Electrochemical sensor for visual detection of pefloxacin as well as preparation method and application of electrochemical sensor

Abstract

The invention discloses an electrochemical sensor for pefloxacin visual detection and a preparation method and application thereof.The electrochemical sensor is of an open type double-electrode structure and comprises a conductive glass substrate, a detection area and a signal output area are arranged on the conductive glass substrate, and ZIF-67 is dropwise added to the detection area. The sensor is processed on a conductive glass substrate through electrodeposition and laser etching technologies, the color development length of a signal output area is changed by changing the impedance of a detection area, and rapid and sensitive detection of pefloxacin can be realized based on the distance change.

Description

Technical Field

[0001] The invention belongs to the technical field of rapid antibiotic detection, and in particular relates to an electrochemical sensor for visual detection of pefloxacin and a preparation method and application thereof. Background Art

[0002] Pefloxacin (PEF) is a broad-spectrum fluoroquinolone antibiotic, mainly used to treat a variety of infections caused by sensitive bacteria. However, due to its excellent drug properties, fewer side effects and relatively low price, PEF is illegally used as a growth promoter for poultry, which has caused a series of food safety issues. In addition, PEF has poor degradability and strong water solubility. Improper use will lead to its continuous accumulation in the environment. This accumulation not only exists in animals, but also appears in wastewater and soil, posing a serious threat to human health. Therefore, in order to accurately evaluate PEF residues in actual environments (such as food, water environment, etc.), rapid detection technology for pefloxacin has become particularly important.

[0003] Rapid detection technology generally refers to technology that can provide test results in a short time (usually within a few minutes to a few hours), which is of great significance in clinical treatment and food safety. Common rapid detection technologies for pefloxacin mainly include immunochromatography and enzyme-linked immunosorbent assay. Immunochromatography is a rapid detection method based on antigen-antibody reaction. It reflects the sample concentration by aggregating and coloring the nanogold on the test strip. It is usually used for rapid on-site detection, which is simple to operate and does not require complex instruments. Enzyme-linked immunosorbent assay is based on the principle of antigen-antibody reaction. It produces a detectable signal through the reaction of enzyme-labeled antibodies or antigens with substrates, thereby realizing the detection of target molecules. The above two methods rely on the change of color depth for the detection of PEF, which can easily realize qualitative detection. However, when performing quantitative detection, it is necessary to accurately determine the degree of color change. In the process of visual detection relying on optical signal changes, the key to ensuring the accuracy of the test results is to accurately capture the signal intensity. When people observe the color changes of materials with the naked eye, it is difficult to ensure the consistency of the test results due to the differences in individual sensitivity to color. When using a camera or other equipment to capture and analyze the grayscale or RGB values ​​of an image, it is necessary to ensure that the sensor performance, exposure settings, and ambient lighting are consistent for each test, which may be difficult in actual operation. In addition, when testing various samples, due to the complexity of the sample composition, the sample solution itself may be colored or turbid, which may interfere with the precise measurement of the optical signal intensity, whether observed by the naked eye or captured by a camera, and thus affect the accurate and rapid determination of PEF. Summary of the invention

[0004] Technical problems solved: In response to the above technical problems, the present invention provides an electrochemical sensor for visual detection of pefloxacin and a preparation method and application thereof, which can effectively solve the above-mentioned shortcomings that naked eye observation or camera photography may interfere with the precise measurement of optical signal intensity, thereby affecting the accurate and rapid determination of pefloxacin.

[0005] Technical solution: In the first aspect, the present invention provides an electrochemical sensor for visual detection of pefloxacin, wherein the electrochemical sensor is an open dual-electrode structure, which includes a conductive glass substrate, on which a detection area and a signal output area are provided, and ZIF-67 is dropped into the detection area.

[0006] In a second aspect, the present invention provides a method for preparing the electrochemical sensor according to the first aspect, comprising the following steps: S1. Preparation of ZIF-67 material: 2-methylimidazole and cobalt nitrate hexahydrate were dissolved in methanol in proportion, mixed and stirred, and centrifuged after the reaction to obtain a purple precipitate, which was washed with methanol, vacuum dried, and then transferred to a mortar, crushed into powder, and collected for later use; S2. Electrode processing: S2-1, pretreatment of the substrate: the conductive glass is cut into a preset size as the substrate of the electrochemical sensor, a series of cleaning operations are performed on the substrate, and then it is dried with a nitrogen flow to obtain a dried substrate, which is stored in a clean container for later use; S2-2. Shielding the detection area of ​​the electrochemical sensor: placing the dried substrate in an electroplating solution composed of HCl, K3[Fe(CN)6] and FeCl3, depositing Prussian blue in the signal output area using a constant voltage method, using Pt wire and Ag / AgCl electrode as the counter electrode and reference electrode respectively, and the sensor substrate as the working electrode; after the deposition is completed, rinse it clean and place it in an oven for drying; then, the designed detection area and signal output area are etched onto the substrate by laser etching technology; S2-3. Modify the detection area: Use brown insulating tape to stick around the detection area, use a pipette to draw ZIF-67 dispersion solution and drop it into the detection area, place the electrode under an infrared lamp to heat and dry, and then transfer the sample to an oven for drying; add pefloxacin aptamer solution to the detection area again and store it at 4 °C for 12 h. After the aptamer is assembled, rinse the detection area with phosphate buffer (pH=7.4), and finally add BSA to the detection area and incubate at 4 °C for 1 h to block inactive sites.

[0007] Preferably, in step S1, the mass ratio of cobalt nitrate hexahydrate to 2-methylimidazole is 1:4 to 1:10.

[0008] Preferably, the specific process of the series of cleaning operations in step S2-1 is: immersing the electrode in a 0.1 M NaOH solution and boiling it for 30 min, and then ultrasonically treating it in toluene, acetone, ultrapure water and ethanol for 30 min in sequence after cooling.

[0009] Preferably, the molar concentrations of HCl, K3[Fe(CN)6] and FeCl3 in the electrodeposition solution in step S2-2 are all 5 mM.

[0010] In a third aspect, the present invention provides use of the electrochemical sensor described in the first aspect or the electrochemical sensor prepared by the preparation method described in the second aspect in detecting pefloxacin.

[0011] Preferably, the concentration of pefloxacin to be tested is 5 ng / mL-250 ng / mL.

[0012] Preferably, the length L of the output region Prussian white is related to the concentration C of pefloxacin PEF The relationship is L=0.0923C PEF +1.86, where L is in mm, C PEF The unit is ng / mL.

[0013] Beneficial effects: The present invention is a pefloxacin distance readout visualization electrochemical sensor based on an open bipolar electrode structure, which is processed on a conductive glass substrate by electrodeposition and laser etching technology. By changing the impedance of the detection area, the color development length of the signal output area changes, and based on the distance change, rapid and sensitive detection of pefloxacin can be achieved. The present invention has developed a low-cost portable detection device through innovative structural design and advanced processing technology, and detection can be completed by naked eyes without professional equipment. At the same time, based on the open bipolar electrode structure, the detection area and the signal area are not in direct contact, which effectively avoids the interference of the sample color on the visualization signal. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is a diagram of the mechanism of the sensor of the present invention for detecting pefloxacin (PEF); Figure 2 It is a relationship diagram between the detection of different concentrations of PEF and the length of the signal output area of ​​the sensor of the present invention; Figure 3 is a schematic diagram of the preparation of the sensor substrate; Figure 4The electrochemical impedance spectroscopy test results (A) and the sensor detection results under an applied voltage of -2.0 V and placed in 0.1 MKCl solution (B). The PEF concentration in (A) is 150 ng / mL, and in (B) a: ZIF-67 / FTO, b: PEF-Aptamer / ZIF-67 / FTO, c: PEF / PEF -Aptamer / ZIF-67 / FTO; Figure 5 The optimization results of different molar ratios of cobalt nitrate hexahydrate to 2-methylimidazole in ZIF-67 material (a: 1:10, b: 1:8, c: 1:6 and d: 1:4) (A), KCl concentration optimization results (B), applied voltage optimization results (C) and PEF aptamer concentration optimization results (D); Figure 6 It is a schematic diagram of the anti-interference experimental results of the sensor of the present invention. DETAILED DESCRIPTION

[0015] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments: Example 1: Detection mechanism and verification Detection mechanism Figure 1 As shown: Through Prussian blue (PB) electrodeposition and laser etching technology, the detection area and signal output area with an open bipolar electrode structure were processed on the FTO substrate. Then ZIF-67 was dripped into the detection area as a carrier for fixing the PEF aptamer, thus completing the construction of the biosensor. When a suitable voltage is applied to the detection area, electrons flow from the detection area to the electrolyte (0.1 M KCl) solution, and then the electrons in the solution undergo a redox reaction with the PB in the signal output area, causing it to change from blue to colorless Prussian white (PW) according to the electrochromic properties of PB. When PEF is not added, because the impedance of the detection area is large and the current in the electrolyte solution is small, the bipolar electrode partial pressure is small, and the color change potential of PB cannot be reached, and no color change occurs. When the biological probe PEF aptamer on the sensor binds to the detection target PEF, a specific reaction occurs between them to form a stable complex, which is then separated from the ZIF-67 material, subsequently causing the impedance of the sensor detection area to decrease, the current to increase, and the partial pressure on the bipolar electrode to increase. The higher the voltage, the longer the color change distance. Ultimately, by evaluating the length of the colorless part of the sensor signal output area, the concentration of the detection target PEF can be quantified.

[0016] Verification of detection mechanism: Electrochromic tests and electrochemical impedance spectroscopy (EIS) measurements were performed on ZIF-67 / FTO, PEF aptamer / ZIF-67 / FTO, and PEF / PEF aptamer / ZIF-67 / FTO. In electrochemical impedance spectroscopy, the radius of the Nyquist circle is equal to the electron transfer resistance ( R et ) and the charge transfer resistance ( R ct ), which are the main parameters of electron transfer kinetics of redox probes. Figure 4 A shows the different electron transfer capabilities of the electrode surface tested by EIS. It can be seen from the figure that PEF aptamer / ZIF-67 / FTO (b) R et is greater than that of ZIF-67 / FTO (a), which is because the redox probe [Fe(CN)6] 3- / 4- When 150 ng / mL PEF solution was added, the PEF-aptamer complex was released from the electrode surface, resulting in a decrease in steric hindrance. Therefore, the PEF / PEF aptamer / ZIF-67 / FTO (c) R et Reduce. Figure 4 As shown in B, when the detection area is only modified by ZIF-67 MOF, the length of Prussian white (PW) in the signal output channel is 22 mm (a). After modification with PEF aptamer, the length is shortened to 8 mm (b). After adding 150 ng / mL PEF, the length of PW of PEF / PEF aptamer / ZIF-67 / FTO (c) is 18 mm. This result shows that the target is separated from the sensor surface after binding with the aptamer, and the R et The above experiments prove the detection principle of the sensor developed by the present invention and make it clear that it has the ability to detect PEF.

[0017] Example 2: Preparation of sensor The preparation method of the electrochemical sensor for visual detection of pefloxacin comprises the following steps: S1. Preparation of ZIF-67 materials: 6.49 g of 2-methylimidazole and 2.93 g of cobalt nitrate hexahydrate

[101] were weighed and dissolved in 200 mL of methanol, respectively. The above solutions were then mixed and stirred at room temperature for 8 h. After the reaction was completed, the product was centrifuged at 7000 rpm for 5 min, and the purple precipitate was collected, washed with methanol, and finally dried under vacuum at 353 K for 24 h. After drying, the solid product was transferred to a mortar, crushed into powder, and collected for later use. Different ratios of ZIF-67 MOF materials were operated according to the molar ratio of cobalt nitrate hexahydrate to 2-methylimidazole of 1:4, 1:6, and 1:10, and the rest of the steps were the same.

[0018] S2. Electrode processing, such as Figure 3 As shown: S2-1. Pretreatment of the substrate: First, cut the FTO conductive glass into a size of 61 mm × 16 mm as the substrate of the sensor. Subsequently, the cut FTO substrate is subjected to a series of cleaning steps to eliminate fat-soluble and water-soluble contaminants. The specific steps are as follows: Soak the electrode in a 0.1 M NaOH solution and boil it for 30 min. After cooling, ultrasonically treat it in toluene, acetone, ultrapure water and ethanol for half an hour in turn. After cleaning, dry it with a nitrogen (N2) flow and carefully store it in a clean container for later use; S2-2. Shield the detection area of ​​the electrochemical sensor: Place the dried substrate in an electroplating solution of 5 mM HCl, 5 mM K3[Fe(CN)6] and 5 mM FeCl3, and deposit Prussian blue (PB) in the signal output area by using a constant voltage method of 0.3 V and 75 s. Use Pt wire and Ag / AgCl electrode as the counter electrode and reference electrode, respectively, and the sensor substrate as the working electrode. After the deposition is completed, use ultrapure water to wash the electrochromic area to rinse off the excess PB solution. In order to fix PB on the electrode surface, place the deposited FTO in an oven at 60 ° C overnight. Then, the designed detection area and signal output area are etched onto the FTO by laser etching technology. The etching pattern consists of a detection area of ​​1 cm×1 cm and a signal output area of ​​26 mm×2.5 mm. S2-3. Modify the detection area: Brown insulating tape (1.3 cm × 1.3 cm × 0.15 mm) was applied around the detection area to prevent liquid leakage. 20 L of ZIF-67 dispersion solution (2 mg / mL) was pipetted onto the detection area and the electrode was placed under an infrared lamp to heat and dry. The sample was then transferred to an oven and baked at 60 °C for 3 h to improve the adhesion between the material and the electrode surface. After ZIF-67 was firmly fixed on the detection area, 20 L of PEF aptamer solution was added to the detection area again and stored at 4 °C for 12 h for aptamer assembly. After the aptamer assembly was completed, the detection area was rinsed with phosphate buffer (pH = 7.4) to remove the unbound aptamer from the electrode surface. Finally, 20 L of bovine serum albumin (BSA) was added to the detection area and incubated at 4 °C for 1 h to block the inactive sites. The sequence of the PEF aptamer (SEQ ID NO. 1) is: 5′-ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG-3′. The PEF aptamer solution was prepared to the required concentration using 0.1 M phosphate buffer solution (PBS), pH = 7.4, as a solvent and stored in a refrigerator at 4 ºC.

[0019] Example 3: Confirmation of linear relationship Based on the sensor modified with the PEF aptamer in Example 2, 20 µL of PEF antibiotics were dripped into the detection area at concentrations of 5 ng / mL, 20 ng / mL, 50 ng / mL, 100 ng / mL, 150 ng / mL, 200 ng / mL and 250 ng / mL, respectively. The sensor containing antibiotics was then placed in a 37 °C constant temperature water bath oscillator and incubated for 40 minutes to allow specific binding between the aptamer and the PEF antibiotic. Subsequently, the sensor was washed 2-3 times with PBS buffer solution in the detection area to remove unreacted antibiotics and reduce experimental errors. After cleaning, the sensor was placed in a 0.1 M electrolyte solution, and a constant voltage of -2.0 V was applied to the sensor using a regulated DC power supply for 10 minutes. The detection results of the sensor are shown in Figure 2 The linear relationship between PEF concentration and the length of the signal output region PW is shown in the figure, ranging from 5 ng / mL to 250 ng / mL, L=0.0923C PEF +1.86 (where L represents PW length and C represents PEF concentration). Correlation coefficient R 2 The detection limit was 1.42 ng / mL (signal-to-noise ratio was 3).

[0020] Example 4: Optimization of sensor preparation conditions In order to achieve the best analytical performance, the experimental conditions of ZIF-67 MOF materials and sensors were adjusted and optimized. Figure 5 A shows the results of electrochemical impedance spectroscopy. In the preparation process of ZIF-67 material, different molar ratios of cobalt nitrate hexahydrate and 2-methylimidazole will lead to the synthesis of MOF materials. R et After the experiment, we chose a synthesis method with a molar ratio of 1:8. Then, the concentration of the electrolyte solution where the sensor is located was compared. Figure 5 As shown in Figure B, when the electrolyte solution concentration reaches 0.1 M, the PW length of the signal output area remains basically unchanged. For this reason, the concentration of the KCl solution we selected is 0.1 M. In addition, the voltage applied to the sensor is also optimized, and the results are shown in Figure 2. Figure 5 As shown in Figure C, when only ZIF-67 is added to the detection area, it can be seen that at -1.7 V, the output distance of PW is short. When the voltage is increased to -2.1 V, all the existing PB is converted into PW. However, it is necessary to consider the PEF detection mechanism and detection range, so -2.0 V is selected for the sensor external voltage. Figure 5 D It can be seen that when the PEF aptamer concentration reaches 3.0 μM, the PW color change length reaches a stable state, so 3.0 μM is selected as the optimal aptamer concentration for the sensor.

[0021] Example 5: Antibiotic Detection On the sensor detection area where the PEF aptamer has been modified, 20 µL of PEF antibiotics with a concentration of 5-250 ng / mL was continued to be dripped, and then the sensor containing antibiotics was placed in a constant temperature water bath oscillator at 37 °C for 40 min to promote the specific binding between the PEF antibiotics and the aptamer. Subsequently, the sensor was washed 2-3 times with PBS buffer solution in the detection area to remove unreacted antibiotics and reduce experimental errors. After washing, the sensor was placed in a 0.1 M electrolyte solution, and a constant voltage of -2.0 V was applied to the sensor using a regulated DC power supply for 10 min.

[0022] In order to further verify the practical value of the sensor, this example explores the selectivity and stability of the sensor. Figure 6In the study, an anti-interference experiment was carried out on the sensor, and the detection ability of the sensor for seven antibiotics, including PEF, aspirin, cefaclor, cefotaxime, amoxicillin, ceftriaxone and penicillin, was tested. It was found that the response of the sensor to PEF was much higher than that of other antibiotics, highlighting the specific recognition of PEF by the aptamer and the excellent selectivity of the sensor for the detection of PEF.

[0023] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An electrochemical sensor for visual detection of pefloxacin, characterized in that: The electrochemical sensor is an open double-electrode structure, which includes a conductive glass substrate. A detection area and a signal output area are provided on the conductive glass substrate, and ZIF-67 is dropped into the detection area.

2. A method for preparing an electrochemical sensor according to claim 1, characterized in that: The following steps are involved: S1. Preparation of ZIF-67 material: 2-methylimidazole and cobalt nitrate hexahydrate were dissolved in methanol in proportion, mixed and stirred, and centrifuged after the reaction to obtain a purple precipitate, which was washed with methanol, vacuum dried, and then transferred to a mortar, crushed into powder, and collected for later use; S2. Electrode processing: S2-1, pretreatment of the substrate: the conductive glass is cut into a preset size as the substrate of the electrochemical sensor, a series of cleaning operations are performed on the substrate, and then it is dried with a nitrogen flow to obtain a dried substrate, which is stored in a clean container for later use; S2-2, shielding the detection area of ​​the electrochemical sensor: placing the dried substrate in an electrodeposition solution composed of HCl, K3[Fe(CN)6] and FeCl3, depositing Prussian blue in the signal output area by a constant voltage method, using a Pt wire and an Ag / AgCl electrode as a counter electrode and a reference electrode, respectively, and the sensor substrate as a working electrode; After the deposition is completed, rinse it clean and place it in an oven to dry; then use laser etching technology to etch the designed detection area and signal output area onto the substrate; S2-3. Modify the detection area: Use brown insulating tape to stick around the detection area, use a pipette to draw ZIF-67 dispersion solution and drop it into the detection area, place the electrode under an infrared lamp to heat and dry, and then transfer the sample to an oven for drying; add pefloxacin aptamer solution to the detection area again and store it at 4 °C for 12 h. After the aptamer is assembled, rinse the detection area with phosphate buffer (pH=7.4), and finally add BSA to the detection area and incubate at 4 °C for 1 h to block inactive sites.

3. The preparation method according to claim 2, characterized in that: In step S1, the mass ratio of cobalt nitrate hexahydrate to 2-methylimidazole is 1:4-1:

10.

4. The preparation method according to claim 2, characterized in that The specific process of the series of cleaning operations in step S2-1 is: immersing the electrode in a 0.1 M NaOH solution and boiling it for 30 min, and then ultrasonically treating it in toluene, acetone, ultrapure water and ethanol for 30 min in sequence after cooling.

5. The preparation method according to claim 2, characterized in that: The molar concentrations of HCl, K3[Fe(CN)6] and FeCl3 in the electrodeposition solution in step S2-2 are all 5 mM.

6. Use of the electrochemical sensor according to claim 1 or the electrochemical sensor prepared by the preparation method according to any one of claims 2 to 5 in detecting pefloxacin.

7. The use according to claim 6, characterized in that: The concentration of pefloxacin to be tested is 5 ng / mL-250 ng / mL.

8. The use according to claim 6, characterized in that: Output area Prussian white length L and pefloxacin concentration C PEF The relationship is L=0.0923C PEF +1.86, where L is in mm, C PEF The unit is ng / mL.

Images