A molecular marker related to sugar content in tomato fruit and its application
By developing molecular markers related to the sugar content of tomato fruits and ARMS-PCR technology, the problem of rapid identification of the sugar content of tomato fruits in existing technologies has been solved, and rapid and accurate fruit sugar content detection has been achieved, supporting the screening of tomato germplasm resources.
Patent Information
- Application Number
- CN202411458795.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-18
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2044-10-18
AI Technical Summary
Existing technologies fail to provide a fast and effective method to distinguish the sugar content of tomato fruits, which affects the screening of tomato germplasm resources.
A molecular marker related to the sugar content of tomato fruit was developed, and PCR amplification was performed using a specific nucleotide sequence and primer set. The sugar content of tomato fruit was identified using ARMS-PCR technology, and the detection was performed using a specific primer set and annealing temperature conditions.
It achieves rapid and efficient identification of tomato fruit sugar content, simplifies operations, reduces costs, and improves detection accuracy and efficiency.
Smart Images

Figure CN119287059B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the sugar content of tomato fruits and an application thereof. Background Art
[0002] Plants have three types of sugar transporters: sucrose transporters, monosaccharide transporters, and SWEET transporters. SWEETs are monosaccharide and sucrose transporters located in the plasma membrane or vacuole membrane of plants. They transport sugars in both directions and facilitate the diffusion of sugars along concentration gradients. The tomato genome contains 29 SWEET genes, of which SlSWEET7a and SlSWEET14 encode proteins located on the plasma membrane that are involved in the transmembrane transport of fructose, glucose, and sucrose and are closely related to sugar accumulation in fruit. Related studies have shown that the SWEET gene family may play a key role in sugar biosynthesis. The expression levels of the LbaSWEET9 and LbaSWEET29 genes in wolfberry are significantly positively correlated with fructose content. Heterologous overexpression of MaSWEET1 in tomatoes has been shown to increase the sucrose and fructose content of the fruit in transgenic tomato lines. Tomato lines overexpressing MdSWEET23 have significantly higher sucrose, fructose, glucose, and starch contents in their leaves than wild-type plants. Although there are many studies on the sugar content of tomato fruits, none of them provide a method for quickly identifying and distinguishing the high and low sugar content of tomato fruits. Therefore, there is an urgent need to provide a method for distinguishing the sugar content of tomato fruits to facilitate the screening of tomato germplasm resources. Summary of the Invention
[0003] In view of this, the present invention provides a molecular marker related to the sugar content of tomato fruit and its application, which can quickly detect the sugar content of tomato fruit.
[0004] In order to achieve the above object, the present invention adopts the following technical solutions:
[0005] In a first aspect, the present invention provides a molecular marker related to the sugar content of tomato fruit, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID No.1.
[0006] It should be noted that when the molecular marker is present, the sugar content of the tomato fruit is low and the genotype is LS; when the insertion is not present, the sugar content of the tomato fruit is high and the genotype is HS; the nucleotide sequence of the molecular marker is specifically: CATTAATACAGACT.
[0007] Preferably, the molecular marker is located at position 55102868 on chromosome 4 of tomato.
[0008] Preferably, the molecular marker is 16 bp.
[0009] In a second aspect, the present invention provides an application of the molecular marker in detecting the sugar content of tomato fruit.
[0010] Preferably, the nucleotide sequence of the forward primer of the primer set is shown as SEQ ID No. 2, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 3.
[0011] In verifying the accuracy of the above molecular markers, the forward primer of the primer set is specifically GAGGGTTATTAGGTGATAGATTGT, and the reverse primer is specifically CACTTTCAATGCCCAGGAT.
[0012] Preferably, the primer set includes an inner primer set and an outer primer set, wherein the nucleotide sequence of the forward primer Indel-Inside-F of the inner primer set is shown as SEQ ID No.4; the nucleotide sequence of the reverse primer Indel-Inside-R is shown as SEQ ID No.5; the nucleotide sequence of the forward primer Indel-Outside-F of the outer primer set is shown as SEQ ID No.6, and the nucleotide sequence of the reverse primer Indel-Outside-R is shown as SEQ ID No.7.
[0013] In the application of identifying tomato varieties, the primer set includes an inner primer set and an outer primer set, wherein the inner primer set forward primer Indel-Inside-F: ATCTCATTAAATACAGATCTTAGTATAAA, and the reverse primer Indel-Inside-R: GGTAGATTTTATACTAAGATATAATAGACTC; the outer primer set forward primer Indel-Outside-F: ATTTGTTACGATTTATTGATTCTTA, and the reverse primer Indel-Outside-R: GAGTGGCGAGTGAAACAAG.
[0014] In a third aspect, the present invention provides a method for detecting molecular markers related to sugar content in tomato fruit, comprising the following steps:
[0015] S1. Using the total DNA of the tomato to be tested as a template, PCR amplification is performed using the primer pair described in claim 7, and electrophoresis is performed for identification;
[0016] S2. When the two bands of 579 bp and 390 bp appear simultaneously in the electrophoresis results, the tomato fruit has a low sugar content. When the two bands of 563 bp and 209 bp appear simultaneously, the tomato fruit has a high sugar content.
[0017] It should be noted that the specific nucleotide sequence of 579 bp is.The 390bp nucleotide sequence is specifically ATCTCATTAAATACAGATCTTAGTATAAAATCTACCATATCATATCTTATTAATAAATAATGTTAAATTAAGTATTATTTTCTCTTTACTTAACGACGCGGTTACATCCTGGGCATTGAAAGTGAAAGGACTACTTCAAATAAGTTCAATTGAATAAAAATAATAATAATACTCGCAATGGAAGAATTCACTATTTAGAAGCTAATCGTTTAGTTACACGCTAGTTTGCAGTAATACAAATTTTATCGTATTTTGGTATTTTCAGATATGTTTTAGATATATGTATGGATACATGAAGTTAAAATTAGGAATAGGTCATTTCGAATACAATGTATCTAAGTGGACTCTCATGTAATCTCGCTCGCCAGTCTCTTGTTTCACTCGCCACTC。
[0018] The 563 bp nucleotide sequence is specifically ATTTGTTACGATTTATTGATTCTTATATTTTCATTATTTTTTTTAATTGAGTCGAGGATCCATCGAATGTATCTCTAAAGTGTGTATATTCGATTCGTTTGTGAGTCCATGTTGTGGCATTACATTAGATAATGTTGTTGTAATTAGGTACAAAGGAATAGAGGTGGAAGCTTCATTTGAGTCTATTATATCTTAGTATAAAATCTACCATATCATATCTTATTAATAAATAATGTTAAATTAAGTATTATTTTCTCTTTACTTAACGACGCGGTTACATCCTGGGCATTGAAAGTGAAAGGACTACTTCAAATAAGTTCAATTGAATAAAAATAATAATAATACTCGCAATGGAAGAATTCACTATTTAGAAGCTAATCGTTTAGTTACACGCTAGTTTGCAGTAATACAAATTTTATCGTATTTTGGTATTTTCAGATATGTTTTAGATATATGTATGGATACATGAAGTTAAAATTAGGAATAGGTCATTTCGAATACAATGTATCTAAGTGGACTCTCATGTAATCTCGCTCGCCAGTCTCTTGTTTCACTCGCCACTC。
[0019] The 209 bp nucleotide sequence is specifically ATTTGTTACGATTTATTGATTCTTATATTTTCATTATTTTTTTTAATTGAGTCGAGGATCCATCGAATGTATCTCTAAAGTGTGTATATTCGATTCGTTTGTGAGTCCATGTTGTGGCATTACATTAGATAATGTTGTTGTAATTAGGTACAAAGGAATAGAGGTGGAAGCTTCATTTGAGTCTATTATATCTTAGTATAAAATCTACC。
[0020] Preferably, the PCR reaction system includes: 13 μL Taq Master buffer, 1 μL DNA template, 1.5 μL Indel-Outside-F, 0.5 μL Indel-Outside-R, 0.5 μL Indel-Inside-F, 1.5 μL Indel-Inside-R, and H2O is added to 25 μL; the PCR amplification program is: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 50-56°C for 30 s, extension at 72°C for 1 min, 34 cycles, and a final extension at 72°C for 5 min.
[0021] Preferably, the annealing temperature in the PCR amplification procedure is 54.8°C.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] (1) The molecular markers provided by the present invention can quickly and efficiently identify the sugar content of tomato fruits and can be well applied to the screening of tomato germplasm resources for high and low sugar content in fruits.
[0024] (2) The present invention uses ARMS-PCR for identification, which is simple to operate. It only requires the use of ordinary Taq enzyme and does not require restriction endonucleases. Therefore, the cost is low and the results can be obtained in 2-3 hours. In addition, by exploring the annealing temperature and primer concentration ratio during amplification, it was found that the most suitable annealing temperature is 54.8°C and the optimal primer concentration ratio is Indel-Outside-F: Indel-Outside-R: Indel-Inside-F: Indel-Inside-R is 3:1:1:3. At this time, the detection bands are clearer and the results are more accurate. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 This is a graph showing the results of the genome-wide association analysis of SV and gene expression provided in Example 1 of the present invention;
[0026] Figure 2 Allele frequency diagrams of SVs selected in SP (P), SLC (C), heirloom (H) and modern (M) populations provided in Examples 1 and 4 of the present invention;
[0027] Figure 3 This is a correlation analysis diagram between SV genotype and gene expression level provided in Example 1 of the present invention;
[0028] Figure 4 This is a correlation analysis diagram between SV genotype and metabolite content provided in Examples 1 and 2 of the present invention;
[0029] Figure 5This is a comparison of the sequencing results at this site for three TS materials with extremely high sugar content in tomato fruits and three TS materials with extremely low sugar content in tomato fruits provided in Example 2 of the present invention;
[0030] Figure 6 The electrophoresis diagrams of TS-175 and TS-16 provided in Example 3 of the present invention at different annealing temperatures and different primer concentration ratios;
[0031] Figure 7 This is the electrophoresis diagram of 70 TS materials provided in Example 3 of the present invention at an annealing temperature of 54.8° C. and a primer concentration ratio of Indel-Outside-F:Indel-Outside-R:Indel-Inside-F:Indel-Inside-R of 3:1:1:3;
[0032] Figure 8 The electrophoretograms for the commercial varieties and breeding materials provided in Example 4 of the present invention, as well as the verification of TS-16 and TS-175;
[0033] Figure 9 This is a graph showing the sugar content of tomato fruits of eight commercial varieties and breeding materials provided in Example 4 of the present invention;
[0034] Figure 10 This is a graph showing the sugar content of tomato fruits of another eight commercial varieties and breeding materials provided in Example 4 of the present invention. DETAILED DESCRIPTION
[0035] The present invention will be further described in detail below with reference to specific embodiments so that those skilled in the art can understand the present invention more clearly.
[0036] Sources and physical and chemical parameters of key test materials:
[0037] BWM-2, BWM-3, BWM-4, BWM-5, BWM-6, Youkang 28001, Provence, Lola, Pinfan 5444, Pink Beibei, White Arrow, Tao Mengqian, Pinfan 5755, Pinfan 4945, Provence, Jingfan 309, Millennium, Pink Dan, Crisp Millennium, Hongyan, Kumquat, Zixia Fairy, Golden Beans, Red Agate, Beiweimei, Zibei, Busan 88, Wonderful, Yellow Agate, are all collected by domestic research institutes.
[0038] Example 1
[0039] By reviewing the literature, a total of 17 structural genes and regulatory genes related to tomato sugar metabolism and transport were screened. The results of eGWAS using 71,684 structural variants (SVs) combined with transcriptome data from 305 tomato materials were referred to in Wang Xin's paper (Genome of Solanum pimpinellifolium provides insights into structural variants during tomato breeding). Figure 1 As shown. It was found that 5 genes among the 17 sugar-related genes were associated with significant sites, of which 4 genes were associated with 4 cis sites. Genotype analysis of the SVs in the associated cis sites was performed, and correlation analysis between gene expression and metabolite content (Ye Jie, Transcriptome Profiling of Tomato Fruit Development Reveals Transcription Factors Associated with Ascorbic Acid, Carotenoid and Flavonoid Biosynthesis) was performed, as shown in Figure 2. Figure 2 、 3 , 4. It was found that the -10 ) SV (SV35822) can effectively distinguish the expression of SWEET 1a (Solyc04g064610) and fruit sugar content in natural populations. Therefore, the sugar-significant variant site SV35822 was used to develop a molecular marker. The relevant software used included GEMMA, GraphPad Prism, and Excel 2023.
[0040] Example 2 Detection of molecular markers related to sugar content in tomato fruit
[0041] S1. Among 70 natural population materials with both confirmed genotypes and phenotypes, 53 materials showed a 16 bp insertion at position 55102868 on tomato chromosome 4, and 17 materials did not show a 16 bp insertion at this position, with a P value of 1.164×10 -10 , and the sugar content of tomato fruits with 16bp insertion was significantly lower than that without 16bp insertion ( Figure 4 From these natural populations, we selected high-sugar-content materials TS-16, TS-83, and TS-254; and low-sugar-content materials TS-175, TS-100, and TS-194. It should be noted that the inserted 16-bp nucleotide sequence is: CATTAATACAGACT.
[0042] S2. PCR amplification and sequencing were performed using the InDel detection primers F: GAGGGTTATTAGGTGATAGATTGT, R: CACTTTCAATGCCCAGGAT. Sequencing results were compared. The PCR reaction system consisted of 13 μL Taq Master Buffer, 1 μL DNA template, 1 μL each of the forward and reverse primers, and HO to 25 μL. The PCR amplification program was as follows: 34 cycles of initial denaturation at 94°C for 3 minutes, denaturation at 94°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 72°C for 1 minute, followed by a final extension at 72°C for 5 minutes.
[0043] The results showed that: there was no 16bp nucleotide sequence insertion in the three selected TS materials with high sugar content in tomato fruits, but there was a 16bp nucleotide sequence insertion in the three selected TS materials with low sugar content in tomato fruits (such as Figure 5 Therefore, this SV can be selected to develop molecular markers related to the sugar content of tomato fruit.
[0044] Example 3 Identification of tomato sugar content using molecular markers related to tomato fruit sugar content
[0045] (1) Primer design process
[0046] Primers were designed using Primer 5.0 based on the ARMS-PCR principle and primer design principles. The primers included specific inner primers and shared outer primers. The specific inner primers ensured their specific sites were at the 3' end of the primers and were synthesized by Qingke Biotechnology Co., Ltd. The specific primer sequences are as follows:
[0047] Indel-Outside-F:ATTTGTTACGATTTATTGATTCTTA;
[0048] Indel-Outside-R:GAGTGGCGAGTGAAACAAG;
[0049] Indel-Inside-F:ATCTCATTAAATACAGATCTTAGTATAAA;
[0050] Indel-Inside-R:GGTAGATTTTATACTAAGATATAATAGACTC.
[0051] (2) Extraction of total DNA from samples
[0052] Take the sample and add 750μL CTAB solution, grind at 60Hz for 90s; after grinding, place in a water bath at 65℃ for 1-2h; add 750μL chloroform-isoamyl alcohol solution, where the volume ratio of chloroform to isoamyl alcohol is 24:1, invert 100 times, and centrifuge at 10000rpm for 10min; take the supernatant solution and add it to a 1.5mL centrifuge tube and add 400μL isopropanol solution and gently invert 20 times; freeze in a -20℃ refrigerator for 10min; after freezing, centrifuge at 10000rpm for 5min and discard the supernatant solution; wash the precipitate with 75% alcohol and discard the alcohol, and place it in a fume hood to allow the alcohol to evaporate completely; add 50μL ddH2O to dissolve the DNA and store in a -20℃ refrigerator for later use.
[0053] (3) PCR amplification
[0054] In order to further explore the effects of annealing temperature and primer concentration on the results during PCR, the following experiments were conducted using TS-175 and TS-16 in Example 2 as sample DNA templates:
[0055] The PCR reaction system is as follows:
[0056] When the primer ratio is 1:1:1:1, the PCR reaction system includes 13 μL Taq Master buffer, 1 μL DNA template, 1 μL Indel-Outside-F, 1 μL Indel-Outside-R, 1 μL Indel-Inside-F, 1 μL Indel-Inside-R, and HO to 25 μL.
[0057] The PCR reaction conditions were as follows: the reaction solutions were placed in a PCR instrument for temperature gradient amplification at 56-50°C, pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 60-50°C for 30 s, extension at 72°C for 1 min, 34 cycles, and finally extension at 72°C for 5 min.
[0058] When the primer ratio is 1:1:1:1, the PCR reaction system includes 13 μL Taq Master buffer, 1 μL DNA template, 1 μL Indel-Outside-F, 1 μL Indel-Outside-R, 1 μL Indel-Inside-F, 1 μL Indel-Inside-R, and HO to 25 μL.
[0059] The PCR reaction conditions were as follows: the reaction solutions were placed in a PCR instrument for amplification, pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 53.7°C for 30 s, extension at 72°C for 1 min, 34 cycles, and finally extension at 72°C for 5 min.
[0060] When the primer ratio was 3:1:1:3, the PCR reaction system included 13 μL Taq Master buffer, 1 μL DNA template, 0.5 μL Indel-Outside-F, 1.5 μL Indel-Outside-R, 0.5 μL Indel-Inside-F, 1.5 μL Indel-Inside-R, and HO to 25 μL.
[0061] The PCR reaction conditions were as follows: the reaction solutions were placed in a PCR instrument for amplification, pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 52.3°C / 54.8°C for 30 s, extension at 72°C for 1 min, 34 cycles, and finally extension at 72°C for 5 min.
[0062] Agarose gel electrophoresis: Take 5 μL of PCR product and add it to 2% agarose gel, run electrophoresis at 150V for 2 min, and observe the results on the gel imaging system ( Figure 6 ).
[0063] Depend on Figure 6 The results showed that when a 579bp and a 390bp band appeared, it indicated that the genotype was LS type and the phenotype was low sugar content type of the fruit; when a 563bp and a 209bp band appeared, it indicated that the genotype was HS type and the phenotype was high sugar content type of the fruit; when bands of 579bp, 390bp, 563bp, and 209bp appeared, it indicated that the genotype was heterozygous, but since the size difference between the 579bp and 563bp bands was very small, the appearance of three bands in the gel imaging system indicated a heterozygous type.
[0064] When the primer ratio was 1:1:1:1 and the annealing temperatures were 56°C, 55°C, 54.8°C, 53.7°C, and 52.3°C, the TS-175 amplified band sizes were 579bp and 390bp, and the TS-16 amplified band sizes were 563bp and 209bp. However, the brightness of the 579bp band was not as high as that of the 563bp band, but the genotypes could still be distinguished.
[0065] When the primer concentration ratio was 1:1:1:1 and the annealing temperature was 53.7°C, TS-175 amplified 579bp, but TS-16 did not amplify 563bp, indicating that the specificity of the primers at this primer ratio and annealing temperature was unstable.
[0066] When the primer ratio was 3:1:1:3 and the annealing temperatures were 52.3°C and 54.8°C, the amplified band sizes for TS-175 were 579 bp and 390 bp, and the amplified band sizes for TS-16 were 563 bp and 209 bp. However, primer dimers appeared at 52.3°C. Therefore, at this primer ratio, the primers showed strong specificity at 54.8°C.
[0067] Verification of the effects of annealing temperature and primer ratio on marker detection
[0068] To further verify the detection effect when the annealing temperature was 54.8°C and the primer concentration ratio was 3:1:1:3, 70 TS materials in Example 2 were used for ARMS-PCR amplification. The results are shown in Table 2. Figure 7 .
[0069] Depend on Figure 7 The results showed that of the 70 DNA samples, the ARMS-PCR amplified band sizes matched the known genotypes from resequencing for 66 samples, while the ARMS-PCR amplified band sizes did not match the genotypes for 4 samples. Of these four discrepant DNA samples, TS-138, TS-140, and TS-158 had HS genotypes from resequencing, LS genotyping from molecular markers, and LS sequencing results, respectively. Their sugar contents were 4.10, 4.10, and 6.20, respectively. TS-90 had LS genotypes from resequencing, HS genotyping from molecular markers, and HS sequencing results, respectively, with a sugar content of 4.6. The molecular marker genotypes for all four DNA samples were consistent with the sequencing results, demonstrating the high accuracy of the marker. Sugar content in tomatoes is a quantitative trait controlled by multiple genes, and discrepancies between phenotype and genotype can occur in a few natural populations. The band size amplified by ARMS-PCR using this primer was consistent with the phenotype of the natural population at a rate of 97.05% (the number of DNA samples that were consistent with the phenotype was 68, with a total number of samples of 70). This molecular marker is feasible for detecting the sugar content of tomato fruit.
[0070] Example 4 Application
[0071] This example uses commercial varieties and breeding varieties for relevant verification, and the specific steps are as follows:
[0072] 28 commercial varieties and breeding materials (BWM-2, BWM-3, BWM-4, BWM-5, BWM-6, Youkang 28001, Provence, Lola, Pinfan 5444, Fenbeibei, Baijian, Taomengqian, Pinfan 5755, Pinfan 4945, Provence, Jingfan 309, Qianxi, Fendan, Cuiqianxi, Hongyan, Jinju, Zixiaxianzi, Jindoudou, Hongmanyu, Beiweimei, Zibei, Busan 88, Jingcai, Huangmanyu) were selected and ARMS-PCR detection was performed as described in Example 3 using the molecular markers provided in Example 2. The detection results of the 28 commercial varieties and breeding materials are shown in FIG. Figure 8 .
[0073] Depend on Figure 2 、 Figure 8 、 Figure 9 、 Figure 10 The results show that due to natural selection and artificial domestication, more than 65% of the genotypes of modern large-fruited tomatoes, commercial varieties and breeding varieties are LS types ( Figure 2 ), which has a relatively low sugar content. However, natural populations contain germplasm with high sugar content. Therefore, this molecular marker can be used to screen for germplasm with high sugar content in natural populations, broadening the range of parent selection and providing a path for the breeding of high-sugar tomato fruit varieties.
[0074] The raw materials not specifically described in the present invention are all existing materials that can be directly purchased from the market.
[0075] The above is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A method for detecting molecular markers related to sugar content in tomato fruit, characterized in that: The following steps are involved: S1. Using the total DNA of the tomato to be tested as a template, PCR amplification is performed using a primer pair and electrophoresis is performed for identification; the primer pair comprises an inner primer set and an outer primer set, wherein the nucleotide sequence of the inner primer set forward primer Indel-Inside-F is shown as SEQ ID No. 4; the nucleotide sequence of the reverse primer Indel-Inside-R is shown as SEQ ID No. 5; the nucleotide sequence of the outer primer set forward primer Indel-Outside-F is shown as SEQ ID No. 6, and the nucleotide sequence of the reverse primer Indel-Outside-R is shown as SEQ ID No. 7; S2. When the two bands of 579 bp and 390 bp appear simultaneously in the electrophoresis results, the tomato fruit has a low sugar content. When the two bands of 563 bp and 209 bp appear simultaneously, the tomato fruit has a high sugar content.
2. The detection method according to claim 1, wherein The PCR reaction system included 13 μL Taq Masterbuffer, 1 μL DNA template, 1.5 μL Indel-Outside-F, 0.5 μL Indel-Outside-R, 0.5 μL Indel-Inside-F, 1.5 μL Indel-Inside-R, and H2O to 25 μL. The PCR amplification procedure included pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 50-56°C for 30 s, extension at 72°C for 1 min, 34 cycles, and a final extension at 72°C for 5 min.
3. The detection method according to claim 2, characterized in that The annealing temperature in the PCR amplification program is 54.8°C.
Citation Information
Patent Citations
Molecular marker related to length of fruit stem of tomato fruit and application of molecular marker
CN117512167A