

[0085] Example 4: Effect of inhibitors of key genes in downstream signaling pathways regulated by circBCO2 or exogenous proteins on HCC progression

[0086] 1. In vitro experiment

[0087] ​​To verify that circBCO2 can serve as a novel therapeutic target for hepatocellular carcinoma (HCC), this embodiment knocked down HCC cells and constructed a stable cell line (same as in Example 3). The stable cell line with circBCO2 knockdown was co-incubated with hsa-miR-590-5p antagonist (miR30003258-4-5, purchased from RiboBio) (20 nM), recombinant LANCL1 protein (CSB-EP012742HU, purchased from CUSABIO) (4 μg / mL) and RAC1 inhibitor (HY-115376, purchased from MCE) (100 μM). Subsequently, the effect of circBCO2 on the regulation of HCC progression was confirmed by using CCK-8 and Transwell assays (experimental methods same as in Example 3).

[0088] cck-8( Figure 4 A) and transwell experiment ( Figure 4 Results B) confirmed that after circBCO2 expression was downregulated, cells co-incubated with inhibitors of key genes in the downstream pathway of circBCO2 or exogenous proteins showed significantly higher proliferation and migration abilities than the control group. Figure 4 (A and 4B). sh-circBCO2 showed a good inhibitory effect on HCC progression.

[0089] 2. In vivo experiments

[0090] In this embodiment, a subcutaneous tumor model was constructed using 8-week-old BALB / c mice. Before surgery, mice were anesthetized and restrained by intraperitoneal injection of 1.25% aflutidine solution at a dose of 200 μL / 25 mg of body weight. A needle was inserted into the axilla, parallel to the subcutaneous tissue. After the needle reached the axilla, Huh7 cells were injected at a dose of 1 × 10⁻⁶ cells. 6 Cells were used to construct a subcutaneous tumor model.

[0091] Mice were randomly divided into 4 groups.

[0092] 1) sh-circBCO2 group: treated with a stable cell line of circBCO2 knockdown constructed according to the method in Example 3.

[0093] 2) sh-circBCO2+hsa-miR-590-5p antagonist group: Stable cell lines with circBCO2 knockdown were treated with 20 nM hsa-miR-590-5p antagonist.

[0094] 3) sh-circBCO2+ recombinant LANCL1 proteome: Stable cell lines with circBCO2 knockdown were treated with 4 μg / mL recombinant LANCL1 protein after co-incubation.

[0095] 4) sh-circBCO2+RAC1 inhibitor group: stable cell lines with circBCO2 knockdown were co-incubated with 100 μM RAC1 inhibitor antagonist and then treated.

[0096] Subcutaneous tumor model is a model for rapid detection of tumor generation in vivo. In the established subcutaneous tumor model, 300 μL of cell suspension (1 x 106 cells) was subcutaneously injected into the armpit of mice, and the tumor size was measured at the same interval of time and the growth curve was plotted. Figure 4 C), 28 days after the result of in vivo imaging, 1.25% afluoron solution was injected into the abdominal cavity before operation, the mice were anesthetized according to the mouse weight 200 μL / 25 mg dose, and then the sample was taken, the tumor mass formed was taken out, and the general morphology examination Figure 4 D) and weighing Figure 4 E) were performed.

[0097] Figure 4 C- Figure 4 The experimental results of E prove that after using the inhibitors of key genes in the downstream pathway of circBCO2 and exogenous protein stimulation, the proliferation and migration ability of the tumor is reversed and significantly higher than that of the control group. The above results confirm that circBCO2 can be used as a new potential therapeutic target for hepatocellular carcinoma.

[0098] The technical solutions of the present application are not limited to the above specific embodiments, and any technical variations made according to the technical solutions of the present application fall within the protection scope of the present application.

Claims

1. A method for screening drugs for the prevention and / or treatment of liver cancer, wherein the method includes screening the drugs using a drug target; the drug target includes circBCO2 with a sequence as shown in SEQ ID NO: 2; The liver cancer mentioned is hepatocellular carcinoma.

2. Use of circBCO2 inhibitors in the preparation of medicaments for the prevention and / or treatment of liver cancer; The liver cancer mentioned is hepatocellular carcinoma; The sequence of circBCO2 is shown in SEQ ID NO: 2; The circBCO2 inhibitor includes shRNA; The shRNA has the sequence shown in SEQ ID NO:

1.

3. The use according to claim 2, characterized in that, The drug also contains other active ingredients for the prevention and / or treatment of liver cancer.

4. The use according to any one of claims 2-3, characterized in that, The drug also contains pharmaceutically acceptable excipients.

5. The use according to claim 4, characterized in that, The pharmaceutically acceptable excipients include at least one of diluents, excipients, binders, humectants, surfactants, lubricants, and disintegrants.

6. The use according to any one of claims 2-3, characterized in that, The drug is in the form of an injectable dosage form.

7. The use according to any one of claims 2-3, characterized in that, The drug is administered to animals.

8. The use of biomarkers in the preparation of products for the diagnosis and / or prognosis of liver cancer; The marker includes circBCO2 with the sequence shown in SEQ ID NO: 2; The product includes a substance for detecting the biomarkers at the gene level; The liver cancer mentioned is hepatocellular carcinoma.

9. The application according to claim 8, characterized in that, The substance includes substances selected from at least one of the following detection techniques or methods: Northern blotting, PCR, microarray, nucleic acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, mass spectrometry, and biotin-avidin technology.

10. The application according to claim 9, characterized in that, The substance includes at least one of the following: a probe that specifically recognizes circBCO2, a gene chip, and primers that specifically amplify circBCO2.

11. The application according to any one of claims 8-10, characterized in that, The products include reagents, test plates, test strips, devices, systems, reagent kits, chips, or nucleic acid membrane strips.

12. A system for diagnosing and / or prognosing liver cancer, the system comprising: Detection component: The detection component is used to detect the biomarker of claim 8 at the gene level; Result judgment component: The result judgment component is used to output diagnostic and / or prognostic results based on the results of the markers detected by the detection component; The liver cancer mentioned is hepatocellular carcinoma.

Images