Haplotype SNP molecular marker combinations, primer pairs, and their applications in the SLC25A38 gene associated with laying hen egg quality traits

Abstract

The present invention discloses a haplotype SNP molecular marker combination associated with egg quality traits in the SLC25A38 gene, a primer pair, and their application, relating to the field of molecular marker screening in poultry. The molecular markers are cloned from the SLC25A38 gene of laying hens, and five SNP markers significantly associated with egg quality traits are screened and obtained. Haplotypes consisting of one or a combination of these markers are then used to perform association analysis on egg quality traits. The sequences of the five SNP markers in the SLC25A38 gene are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. The present invention also discloses a primer pair for detecting the molecular markers, a method for screening for egg quality traits in laying hens, and their application in assisted breeding or assisted selection for egg quality traits in laying hens. The provided haplotype SNP molecular marker combination can be used as a haplotype molecular marker associated with eggshell color (L), eggshell strength, and SCI traits, providing a new molecular breeding marker for marker-assisted breeding of egg shell color (L), eggshell strength, and SCI traits in laying hens.

Description

Technical Field

[0001] The present invention relates to the technical field of laying hen genetic marker screening, and in particular to a haplotype SNP molecular marker combination related to laying hen egg quality traits in the SLC25A38 gene, a primer pair and applications thereof. Background Art

[0002] With improved living standards, people are increasingly pursuing high-quality livestock and poultry products. Eggs, with their high nutritional value and effective conversion rate exceeding 98%, have become a popular food. While eggshell color and strength do not determine egg quality and nutritional value, consumers often consider eggshell color as an intuitive trait when purchasing eggs. Furthermore, eggshell strength is also considered important because it affects egg breakage rates. Currently, there are four main types of eggs on the market: brown, pink, white, and green. Brown and pink eggs dominate the market in my country. In production practice, it has been found that brown-shelled hens often experience uneven egg color and lighter eggshells, which hinders farmers' profitability. The depth of the brown color of the eggshell depends on the total amount of protoporphyrin IX in the eggshell. The color of brown-shelled eggs produced by different individuals of the same breed is different. This is because the ability to synthesize protoporphyrin varies among individual laying hens and is related to the individual's genetic basis. In addition, the brownness of the eggshells of eggs produced by the same individual at different laying stages also varies to a certain extent. This may be related to multiple factors, such as age, stress, nutrition, drugs and diseases, which can affect the color uniformity of brown-shelled eggs, causing the color of brown-shelled eggs to vary from dark brown to light brown.

[0003] The primary pigment in brown eggs is protoporphyrin IX, a precursor to heme synthesis. The first step in heme biosynthesis is the condensation of glycine and succinyl-CoA to form δ-aminolevulinic acid (ALA). ALA is then catalyzed to condense into porphyrinogen. Four molecules of porphyrinogen further condense into uroporphyrinogen III, which undergoes decarboxylation to form coproporphyrinogen III. Coproporphyrinogen III undergoes oxidative decarboxylation to form protoporphyrin IX. Ferrous iron is then incorporated into protoporphyrin IX by ferrochelatase, forming heme. Aminolevulinate synthase 1 (ALAS1) is the first, rate-limiting enzyme in heme synthesis. It is ubiquitously expressed in most non-erythroid tissues that produce heme. The rate of heme synthesis is controlled by ALAS1 levels. The first step in ALAS1-mediated protoporphyrin IX synthesis is the condensation of succinyl-CoA and glycine to produce ALA in the mitochondrial matrix, a rate-limiting step in protoporphyrin IX synthesis. The solute transporter SLC25A38 (Solute Carrier Family 25 Member 38, SLC25A38), a member of the solute carrier family 25, is a pro-apoptotic protein encoded by the SLC25A38 gene. The SLC25 protein family is widely present in eukaryotes and is also known as the mitochondrial carrier family. They transport amino acids, fatty acids, carboxylic acids, cofactors, inorganic ions, and nucleotides across the inner mitochondrial membrane for vital cellular processes such as oxidative phosphorylation, amino acid degradation, and heme biosynthesis. The SLC25A38 protein encoded by the SLC25A38 gene is an amino acid transporter composed of 288 amino acids. It has been confirmed to be the main mitochondrial glycine transporter required for heme biosynthesis. It can promote the production of ALA by transporting glycine to mitochondria or exchanging glycine through the mitochondrial inner membrane of red blood cells, accelerate heme synthesis, and increase the content of protoporphyrin IX.

[0004] However, to date, there has been no report on the research of SLC25A38 gene in laying hens, and there is no research on using SLC25A38 gene in laying hens as a molecular marker for egg quality traits. Summary of the Invention

[0005] The present invention provides a haplotype SNP molecular marker combination related to laying hen egg quality traits in the SLC25A38 gene, a primer pair and its application, aiming to solve the problems existing in the above-mentioned background technology.

[0006] In order to achieve the above technical objectives, the present invention mainly adopts the following technical solutions:

[0007] In a first aspect, the present invention discloses a haplotype SNP molecular marker combination associated with egg quality traits in the SLC25A38 gene, wherein the egg quality traits include one or more of eggshell color L, eggshell strength, and SCI; the SNP molecular marker is located in the coding region of the SLC25A38 gene of laying hens, including SNP site 1, SNP site 2, SNP site 3, SNP site 4, and SNP site 5;

[0008] The SNP site 1 is at position 473 of the sequence shown in SEQ ID NO: 1, or position 3515 of the reverse complementary sequence of the SLC25A38 gene, and has an A / G mutation;

[0009] The SNP site 2 is located at position 603 of the sequence shown in SEQ ID NO: 1, or position 3645 of the reverse complementary sequence of the SLC25A38 gene, and has a T / C mutation;

[0010] The SNP site 3 is at position 566 of the sequence shown in SEQ ID NO: 2, or position 4247 of the reverse complementary sequence of the SLC25A38 gene, and has a G / A mutation;

[0011] The SNP site 4 is located at position 350 of the sequence shown in SEQ ID NO: 3, or position 5431 of the reverse complementary sequence of the SLC25A38 gene, and has an A / G mutation;

[0012] The SNP site 5 is at position 413 of the sequence shown in SEQ ID NO: 3, or position 5494 of the reverse complementary sequence of the SLC25A38 gene, and has a C / G mutation.

[0013] In a preferred embodiment of the present invention, when the SNP molecular marker combination is the ATGAC / ATGAC haplotype, the eggshell color L and SCI are significantly better than other haplotype combinations; when the SNP molecular marker combination is the ACAAC / ATGAC haplotype, the eggshell strength is significantly better than other haplotype combinations.

[0014] In a second aspect, the present invention discloses an application of the haplotype SNP molecular marker combination as described in the first aspect in assisted breeding of laying hens or assisted selection of laying hen egg quality traits.

[0015] In the third aspect, the present invention discloses a primer for detecting the SNP site 1 and / or SNP site 2 described in the first aspect, characterized in that the nucleotide sequence is: the nucleotide sequence of the upstream primer 1-F is shown in SEQ ID NO: 4, and the nucleotide sequence of the downstream primer 1-R is shown in SEQ ID NO: 5.

[0016] In a fourth aspect, the present invention discloses a primer for detecting the SNP site 3 described in the first aspect, characterized in that the nucleotide sequence is: the nucleotide sequence of the upstream primer 2-F is shown in SEQ ID NO: 6, and the nucleotide sequence of the downstream primer 2-R is shown in SEQ ID NO: 7.

[0017] In the fifth aspect, the present invention discloses a primer for detecting the SNP site 4 and / or SNP site 5 described in the first aspect, characterized in that the nucleotide sequence is: the nucleotide sequence of the upstream primer 3-F is as shown in SEQ ID NO: 8, and the nucleotide sequence of the downstream primer 3-R is as shown in SEQ ID NO: 9.

[0018] In a sixth aspect, the present invention discloses a use of the primers described in any one of the third aspect, the fourth aspect, and the fifth aspect in assisted breeding of laying hens or assisted selection of laying hen egg quality traits.

[0019] In the seventh aspect, the present invention discloses a kit for detecting egg quality traits of laying hens, wherein the egg quality traits of laying hens include one or more of eggshell color L, eggshell strength, and SCI; and includes the primers described in the third aspect, the fourth aspect, and the fifth aspect.

[0020] In an eighth aspect, the present invention discloses a use of the kit as described in the seventh aspect in detecting egg quality traits of laying hen eggs.

[0021] In a ninth aspect, the present invention discloses a method for screening egg quality traits of laying hens, wherein the egg quality traits of laying hens include one or more of eggshell color L, eggshell strength, and SCI; the method comprises the following steps:

[0022] (1) Extracting genomic DNA from laying hen blood;

[0023] (2) using the primers described in the third aspect to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 1 in the first aspect; using the primers described in the fourth aspect to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 2 in the first aspect; using the primers described in the fifth aspect to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 3 in the first aspect;

[0024] (3) Sequencing the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 to screen for DNA sequence mutation sites and analyze the haplotype combination of the SLC25A38 gene;

[0025] (4) Select individuals with the haplotype combination of ATGAC / ATGAC or ACAAC / ATGAC.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention has discovered a haplotype SNP molecular marker combination related to laying hen egg quality traits, providing a reference basis for assisted selection of laying hen egg quality traits. The provided haplotype SNP molecular marker combination can be used as a haplotype molecular marker related to eggshell color L, eggshell strength, and SCI traits, providing a new molecular breeding marker for marker-assisted breeding of laying hen egg color L, eggshell strength, and SCI traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The results of agarose gel analysis of the PCR amplification products of the laying hen SLC25A38 gene fragment using primers 1-F and 1-R, where M is a marker and 1-4 are the amplification results of the SLC25A38 gene fragment;

[0029] Figure 2 The results of agarose gel analysis of the PCR amplification products of the laying hen SLC25A38 gene fragment using primers 2-F and 2-R, where M is a marker and 1-4 are the amplification results of the SLC25A38 gene fragment;

[0030] Figure 3 The results of agarose gel analysis of the PCR amplification products of the laying hen SLC25A38 gene fragment using primers 3-F and 3-R, where M is a marker and 1-4 are the amplification results of the SLC25A38 gene fragment;

[0031] Figure 4 Comparison of sequencing results of individuals with different genotypes at the five SNP polymorphism sites of the SLC25A38 gene in laying hens; (a) There is an A / G mutation site at 3515bp of the reverse complementary sequence of the SLC25A38 gene; (b) There is a T / C mutation site at 3645bp of the reverse complementary sequence of the SLC25A38 gene; (c) There is a G / A mutation site at 4247bp of the reverse complementary sequence of the SLC25A38 gene; (d) There is an A / G mutation site at 5431bp of the reverse complementary sequence of the SLC25A38 gene; (e) There is a C / G mutation site at 5494bp of the reverse complementary sequence of the SLC25A38 gene;

[0032] Figure 5 This is the result of haplotype block analysis of the SLC25A38 gene. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0034] Example 1: Acquisition of a partial coding region fragment of the laying hen SLC25A38 gene and establishment of a SNP detection method

[0035] 1. Extraction of genomic DNA from laying hens

[0036] The experimental laying hen breed used in this study was the Luodao Red chicken, and the samples were obtained from the poultry testing field of the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. Blood genomic DNA was extracted using a blood / cell / tissue genomic DNA extraction kit from Tiangen Biochemical Technology Co., Ltd. The specific steps are as follows:

[0037] (1) Use a disposable syringe to draw approximately 1 ml of blood from the sub-wing vein of a chicken. Place the blood in a 1.5 ml anticoagulant blood collection tube containing sodium citrate. Gently shake the tube to mix well. Record the wing number and store at -20°C until ready for use. Draw 20 μL of anticoagulant blood, add 180 μL of GA buffer and 20 μL of proteinase K solution, and mix thoroughly.

[0038] (2) Add 200 μl of buffer GB, mix thoroughly by inversion, and incubate at 70°C for 10 min. The solution should become clear and centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0039] (3) Add 200 μl of anhydrous ethanol, shake thoroughly for 15 seconds, and briefly centrifuge;

[0040] (4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid;

[0041] (5) Add 500 μl of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid;

[0042] (6) Add 600 μl of rinse solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid;

[0043] (7) Repeat the previous step;

[0044] (8) Centrifuge at 12000 rpm for 2 min to completely remove residual PW;

[0045] (9) Place the adsorption column in a clean centrifuge tube, add 50-200 μl of elution buffer TE to the center of the column, let it stand at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 2 minutes to elute the DNA, and store the eluted DNA at -20°C for later use.

[0046] 2. Obtaining a partial nucleotide fragment of the laying hen SLC25A38 gene

[0047] Primer pairs were designed based on the laying hen SLC25A38 gene sequence published in the NCBI database (accession number Gene ID: 420717). Three pairs of primers were designed based on the reverse complementary sequence of the sequence. The sequences of the primer pairs are as follows:

[0048] Upstream primer 1-F: 5'-AGCAAGGAACATGCGAGCAAGTT-3' (shown in SEQ ID NO: 4),

[0049] Downstream primer 1-R: 5'-TCCTGAAGCAGATTGAAGCTATTGC-3' (shown in SEQ ID NO: 5).

[0050] Upstream primer 2-F: 5'-ATCCACGCTTACGTTACATTCAG-3' (shown in SEQ ID NO: 6),

[0051] Downstream primer 2-R: 5'-TGAGACTGAATCTCTTGTCAGTG-3' (shown in SEQ ID NO: 7).

[0052] Upstream primer 3-F: 5'-GCAGTCAGTGCTAAGGAACCGAATG-3' (shown in SEQ ID NO: 8),

[0053] Downstream primer 3-R: 5'-TTGGACCACAAGTGCCAAGCCAT-3' (shown in SEQ ID NO: 9).

[0054] PCR amplification was performed in laying hen genomic DNA using the above primers. The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2.

[0055] Table 1 PCR reaction system

[0056]

[0057] Table 2 PCR reaction conditions

[0058]

[0059] The PCR amplification products were detected by agarose gel electrophoresis. Figure 1-Figure 3

[0060] 3. Detection of molecular markers using direct sequencing of PCR products

[0061] The PCR products obtained above were directly sent to Beijing Aoke Dingsheng Biotechnology Co., Ltd. for sequencing. The returned sequencing results were compared with the reverse complementary sequences to determine the mutation site and the genotype of the site in the test population. Blast analysis was performed using DNAStar software. The results are as follows: Figure 4 As shown, five allele mutation sites, namely A / G, T / C, G / A, A / G and C / G, were found at 3515bp, 3645bp, 4247bp, 5431bp and 5494bp of the reverse complementary sequence of the gene, respectively. The above mutations caused the polymorphism of the SLC25A38 gene, forming a total of 11 haplotypes, namely ACAAC, ATGAC, GCGGG, ACGGG, GTGGG, ATGGG, ATAAC, ATGGC, ACGAC, ATGAG, ACGAG

[0062] The nucleotide sequences of the above five SNP markers are referenced in the sequence table SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0063] SEQ ID NO: 1

[0064] agcaaggaacatgcgagcaagttctgcagtcaacattgccctcactgttttctcctcaaacgcttttgttcagcaatttctcattgcacaaaggtggtaagcacggagctatttttaaaatgggcttctctcaacatagataccatgctgtggaaaccctgcccaaggcagtcccaggtacagtccttccggaatgcattgatcaaaagatgcgaagatttgatccttctttcttctacttccctaaaggcctaatcctctgtctcagaagggctttcttcctcccagctgagcaaggcttattcctccatggaactgggaacttcccagtgccagctggtcacagcacgcaggagaaggagtgaggctggtcagttctagtgcaagtcagtcaagatttcaagcccattttttccatcatctgttcatatacagtccacgccattgctgccatcagagtacgcctgagggcR(A or G)cgaggcacaccacctcggaagaagccaaccaagccaaagtcctgcagcagaaaacaaacagcaatccattaccatctgcctccagcatttta attcttcatcatttttttttacatggaacaacccacaY(T or C)tgtatttcagctcagatccagatcagcctctgaaagatccacgcttacgttacattcagcctttaggaagaacccaaaccactgtgcaattacagg gcacccactgaaaaaggaaggagaagggtatgccaggatgacaaaggacagggaaagccacactcaagcctgacatagagaaggtgaaggagcaatagcttcaatctgcttcagga

[0065] SEQ ID NO: 2

[0066] atccacgcttacgttacattcagcctttaggaagaacccaaaccactgtgcaattacagggcacccactgaaaaaggaaggagaagggtatgccaggatgacaaaggacagggaaagccacactcaagcctgacatagagaaggtgaaggagcaatagcttcaatctgcttcaggaaaatgacttgtccttgttttagagctcattcttgttcacaaagtaacgtaactgttctttaaaaactgaagtttgtaagtgctgaaaataaatacatctgttaggaaacggttcgtgcacaagaaaaaaaaaagaaaatccatacacaaatacagattcttgtttaggaaagaaaacaaagcaaagctgctaagatccactacatactaaggaaaccctttgccttagtgcggtaattacagatgtgcctacatggataaaccagaggtggcagcagctgcaagcacagctcttccaagctcatgttcagagctaaagtcaccaccagtgtgaagacaaaggcatagcagacaactgaagtgtaatcattcagcagcttgatgcatgagR(G or A)cagatctgtgtggagagatgcttggtggaattatagcacaaaggtgggcatagcctactcttcaactgcctgtcttctgtaattttgtgcaaacagttaaaggatttgagaatggcaagagtaattggggagcaagttccactcccttgtaatccattcaagaggagcaggaaataatctgagtagtgataatagcctcttaattacaaggaaactcaaggaatggactgaaacttctgccttcaaaccatctaccacagtacccttccagttaatttcccaagcaggtccacatgaaaaacactgacaagagattcagtctca

[0067] SEQ ID NO: 3[[ID=​gcagtcagtgctaaggaaccgaatgtaacaggaactcagataaggaaaagttgtttaagtcttgcctcagccagttctacaaccagagaaaccccagcttagtggaaactaatcagtatacaagacaaacagcagaagaaaccactgctgaacacatcctctctttcagttcctcactaacctaacttacgtatcactcacctaccttaagcatgagtcttcaaaaagacagtacattttgggcccatttccacttctatactgacatgagatctacagttttccacaagcaaaaggcaaacatctcacctaaagccctacaagagagtaactgaactactgatgatgcR(A or G)tgcaataagcgaagcagcgacttttatggcacaatgcaacaaaagcaacgttttatgtcacaS(C or G)cctctgaagttcagccttaccctgaggtgtgagttttttggtctgtgtgtagaacatcaggtagatcccagagaaaggtgcatcccgtagcagagtggcagtgagcccactgaacatgccacgagccccttccgtctgatagatactcctcagagctccatacacactcccatagccaaatcttccactctgcagagttagataagagtcagtcatccacatgccaaggagttccactcacaccctgaggccactgtgttctcatctgatacaagagatggcagtagagaggatagcccaaggcaaaaactgtgttccacctacctcagcctctaaaagagtccttcaagaaggtaaaacacaaaaagtatcccacaaatacagaggcactgtatacaaacagcactgtaaaatctcagggtaagtttcacattcacattctgcctagttatcagtagtatggcttggcacttgtggtccaa。

[0069] Example 2 Detection of the polymorphic distribution of the molecular markers prepared by the present invention in laying hens

[0070] The polymorphism of five loci in the partial coding region of the SLC25A38 gene in laying hens was detected. Three genotypes were detected at the g.3515A>G, g.3645T>C, g.4247G>A, g.5431A>G and g.5494C>G loci. The genotype frequencies, allele frequencies and distributions are shown in Table 3.

[0071] Table 3 Genotype frequency and allele frequency of SLC25A38 gene in laying hens

[0072]

[0073]

[0074] As shown in Table 3, three genotypes were detected at the five mutation sites of the sequence. At sites SLC25A38_SNP1 to SLC25A38_SNP5, the dominant alleles were A, T, G, A, and C, and the dominant genotypes were AA, TT, GG, AA, and CC, respectively.

[0075] Example 3 Association analysis and application of the molecular markers of the present invention with egg quality traits

[0076] To determine whether the markers SLC25A38_SNP1 to SLC25A38_SNP5 detected in laying hens are associated with differences in egg quality traits, 262 Luodao Red chickens were selected as the experimental samples. The samples were collected at the Poultry Experimental Field of the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. Seven egg quality traits, including egg weight, eggshell color L, a, and b values, eggshell strength, yolk weight, and SCI, were recorded for each individual. Polymorphisms were detected using direct sequencing, and the correlation between different genotypes in the coding region of the SLC25A38 gene in laying hens and egg quality traits was analyzed. Association analysis between genotype and phenotype was performed using SPSS 27.0 software, and the model used was as follows:

[0077] Y ij =u+G i +P j +e ij

[0078] Among them, Y ij is the observed value of the trait; u is the total average value of the trait; G i is the genotype effect; P j is a fixed effect; e ij is a random error.

[0079] Association analysis between different genotypes of five mutation sites and laying hen egg quality traits was conducted in Luodao Red chickens. The statistical analysis results are summarized in Table 4.

[0080]

[0081] As can be seen from Table 4, there are genotypes at the SLC25A38_SNP1 to SLC25A38_SNP5 sites of the SLC25A38 gene that are related to the L, a, and b values ​​of the eggshell color. Among them, the CC genotype at the SLC25A38_SNP5 site, the AA genotype at the SLC25A38_SNP4 site, and the CC genotype at the SLC25A38_SNP2 site have higher color L values; the CT genotype at the SLC25A38_SNP2 site is related to the SLC The AG genotype at SLC25A38_SNP1 had a higher color a value; the GG genotype at SLC25A38_SNP3 had a higher color b value. In addition, the CC genotype at SLC25A38_SNP2 had a higher egg weight and SCI; the AA genotype at SLC25A38_SNP3 had a higher egg weight; the AA genotype at SLC25A38_SNP4 and the CC genotype at SLC25A38_SNP5 had a higher SCI.

[0082] Example 4 Identification of Haplotype Combinations Containing Excellent Egg Quality Traits

[0083] 1. Construction of haplotypes and haplotype combinations

[0084] Haploview software was used to perform haplotype analysis of SLC25A38_SNP1 to SLC25A38_SNP5. The haplotype block analysis results are shown in Figure 2. Figure 5 shown.

[0085] Depend on Figure 5 It can be seen that according to the linkage disequilibrium analysis of the SLC25A38_SNP1 to SLC25A38_SNP5 loci, a total of 2 haplotype blocks were found. Haplotype analysis was performed on the 2 haplotype blocks, and 11 haplotypes were found in the laying hen population studied in the present invention, as shown in Table 5 below.

[0086] Table 5 Haplotype statistics of SLC25A38 gene SNP sites

[0087]

[0088] The haplotype combinations of each individual composed of the above haplotypes were analyzed, and a total of 15 haplotype combinations were found, as shown in Table 6.

[0089] Table 6 SLC25A38 gene haplotype combinations

[0090]

[0091] Some haplotype combinations with smaller numbers in the sample population were eliminated, and the five haplotypes with the largest numbers were selected for association analysis.

[0092] 2. Association analysis between haplotype combinations and egg quality traits

[0093] SPSS 27.0 software was used to perform association analysis between haplotype combinations and egg quality traits. The results are shown in Table 7.

[0094] Table 7 Association analysis results between dominant haplotypes and egg quality traits

[0095]

[0096] As can be seen from Table 7, when the five haplotype combinations are compared with each other, there are no significant differences in egg weight, color a, color b, and yolk weight. The haplotype combination H4H5 (its sequence is: ACGGG / GTGGG) is extremely significantly lower than the other haplotype combinations in color L. The haplotype combination H1H2 (its sequence is: ACAAC / ATGAC) is significantly higher than the haplotype combinations H2H2 (its sequence is: ATGAC / ATGAC) and H5H9 (its sequence is: GTGGG / ACGAC) in eggshell strength, and extremely significantly higher than the haplotype combinations H2H6 (its sequence is: ATGAC / ATGGG) and H4H5 (its sequence is: ACGGG / GTGGG) haplotype combinations. The haplotype combination H4H5 (its sequence is: ACGGG / GTGGG) is extremely significantly lower than the other haplotype combinations in SCI.

[0097] In summary, the H2H2 (sequence: ATGAC / ATGAC) haplotype combination outperformed other haplotype combinations in terms of color L and SCI, and the H1H2 (sequence: ACAAC / ATGAC) haplotype combination outperformed other haplotype combinations in terms of eggshell strength. Therefore, in the experimental population of this embodiment, the H2H2 (sequence: ATGAC / ATGAC) and H1H2 (sequence: ACAAC / ATGAC) haplotype combinations had the best egg quality traits.

[0098] This example identified two haplotype combinations (sequences: ATGAC / ATGAC and ACAAC / ATGAC) with excellent egg quality traits. Therefore, selecting individuals with these two haplotype combinations within a laying hen population will help improve egg quality traits in laying hens. Based on these results, the haplotype combinations composed of the mutation sites of this invention can be used as potential genetic markers for improving eggshell color and other egg quality traits in laying hens for assisted selection.

[0099] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of a detection primer combination of a haplotype SNP molecular marker combination related to laying hen egg quality traits in the SLC25A38 gene in assisted breeding for laying hen egg quality traits, characterized in that: The laying egg quality traits are eggshell color L, eggshell strength and SCI; the SNP molecular marker is located in the coding region of the laying hen SLC25A38 gene, including SNP site 1, SNP site 2, SNP site 3, SNP site 4 and SNP site 5; The SNP site 1 is at position 473 of the sequence shown in SEQ ID NO: 1, and has an A / G mutation; The SNP site 2 is located at position 603 of the sequence shown in SEQ ID NO: 1, and has a T / C mutation; The SNP site 3 is at position 566 of the sequence shown in SEQ ID NO: 2, and has a G / A mutation; The SNP site 4 is located at position 350 of the sequence shown in SEQ ID NO: 3, and has an A / G mutation; The SNP site 5 is at position 413 of the sequence shown in SEQ ID NO: 3, and has a C / G mutation; When the SNP molecular marker combination is the ATGAC / ATGAC haplotype, the eggshell color L and SCI are significantly better than other haplotype combinations; when the SNP molecular marker combination is the ACAAC / ATGAC haplotype, the eggshell strength is significantly better than other haplotype combinations; The laying hens are Luodao Red chickens.

2. The use according to claim 1, characterized in that The nucleotide sequences of the primers for detecting SNP site 1 and / or SNP site 2 are as follows: the nucleotide sequence of the upstream primer 1-F is shown in SEQ ID NO: 4, and the nucleotide sequence of the downstream primer 1-R is shown in SEQ ID NO:

5.

3. The use according to claim 1, characterized in that The nucleotide sequences of the primers for detecting SNP site 3 are as follows: the nucleotide sequence of the upstream primer 2-F is shown in SEQ ID NO: 6, and the nucleotide sequence of the downstream primer 2-R is shown in SEQ ID NO:

7.

4. The use according to claim 1, wherein The nucleotide sequences of the primers for detecting SNP site 4 and / or SNP site 5 are as follows: the nucleotide sequence of the upstream primer 3-F is shown in SEQ ID NO: 8, and the nucleotide sequence of the downstream primer 3-R is shown in SEQ ID NO:

9.

5. Use of a kit for detecting egg quality traits in laying hens, wherein the egg quality traits are eggshell color (L), eggshell strength, and SCI; the kit comprising primers as shown in SEQ ID NOs: 4-9; and SNP molecular markers located in the coding region of the SLC25A38 gene in laying hens, including SNP sites 1, 2, 3, 4, and 5. The SNP site 1 is at position 473 of the sequence shown in SEQ ID NO: 1, and has an A / G mutation; The SNP site 2 is located at position 603 of the sequence shown in SEQ ID NO: 1, and has a T / C mutation; The SNP site 3 is at position 566 of the sequence shown in SEQ ID NO: 2, and has a G / A mutation; The SNP site 4 is located at position 350 of the sequence shown in SEQ ID NO: 3, and has an A / G mutation; The SNP site 5 is at position 413 of the sequence shown in SEQ ID NO: 3, and has a C / G mutation; When the SNP molecular marker combination is the ATGAC / ATGAC haplotype, the eggshell color L and SCI are significantly better than other haplotype combinations; when the SNP molecular marker combination is the ACAAC / ATGAC haplotype, the eggshell strength is significantly better than other haplotype combinations; The laying hens are Luodao Red chickens.

6. A method for screening egg quality traits in laying hens, characterized in that: The egg quality traits of the laying hen are eggshell color L, eggshell strength and SCI; comprising the following steps: (1) Extracting genomic DNA from laying hen blood; (2) PCR amplification was performed using the primers described in SEQ ID NOs: 4-5 to obtain the sequence shown in SEQ ID NO: 1 in claim 1; PCR amplification was performed using the primers described in SEQ ID NOs: 6-7 to obtain the sequence shown in SEQ ID NO: 2 in claim 1; PCR amplification was performed using the primers described in SEQ ID NOs: 8-9 to obtain the sequence shown in SEQ ID NO: 3 in claim 1; (3) Sequencing the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 to screen for DNA sequence mutation sites and analyze the haplotype combination of the SLC25A38 gene; (4) selecting individuals with the haplotype combination of ATGAC / ATGAC or ACAAC / ATGAC; The laying hens are Luodao Red chickens.

Images