Primer for a molecular marker related to the white feather trait of Shaoxing duck and its application

Abstract

The present invention relates to a primer of a molecular marker related to the white feather trait of Shaoxing duck and its application, belonging to the field of biotechnology. The present invention uses the duck reference genome version GCF_015476345.1, the molecular marker is located at the 5212998th base of chromosome 13, and is located on the intron between the 1M and 2 exons of the MITF gene. The molecular marker has two mutations, T and C, and the trait is a recessive genetic trait, wherein the T / T genotype individual phenotype is white feather, and the T / C and C / C genotype phenotypes are gray feathers. The present invention uses the above-mentioned molecular markers for screening and breeding white feather Shaoxing ducks, which has great economic application value and breeding value for breeding high-quality white feather Shaoxing ducks.

Description

Technical Field

[0001] The invention relates to a molecular marker primer related to the white feather trait of Shaoxing duck and application thereof, belonging to the field of biotechnology. Background Art

[0002] Shaoxing duck is a famous local breed of high-quality egg-laying duck in my country. The Poultry Records records that Shaoxing ducks start laying eggs at an average age of 104 days, with an annual egg production of 307 eggs and an average egg weight of 67g. The production performance is very good. At the same time, due to the long egg-laying period, the egg-laying ducks are eliminated for two years, accumulating enough flavor substances, and are highly popular in the market. In the duck meat market, ducks with white feathers have higher economic value. Breeding Shaoxing ducks with white feathers is of great significance to improving the economic benefits of Shaoxing ducks. The gene MITF is called microphthalmia transcription factor, which is considered to be a key regulatory gene in the development of melanocytes. The white feather traits of Beijing ducks, Sanshui white ducks, Liancheng white ducks, and Putian ducks are all related to the variation of this gene. The ~6.6Kb insertion fragment between exons 1M and 2 on the Beijing duck MITF gene is considered to be the key to causing the white feathers of Beijing ducks, but this insertion is only fixed in Beijing ducks, and only a small amount is detected in the genomes of wild ducks and local ducks in my country. According to the applicant's understanding, the molecular marker used in patent CN115820874 A is a transposon insertion polymorphic molecular marker with a length of 6693bp located on chromosome 1, and is not located on the same chromosome as the molecular marker of the present invention. The association of white feather traits of Sanshui white duck has not been published publicly. The two pairs of three primers in patent CN 116676399 A can obtain PCR products with lengths of 237bp and 354bp in Sanshui white duck and Zhongshan shelduck, respectively. Among them, the amplified product of Sanshui white duck only contains a 237bp band, while the amplified product of Zhongshan shelduck contains a 354bp band, thereby realizing the distinction between white feather and colored feather samples. The applicant randomly selected 9 gray-feathered Shaoxing ducks and 10 white-feathered Shaoxing ducks to test their primers. The gray-feather samples showed a band of 354bp or two bands of 237bp and 354bp, but the white-feather samples showed deviations in detection results. Only two samples had a strong 237bp band signal, two samples had a weak 237bp band signal, and the other samples had no detection at all ( Figure 1 ), so this patent is not applicable to the detection and breeding of white-feathered Shaoxing ducks. The variation site of Liancheng white duck in patent CN111334589A also does not provide the physical location relative to the reference genome, but the white feather rate of offspring bred based on its variation is 96.2%, which cannot meet the requirement of 100% white feather rate of offspring. Therefore, the existing molecular markers related to the white feather trait of ducks are not suitable for the selection of white feather traits of Shaoxing ducks. There is an urgent need for a detection and breeding method for the white feather trait of Shaoxing ducks to improve the quality of breeding. Summary of the invention

[0003] The purpose of the present invention is to address the defects of the prior art and propose a primer for a molecular marker related to the white feather trait of Shaoxing duck and its application, which can be used as an auxiliary molecular marker in the breeding process of white feather Shaoxing duck to accelerate the breeding of high-quality, high-yield white feather Shaoxing duck with stable inheritance of white feather trait.

[0004] The present invention discovers natural white-feathered individuals in the natural population of Shaoxing ducks, and stably inherited white-feathered Shaoxing ducks can be obtained through purification selection. The associated gene MITF of the white feather trait of Shaoxing ducks is located through hybridization and whole genome association analysis. By developing a site different from the prior art, it can be ensured that the site is fixed in the genome of the white-feathered Shaoxing duck, which is used for the selection and breeding of white-feathered Shaoxing ducks, so that the white feather rate in the offspring of Shaoxing ducks is 100%.

[0005] The present invention solves the technical problem through the following technical scheme: First, a primer for a molecular marker related to the white feather trait of Shaoxing duck is provided, wherein the molecular marker is located at base 5212998 of chromosome 13 of the duck reference genome GCF_015476345.1 version, and is located in the intron region between exons 1M and 2 of the MITF gene. The base mutation is T or C, and the genotype is T / T, T / C and C / C; the sequence of the Shaoxing duck-specific primer pair is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0006] The present invention further provides the application of primers of molecular markers related to the Shaoxing duck white feather trait, which are mainly used to detect the SNP molecular marker genotype of Shaoxing duck feather color.

[0007] The specific detection method includes the following steps:

[0008] The first step is to perform PCR amplification on the Shaoxing duck sample to be tested using duck DNA specific primer pairs to obtain an amplified product;

[0009] The second step is to perform Sanger sequencing on the amplified product;

[0010] The third step is to determine the molecular marker genotype of the target SNP site based on the sequencing results of the second step.

[0011] In the first step of the above method, the sequence of the duck DNA specific primer pair consists of upstream primer SEQ ID NO: 1 and downstream primer SEQ ID NO: 2, and the amplified product contains base 5212998 on chromosome 13 of duck reference genome version GCF_015476345.1.

[0012] In the first step, the concentration of the reaction system is 25ul.

[0013] Shaoxing duck DNA to be tested 50 ng

[0014] 2 x Accurate Taq Master Mix 12.5μl

[0015] Upstream primer 1 μl

[0016] Downstream primer 1 μl

[0017] Add sterile water to 25 μl.

[0018] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; and storage at 20°C.

[0019] The nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4. In the third step, the judgment standard is that the feather color of Shaoxing ducks with SNP sites of T / T genotype is white, and the feather color of Shaoxing ducks with T / C and C / C genotypes is gray.

[0020] The SNP molecular marker associated with the white feather trait of Shaoxing duck can be used in the breeding assisted selection of white Shaoxing duck, and the genotype T / T is a white feather molecular marker, and the genotype T / C or C / C is a gray feather molecular marker.

[0021] Compared with the problem that the white feather rate of offspring of molecular markers in the prior art cannot reach 100%, or the detection efficiency in white feather Shaoxing ducks is low, the white feather rate of offspring of white feather Shaoxing ducks obtained by the present invention can reach 100%, and the detection efficiency of molecular markers for white feather Shaoxing ducks is also 100%. The present invention uses the above molecular markers to screen and breed white feather Shaoxing ducks, which has the beneficial effect of improving the breeding quality of Shaoxing ducks, and has high economic application value and breeding value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Gel images of the amplified products of the existing CN 116676399 A primer in the gray-feathered and white-feathered Shaoxing ducks. The left side is the gray-feathered Shaoxing duck, and the right side is the white-feathered Shaoxing duck.

[0023] Figure 2 Individual phenotypes of gray-feathered Shaoxing duck and white-feathered Shaoxing duck.

[0024] Figure 3 Manhattan plot of genome-wide association analysis. The horizontal axis is the physical position of the chromosome, and the vertical axis is .

[0025] Figure 4 Individual genotype identification diagram of homozygous gray feather, heterozygous gray feather and homozygous white feather Shaoxing duck.

[0026] Figure 5The detection efficiency of the molecular marker of the present invention in gray-feather Shaoxing duck and white-feather Shaoxing duck. DETAILED DESCRIPTION

[0027] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are based on conventional experimental conditions.

[0028] Comparative Example 1

[0029] Two pairs of three primers in patent CN 116676399 A were used to amplify 9 gray-feathered Shaoxing ducks and 10 white-feathered Shaoxing ducks. The results are as follows: Figure 1 The white-feathered Shaoxing duck shown had one strong 237 bp band and three weak 237 bp bands, and the overall white feather detection efficiency was 40%.

[0030] Example 1

[0031] The white feather rate of the white-feathered Shaoxing duck offspring obtained by the present invention can reach 100% (Table 1), and the detection efficiency of the molecular marker for white-feathered Shaoxing duck is also 100% ( Figure 5 ).

[0032] This example screens SNP molecular markers related to the white feather trait of Shaoxing duck by the following method, and the preparation method includes the following steps: constructing a hybrid family of white feather and gray feather Shaoxing duck; whole genome sequencing to detect high-quality candidate markers; using the mixed model of the EMMAX tool to perform whole genome association analysis on feather color traits; fine positioning of candidate SNPs according to family genotypes; comparison between different genotype groups at the detection site. The white feather and gray feather Shaoxing duck F0 generation involved in the example was donated by Zhejiang Guowei Technology Co., Ltd. and will not be repeated here.

[0033] The details are as follows:

[0034] 1. Hybrid line construction

[0035] In order to find out the inheritance mode of the white feather trait of Shaoxing duck, this example uses the F0 generation white feather and gray feather Shaoxing duck to carry out forward and reverse hybridization (Table 1), and the offspring phenotypes are counted (Table 2). The offspring produced by the forward and reverse crosses of white feather and white feather Shaoxing duck are all white feathers, and the forward and reverse crosses of white feather and gray feather Shaoxing duck can produce white feather and gray feather offspring. Statistics show that the feather color of the offspring has nothing to do with gender, indicating that the white feather trait conforms to autosomal recessive inheritance.

[0036] Table 1 Phenotypic statistics of hybrid families.

[0037]

[0038] Table 2 Physiological segregation statistics of F1 representatives of positive and negative crosses of white-feathered and gray-feathered samples.

[0039]

[0040] Genome-wide association populations and analyses

[0041] Adult Shaoxing ducks of white (78) and gray (85) colors were selected from the family. Blood was collected from the subwing vein using EDTA anticoagulation tubes, and the tubes were gently shaken and frozen at -20 degrees Celsius. Blood DNA was extracted using the CTAB method. The sequencing library was prepared using the standard library construction process of Illumina's TruSeq DNA PCR-free prep kit reagents, and sequenced using the Illumina NovaSeq platform. The average sequencing depth was 14X and the average alignment rate was 99.6%. The reference genome used the GCF_015476345.1 version, and the main tools used for variant detection were BWA and GATK. Variants with a minimum allele frequency of less than 0.05 and a missing rate of more than 20% were filtered out, and the remaining variants were involved in GWAS analysis. The first three principal components and sex were used as covariates, and the EMMAX tool mixed model was used to perform a genome-wide association analysis of Shaoxing duck color. According to the Bonferroni correction method, the suggestive threshold was 7.150 and the significance threshold was 8.451. The results of genome-wide association analysis showed that the QTL interval significantly associated with the white feather trait of Shaoxing duck was obtained from chromosome 13 3595934 to 9459595, and a total of 406 SNP markers with extremely significant association were found. Figure 3 , the horizontal axis is the physical position of the chromosome, and the vertical axis is .

[0042] 3. Detailed screening of 406 SNP markers based on family genotypes

[0043] The above experiment proves that the white feather trait of Shaoxing duck is autosomal recessive. Based on the phenotypic information of the family and offspring, we can determine the genotypes of some individuals for screening SNP molecular markers:

[0044] The genotype of all white-feathered Shaoxing duck individuals was aa, so the SNP markers of the homozygous state of white-feathered Shaoxing duck were screened;

[0045] When the hybrid offspring of F0 gray-feathered Shaoxing duck and F0 white-feathered Shaoxing duck produced both gray-feathered and white-feathered F1 offspring, it was proved that the genotype of the F0 gray-feathered individual was Aa, so the SNP markers of the heterozygous state of the Aa sample were screened;

[0046] The F1 gray-feathered individuals produced by the cross between the gray-feathered F0 and the white-feathered F0 have a genotype of Aa, so the SNP markers of the heterozygous state of these gray-feathered individuals were screened;

[0047] The genotype of other gray feather samples cannot be aa, so the SNP markers with the same homozygous state as the white feathers are filtered out.

[0048] According to the above genotype information, 406 candidate SNPs were screened, and 38 SNP markers met the above conditions (Table 3), located in the 27.7Kb interval from 5192569 to 5220256 on chromosome 13, all located on the MITF gene, of which the 5212998th base was the most significant in the whole genome association analysis, located on the 2nd intron between the 2nd and 3rd exons of the MITF gene. None of the indels on the MITF gene met the above genotype screening conditions.

[0049] Table 3 Candidate alleles

[0050] chromosome Location White feather phenotype allele Gray feather phenotypic allele -logPvalue Location in the genetic structure chr13 5192569 A G 28.379 Intron 5 chr13 5192957 A T 28.343 Intron 5 chr13 5192982 A G 28.343 Intron 5 chr13 5193168 A G 28.343 Intron 5 chr13 5193270 T G 28.343 Intron 5 chr13 5193334 C T 28.343 Intron 5 chr13 5193338 C T 28.343 Intron 5 chr13 5193496 A G 28.343 Intron 5 chr13 5193498 T G 27.333 Intron 5 chr13 5193670 G T 27.991 Intron 5 chr13 5193939 T C 28.343 Intron 5 chr13 5196118 C G 28.343 Intron 4 chr13 5196824 A G 27.914 Intron 4 chr13 5198521 G C 28.343 Intron 2 chr13 5206242 G A 28.343 Intron 2 chr13 5207082 A G 26.926 Intron 2 chr13 5207507 A G 26.032 Intron 2 chr13 5207674 C G 28.343 Intron 2 chr13 5207959 A C 27.626 Intron 2 chr13 5208048 C A 27.626 Intron 2 chr13 5208280 T C 28.343 Intron 2 chr13 5208300 C T 28.343 Intron 2 chr13 5208590 T C 28.343 Intron 2 chr13 5208933 G A 27.567 Intron 2 chr13 5210905 A G 28.343 Intron 2 chr13 5211225 T C 28.343 Intron 2 chr13 5212453 A G 28.343 Intron 2 chr13 5212998 T C 28.990 Intron 2 chr13 5213129 A G 27.131 Intron 2 chr13 5213726 T C 27.851 Intron 2 chr13 5213865 G A 28.343 Intron 2 chr13 5214465 G A 27.969 Intron 2 chr13 5216119 T A 28.560 Intron 2 chr13 5216409 A G 28.560 Intron 2 chr13 5216652 G A 28.560 Intron 2 chr13 5216960 T C 28.560 Intron 2 chr13 5217108 A C 28.560 Intron 2 chr13 5220256 A G 28.560 Intron 2

[0051] 4. Specific amplification of base 5212998 on chromosome 13 and identification of genotype

[0052] Perform the analysis and testing as follows:

[0053] The first step is to design specific primers whose amplification products include the 5212998th base on chromosome 13 based on the reference genome.

[0054] Step 2: Perform PCR amplification on the Shaoxing duck sample to be tested using duck DNA specific primers to obtain an amplified product;

[0055] Step 3: Perform Sanger sequencing on the amplified product;

[0056] Step 4: Determine the molecular marker genotype of the target SNP site based on the sequencing results of step 3.

[0057] In the second step of the above method, the sequence of the duck DNA specific primer pair consists of an upstream primer SEQ ID NO: 1 and a downstream primer SEQ ID NO: 2, which includes the 5212998th base on chromosome 13 of the duck reference genome GCF_015476345.1 version. Primers are designed for the 5212998th base on chromosome 13, and the nucleotide sequences of the primers are as follows:

[0058] SEQ ID NO: 1 GCTTTGTCCCTGTATGGGCTTG

[0059] SEQ ID NO: 2 CTGTTTGTGGCTTTTGGCTGTTCA

[0060] In the first step, the concentration of the reaction system is 25ul.

[0061] Shaoxing duck DNA to be tested 50 ng

[0062] 2 x Accurate Taq Master Mix 12.5μl

[0063] Upstream primer 1 μl

[0064] Downstream primer 1 μl

[0065] Add sterile water to 25 μl.

[0066] The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

[0067] The nucleotide sequence of the amplified product is SEQ ID NO: 3 CTGACTTTTCACAAGTGGAATTTAAGCTAAAACCGGCCATTTTGCTCAAACTGTAGATGAAAGCAAGCAAAACAAACCAAACAAACATTATTTTCATAACGTTTAAAACTCCCTACCCTCCACACCAGTGTTGTCACTACAAGGTTTGTGAAAGCTTGCTACATTTTTATAGCATATGAGA TGAAGTTAGAGCCCAGATAACTGCTGGTGTAGAGGAACACTATCTTCAGCATTTGGGGGCCAAGCAAGGACTAAGGCTGATGTCAGATCGTTCAAATTCTCAGCTCTAGCTTGTAAGAAAGAAGTGGTGTTCAGAATAGTGCCTGTGGGCCATCCAAGTATTTACTTACAAAATCTCATT

[0068] Or SEQ ID NO: 4 CTGACTTTTCACAAGTGGAATTTAAGCTAAAACCGGCCATTTTGCTCAACCTGTAGATGAAAGCAAGCAAAACAAACCAAACAAACATTATTTTCATAACGTTTAAAACTCCCTACCCTCCACACCGGTGTTGTCACTACAAGGTTTGTGAAAGCTTGCTACATTTTTATAGCATATGAGA TGAAGTTAGAGCCCAGATAACTGCTGGTGTAGAGGAACACTATCTTCAGCACTTGGGGGCCAAGCAAGGACTAAGGCTGATGTCAGATCGTTCAAATTCTCAGCTCTAGCTTGTAAGAAAGAAGTGGTGTTCAGAATAGTGCCTGTGGGCCATCCAAGTATTTACTTACAAAATCTCATT. There is a T / C polymorphism at base 232 of the amplification product.

[0069] In the fourth step, the judgment standard is that the feather color of Shaoxing ducks with SNP loci of T / T genotype is white, and the feather color of Shaoxing ducks with T / C and C / C genotypes is gray ( Figure 4 ).

[0070] 4. Testing molecular marker detection efficiency in expanded samples

[0071] In addition, 50 gray feather samples and 50 white feather samples were randomly selected to test the detection efficiency of molecular markers. Among them, 41 gray feather Shaoxing duck homozygous C / C genotype samples, 9 heterozygous T / C genotype samples, and all white feather Shaoxing duck samples were T / T genotypes. Figure 5 As shown, the left side shows the detection efficiency of gray-feathered Shaoxing duck, and the right side shows the detection efficiency of white-feathered Shaoxing duck.

[0072] The MITF gene SNP molecular marker related to the white feather trait of Shaoxing duck in the present invention conforms to autosomal recessive inheritance, and its genotype is extremely significantly associated with the white feather trait of Shaoxing duck. The SNP molecular marker is located in the intron region between the 1M and 2 exons of the MITF gene, and is located at position 5212998 of duck chromosome 13. All samples with T / T genotype at this site have white feather traits, and all samples with T / C or C / C genotype have gray feather traits.

[0073] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a molecular marker-specific primer pair related to the white feather trait of Shaoxing duck, characterized in that: The nucleotide sequences of the Shaoxing duck specific primer pair required for molecular markers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The molecular marker specific primer pair is used to detect the white feather trait of Shaoxing duck. The detection method comprises the following steps: The first step is to perform PCR amplification on the Shaoxing duck sample to be tested using the specific primer pair to obtain an amplification product, wherein the Shaoxing duck DNA sample to be tested contains the SNP located at the 5212998th position of chromosome 13 of the duck reference genome GCF_015476345.1 version after whole genome resequencing and whole genome association analysis; The second step is to perform Sanger sequencing on the amplified product; The third step is to determine the molecular marker genotype of the target SNP site based on the sequencing results of the second step. The judgment standard is that the feather color of Shaoxing ducks with T / T genotype at the SNP site is white, and the feather color of Shaoxing ducks with T / C and C / C genotypes is gray.

2. The use of primers for molecular markers related to Shaoxing duck white feather traits according to claim 1, characterized in that: The sequence of the Shaoxing duck DNA-specific primer pair in the first step consists of an upstream primer SEQ ID NO: 1 and a downstream primer SEQ ID NO: 2, and the amplified product contains the 5212998th base on chromosome 13 of the duck reference genome GCF_015476345.1 version.

3. The use of the primers for molecular markers related to the Shaoxing duck white feather trait according to claim 2, characterized in that: In the first step, the concentration of the reaction system is 25ul. Shaoxing duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl. The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 59°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; and storage at 20°C.

4. The use of the primers for molecular markers related to the Shaoxing duck white feather trait according to claim 3, characterized in that: The nucleotide sequence of the amplified product is shown in SEQ ID NO:3 or SEQ ID NO:4.

Images