Probiotic vaccines and related methods of use

Abstract

Provided herein are probiotic vaccines comprising a recombinant filamentous bacteriophage genome comprising a nucleic acid encoding a polypeptide comprising an exogenous peptide epitope, or a fragment or variant thereof, selected from the group consisting of: LPESFDGDPASNTAPLQPEQLQVF "SEQ ID NO: 1; HER2". In particular embodiments of the vaccine of the invention, exogenous peptide epitopes are functionally expressed on a coat protein selected from the group consisting of: piII, pVI, pVII, pVIII, and pIX. Also provided herein are methods of preventing or treating cancer comprising administering to a patient in need thereof one or more probiotic vaccines provided herein; or one or more recombinant bacteriophages provided herein.

Description

[0001] Related Applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63,311,977 filed on February 19, 2022, U.S. Provisional Patent Application No. 63 / 312,052 filed on February 20, 2022, and U.S. Provisional Patent Application No. 63 / 321,638 filed on March 18, 2022, each of which is incorporated herein by reference in its entirety. Background Art Field of the Invention

[0003] The present invention relates to a recombinant bacteriophage, a probiotic vaccine and a method of using the same. Background Art

[0005] Cancer is more common today due to genetic abnormalities and epigenetic alterations in cellular development and apoptotic pathways. Tumor development and growth is caused by overexpression of genes associated with cell growth and proliferation in cancer and underexpression of genes regulating cell death activities. Alterations in cellular pathways are often caused by random mutations and unhealthy lifestyle habits. Immunocompetent individuals are prone to natural immune alterations that involve activation of multiple immune responses to destroy competent tumor cells. Tumorigenic cells are undergoing apoptosis and necrosis, surrounding tissues are experiencing stress, and the microbiota in the gut all generate anti-cancer immune responses and signals.

[0006] Immunotherapy is a form of cancer treatment that activates the immune system to attack and destroy cancer cells. Cytotoxic T lymphocytes ("CTLs") are essential for a successful anti-tumor immune response. T cells that attack cancer cells need to present tumor antigens to naive T cells, which undergo activation, clonality expansion, and ultimately exert their cytolytic effector function. Effective antigen presentation is essential for the success of CTL effector function. Therefore, developing a successful strategy to initiate presentation of tumor antigens to T cells is critical to immunotherapeutic strategies for cancer treatment.

[0007] Similarly, B cells can inhibit tumor development by producing tumor-reactive antibodies, promoting NK cell killing of tumors, promoting macrophage phagocytosis, and promoting the activation of CD4+ and CD8+ T cells. B cells can promote tumor development by producing autoantibodies and tumor growth factors.

[0008] Since the clinical outcomes of many types of cancer range from poor to fatal, the development of new preventive and / or curative treatments is highly desirable. Summary of the invention

[0009] Provided herein is a probiotic vaccine comprising:

[0010] A recombinant filamentous phage genome comprising a nucleic acid encoding a polypeptide comprising an exogenous peptide epitope or a fragment or variant thereof, wherein the exogenous peptide epitope is selected from the group consisting of:

[0011] LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1; HER2),

[0012] PESFDGDPASNTAPLQPEQLQ(SEQ ID NO:2; HER2),

[0013] QPEKVQTLEAWVIHGG (SEQ ID NO: 3; CD38),

[0014] ISKRNIQFSCKNIYR (SEQ ID NO:4; CD38),

[0015] TFGSVEVHNL (SEQ ID NO:5; CD38),

[0016] QTLEA (SEQ ID NO: 6; CD38),

[0017] IQFSC (SEQ ID NO:7; CD38), and

[0018] AFPEDRSQPG (SEQ ID NO: 8; PD-1); and

[0019] Bacteria infected with the recombinant phage.

[0020] In a specific embodiment of the vaccine of the invention, the foreign peptide epitope is functionally expressed on a coat protein selected from the group consisting of: pill, pVI, pVII, pVIII and pIX. In a specific embodiment, the coat protein is pill.

[0021] In other embodiments, the phage is selected from the group consisting of: filamentous phage, including M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE; M13K3; Myoviridae (Pl-like viruses; P2-like viruses; μ-like viruses; SPOl-like viruses; phiH-like viruses); Siphoviridae (λ-like viruses, γ-like viruses, Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses; N15-like viruses); Podoviridae (Podoviridae) (P1-like viruses; P2-like viruses; μ-like viruses; SPOl-like viruses; phiH-like viruses); ridae (phi29-like virus; P22-like virus; N4-like virus); Tectiviridae (Tectivirus); Corticoviridae (Corticovirus); Lipothrixviridae (Alphalipothrixvirus, Betalipothrixvirus, Gammalipothrixvirus, Deltalipothrixvirus) Viruses (Deltapothrixvirus); Plasmaviridae (Plasmavirus); Rudiviridae (Rudivirus); Fuselloviridae (Fusellovirus); Inoviridae (Inovirus, Plectrovirus, M13-like virus, fd-like virus); Microviridae (Microvirus, Spiromicrovirus, Bdellomicrovirus, Chlamydiamicrovirus); Leviviridae (Levivirus, Allolevivirus) and Cystoviridae (Cystovirus). In a specific embodiment, the bacteriophage is M13K3.

[0022] In other embodiments, the bacteria (e.g., probiotics) infected by the recombinant bacteriophage of the invention provided herein can be selected from: Escherichia coli Nissle 1917, Escherichia coli ER2738, Bacillus amyloliquefaciens; Bacillus polyfermenticus, strain Bispan; Bifidobacterium animalis subsp. Lactis, strain BB-12; Bifidobacterium animalis subsp. Lactis, strain GPS1209; Bifidobacterium animalis subsp. Lactis, strain HN019 (DR1064); Bifidobacterium bifidum, strain BB-12; Bifidobacterium bifidum, strain Rosell-71; Bifidobacterium breve, strain M-16V; Bifidobacterium longum longum; Bifidobacterium thermophilum; Lactobacillus acidophilus, strain La-1; Lactobacillus brevis, strain HA-112; Lactobacillus fermentum, strain HA-179; Lactobacillus helveticus, strain Lafti L10; Lactobacillus helveticus, strain Rosell-52; Lactobacillus paracasei, strain Lafti L26; Lactobacillus paracasei subsp. paracasei, strain 431; Lactobacillus rhamnosus, strain HN001 (DR20); Streptococcus salivarius, strain DSM 13084; Streptococcus thermophilus thermophilus; Bacillus coagulans GBI-30, 6086, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium longum subsp. infantisinfantis), Escherichia coli Nissle 1917, Escherichia coli ER2738, Lactobacillus acidophilus NCFM, Lactobacillus paracasei Stl 1 (or NCC2461), Lactobacillus johnsonii Lai (also known as Lactobacillus LCI, Lactobacillus johnsonii NCC533), Lactobacillus plantarum 299v, Lactobacillus reuteri ATCC 55730 (Lactobacillus reuteri SD2112), Lactobacillus reuteri Protectis (DSM 17938, a progeny strain of ATCC 55730), Lactobacillus reuteri Prodentis (a combination of DSM17938 / ATCC 55730 and ATCC PTA 5289), Lactobacillus rhamnosus GG, Saccharomyces boulardii boulardii), a mixture of Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14, a mixture of Lactobacillus acidophilus NCFM and Bifidobacterium bifidum BB-12, a mixture of Lactobacillus acidophilus CL1285 and Lactobacillus casei LBC80R, a mixture of Lactobacillus plantarum HEAL 9 and Lactobacillus paracasei 8700:2, Lactobacillus bulgaricus, Lactococcus thermophiles and Lactobacillus bifidus. In a specific embodiment, the bacteria infected by the recombinant bacteriophage of the present invention provided herein are F-factor positive. In another embodiment, the bacteria are F-factor positive and are selected from Escherichia coli Nissle 1917 or Escherichia coli ER2738. In a specific embodiment, the bacteria are Escherichia coli Nissle 1917. In another embodiment, the bacteria are Escherichia coli ER2738. .

[0023] In certain embodiments, the probiotic vaccine produces IgG and IgA antibodies that bind to exogenous peptide epitopes. In other embodiments, the probiotic vaccine comprising bacteria continuously produces lysogenic phages. In other embodiments of the probiotic vaccine, the peptide -TSGSGSGSGSGSGSG- is used as a linker between the coat protein and the exogenous peptide epitope.

[0024] Also provided herein is a recombinant filamentous phage genome, the recombinant filamentous phage genome comprising a recombinant phage genome, the recombinant phage genome comprising a nucleic acid encoding a polypeptide comprising an exogenous peptide epitope or a fragment or variant thereof, the exogenous peptide epitope being selected from the group consisting of:

[0025] LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO:1),

[0026] PESFDGDPASNTAPLQPEQLQ (SEQ ID NO:2),

[0027] QPEKVQTLEAWVIHGG (SEQ ID NO:3),

[0028] ISKRNIQFSCKNIYR (SEQ ID NO:4),

[0029] TFGSVEVHNL (SEQ ID NO:5),

[0030] QTLEA (SEQ ID NO:6),

[0031] IQFSC (SEQ ID NO:7), and

[0032] AFPEDRSQPG (SEQ ID NO:8).

[0033] In a specific embodiment of the recombinant phage, the exogenous peptide epitope is functionally expressed on a coat protein selected from the group consisting of: pill, pVI, pVII, pVIII and pIX. In a specific embodiment of the recombinant phage, the coat protein is pill. In other embodiments, the phage is selected from the group consisting of: filamentous phage, including M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE; M13K3; Myoviridae (Pl-like virus; P2-like virus; μ-like virus; SPOl-like virus; phiH-like virus); Long-tailed phage family (λ-like virus, γ-like virus, Tl-like virus; T5-like virus; c2-like virus; L5-like virus; psiMl-like virus; phiC31-like virus; N15-like virus); Short-tailed phage family (Pooviridae) (phi29-like virus; P22-like virus The family includes the following: multilaminaceous viruses (multilaminaceous viruses); capping viruses (capping viruses); lipotrichum (alpha lipotrichum virus, beta lipotrichum virus, gamma lipotrichum virus, delta lipotrichum virus); budding viruses (budding viruses); microbaculovirus (microbaculovirus); microspindle-shaped viruses (microspindle-shaped viruses); filamentous viruses (filamentous viruses, short rod-shaped viruses, M13-like viruses, fd-like viruses); microbial viruses (microphages, spiroplasma microphages, Bdellovibrio microphages, Chlamydia microphages); smooth viruses (smooth viruses, heterosmooth viruses) and cystic viruses (cystic viruses). In other embodiments, the phage is a filamentous phage selected from the group consisting of: M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE and M13K3. In a particularly preferred embodiment, the phage is M13K3. In other embodiments, the recombinant phage produces IgG antibodies that bind to exogenous peptide epitopes. In other embodiments of the recombinant phage, the peptide -TSGSGSGSGSGSGSG- is used as a linker between the coat protein and the exogenous peptide epitope.

[0034] Also provided herein is a method for preventing or treating cancer, comprising administering to a patient in need thereof one or more probiotic vaccines provided herein; or one or more recombinant bacteriophages provided herein. In a specific embodiment, the cancer is selected from the group consisting of: multiple myeloma, epithelial cancer, epithelial ovarian cancer, mucosal melanoma, non-small cell lung cancer, melanoma, head and neck cancer, renal cell carcinoma, Hodgkin's lymphoma, Cancers of the ovary (ovary), pancreas (stomach), lining (ovary), ovary (ovary), ovary (ovary), uterus (body), ovary (body), ovary (body), uterus (body), ovary (body), uterus (body), ovary (body), uterus (body), cervix (body), uterus (body), cervix (body), uterus (body), uterus (body), uterus (body), cervix (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), uterus (body), In a specific embodiment, the cancer is multiple myeloma.

[0035] Also provided herein is a kit comprising the probiotic vaccine of the present invention or the recombinant bacteriophage of the present invention, and instructions for administering the probiotic vaccine or the recombinant bacteriophage.

[0036] Other features and advantages of the present invention will become more apparent to those of ordinary skill in the art after reading the following detailed description and accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The nucleic acid sequence at the insertion site of the nucleic acid encoding SEQ ID NO: 8 in Example 3 is shown, forming the construct M13KE-AFP10 RF I DNA. DETAILED DESCRIPTION

[0038] Provided herein is a novel probiotic vaccine comprising:

[0039] A recombinant phage (e.g., a filamentous phage) genome, the recombinant phage genome comprising a nucleic acid encoding a polypeptide comprising an exogenous peptide epitope or a fragment or variant thereof, the exogenous peptide epitope being selected from the group consisting of:

[0040] LPESFDGDPASNTAPLQPEQLQVF(SEQ ID NO:1),

[0041] PESFDGDPASNTAPLQPEQLQ(SEQ ID NO:2),

[0042] QPEKVQTLEAWVIHGG(SEQ ID NO:3),

[0043] ISKRNIQFSCKNIYR(SEQ ID NO:4),

[0044] TFGSVEVHNL (SEQ ID NO: 5),

[0045] QTLEA (SEQ ID NO: 6),

[0046] IQFSC (SEQ ID NO: 7), and

[0047] AFPEDRSQPG (SEQ ID NO: 8); and

[0048] Bacteria infected with the recombinant phage.

[0049] As used herein, the phrase "probiotic vaccine" refers to a combination of probiotics infected with recombinant bacteriophages.

[0050] As described herein, the probiotic vaccine of the present invention is particularly suitable for methods of treating and / or preventing cancer or infectious diseases. Unlike traditional vaccines, probiotic-based vaccines do not require strict storage conditions and transportation. Traditional live vaccines generally require lower storage temperatures before administration. In addition, traditional vaccines are developed using attenuated strains of pathogenic bacteria, such as Salmonella, Mycobacterium and Bacillus, which have many disadvantages, including that attenuated strains are likely to revert to toxic forms in vivo. The attenuated form of the vaccine also causes an additional immune response in the individual, thereby weakening the effect of the vaccine. Compared with probiotic oral vaccines, the survival rate under the highly acidic conditions of the human intestinal tract is another problem that causes the failure of traditional vaccines. Traditional forms of vaccines are generally unable to survive under highly acidic conditions and therefore cannot reach the inner mucosal layer. On the other hand, probiotics are very familiar with acidic environmental conditions. Because probiotics have the characteristics of acid resistance and bile resistance, they provide a good choice for developing vaccines.

[0051] As used herein, the term "vaccine" refers to a composition capable of stimulating the immune system of a living organism to provide protection against harmful antigens by prevention or by therapy. Preferably, the vaccine or vaccine composition further comprises one or more immunoadjuvant substances.

[0052] As used herein, the terms "preventing," "prevention," "control," or "prevent" generally mean avoiding or minimizing the onset or development of a disease or disorder before it occurs, while the terms "treating," "treatment," or "treat" encompass alleviating, improving, or curing a disease (e.g., cancer, etc.) or disorder (or symptoms of a disease or disorder) after it has occurred. The term "prevention" encompasses "reducing the likelihood of occurrence" or "reducing the likelihood of recurrence."

[0053] As used herein, an "effective amount" or "effective dose" is an amount that provides a desired effect. For therapeutic purposes, an effective amount is an amount sufficient to provide a beneficial or desired clinical result. The preferred effective amount for a given application can be readily determined by one skilled in the art, taking into account, for example, the subject's size, age, weight, the type of disease / disorder to be prevented or treated, and the amount of time since the onset of the disease / disorder. In the context of the present invention, with respect to prevention or treatment, an effective amount of a composition is an amount sufficient to induce a humoral and / or cell-mediated immune response to the disease / disorder.

[0054] According to the various aspects and embodiments of the invention described herein, a "subject" or "host" preferably refers to a mammal, and most preferably refers to a human. The subject may have, be suspected of having, or be at risk of developing cancer and / or an infectious disease (e.g., infection by Korean fever virus, etc.).

[0055] Foreign peptide epitope

[0056] As used herein, the phrase "exogenous peptide epitope" refers to any peptide or sequence that is non-native or natural to the host phage strain used to produce the recombinant phage of the present invention. In other words, the exogenous peptide epitope and its encoding nucleic acid are heterologous (i.e., foreign) to the peptide sequence of the specific phage strain utilized. In several specific embodiments, the length of the exogenous peptide epitope can be within the range selected from the group consisting of: 4-20 amino acids, 4-25 amino acids, 5-20 amino acids, 5-25 amino acids, 5-30 amino acids, 5-35 amino acids, 5-40 amino acids, 5-45 amino acids, and 5-50 amino acids. In a specific embodiment, the length of the exogenous peptide epitope is within the range of 5-20 amino acids.

[0057] According to the present invention, the exogenous peptide epitope (e.g., antigenic peptide) used in the recombinant bacteriophage and / or probiotic vaccine provided herein comprises an amino acid sequence as shown in any one of SEQ ID NOs: 1-8 or a fragment or variant thereof or consists of the amino acid sequence, as follows:

[0058] LPESFDGDPASNTAPLQPEQLQVF(SEQ ID NO:1),

[0059] PESFDGDPASNTAPLQPEQLQ(SEQ ID NO:2),

[0060] QPEKVQTLEAWVIHGG(SEQ ID NO:3),

[0061] ISKRNIQFSCKNIYR(SEQ ID NO:4),

[0062] TFGSVEVHNL (SEQ ID NO: 5),

[0063] QTLEA (SEQ ID NO: 6),

[0064] IQFSC (SEQ ID NO: 7), and

[0065] AFPEDRSQPG (SEQ ID NO: 8).

[0066] The epitopes used to culture the recombinant phage with the probiotic cells will depend on the type of cancer to be treated or prevented; or the infectious disease to be prevented. For example, in embodiments where HER2 exogenous peptide epitopes are used to treat cancers including breast cancer, bladder cancer, pancreatic cancer, ovarian cancer and / or gastric cancer, at least one exogenous peptide epitope or fragment or variant thereof is selected from: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2). In another embodiment, the exogenous peptide epitope comprises: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), wherein there are five or less, four or less, three or less, two or less, or one amino acid substitution within SEQ ID NO: 1 or 2. Therefore, provided herein is a method for preventing or treating cancer including breast cancer, bladder cancer, pancreatic cancer, ovarian cancer and / or gastric cancer, the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the following: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2).

[0067] In another embodiment of using CD38 exogenous peptide epitopes to treat cancers including leukemia, lymphoma, myeloma, multiple myeloma, CLL, etc., at least one exogenous peptide epitope or a fragment or variant thereof is selected from: QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and IQFSC (SEQ ID NO: 7). In another embodiment, the exogenous peptide epitope comprises: QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and IQFSC (SEQ ID NO: 7), wherein there are five or less, four or less, three or less, two or less or one amino acid substitution within SEQ ID NO: 3-7. Therefore, provided herein is a method for preventing or treating cancer, including leukemia, lymphoma, myeloma, multiple myeloma and / or chronic lymphocytic leukemia (CLL), comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the group consisting of QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and IQFSC (SEQ ID NO: 7).

[0068] In another embodiment, it is contemplated herein that an exogenous peptide epitope or fragment or variant thereof selected from the following can prevent infection with Korean fever virus: QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and IQFSC (SEQ ID NO: 7). Therefore, a method for preventing infection with Korean fever virus is provided herein, comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the following: QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and IQFSC (SEQ ID NO: 7).

[0069] In another embodiment of using PD-1 exogenous peptide epitopes to treat cancer, at least one exogenous peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO: 8) or a fragment or variant thereof can treat or prevent PD-1-mediated cancers, such as mucosal cancer, gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC) and / or triple-negative breast cancer (TNBC), etc. In another embodiment, the exogenous peptide epitope comprises: AFPEDRSQPG (SEQ ID NO: 8), wherein there are five or less, four or less, three or less, two or less, or one amino acid substitution within SEQ ID NO: 8. Therefore, provided herein is a method for preventing or treating cancer, the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO: 8) or a fragment or variant thereof; wherein the cancer is selected from the group consisting of: gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC) and / or triple-negative breast cancer (TNBC).

[0070] As used herein, the term "fragment" or grammatical variations thereof refers to a smaller peptide (e.g., a subset of amino acids) relative to the complete reference peptide sequence from which it is derived. For example, the fragment can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids smaller than the complete reference peptide.

[0071] As used herein, the phrase "variant thereof," "variant" or its grammatical variations refers to a biologically active polypeptide having at least about 80% amino acid sequence identity with a reference sequence polypeptide after aligning the sequences and introducing gaps, if necessary, to achieve maximum percentage sequence identity and not considering any conservative substitutions as part of the sequence identity. Such variants include, for example, polypeptides in which one or more amino acid residues are added or deleted at the N-terminus or C-terminus of the polypeptide. In some embodiments, the variant will have at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% amino acid sequence identity. In some embodiments, the variant will have at least about 85% amino acid sequence identity. In some embodiments, the variant will have at least about 90% amino acid sequence identity. In some embodiments, the variant has at least about 95% amino acid sequence identity with the native sequence polypeptide.

[0072] As used herein, "percent (%) amino acid sequence identity" and "homology" with respect to peptide or polypeptide sequences are defined as the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues in a specific peptide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity and not considering any conservative substitutions as part of the sequence identity. Alignment for the purpose of determining percent amino acid sequence identity can be achieved in a variety of ways within the skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or MEGALIGN. TM (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0073] In certain embodiments, amino acid substitutions may include, but are not limited to, replacing an amino acid in a polypeptide with another amino acid. Table 1 shows exemplary conservative substitutions. In other embodiments, conservative amino acid substitutions may be introduced into a peptide of interest, and the product may be screened to obtain a desired activity, such as increased immunogenicity, etc.

[0074] In some embodiments, the modification may include introducing at least one conservative substitution into a peptide or protein, wherein at least one property of an amino acid (e.g., size, shape, or charge) is retained. A "conservative amino acid substitution" refers to a substitution of an amino acid with similar structure and / or function, which is performed without significantly altering the function of the protein. An example of a conservative substitution is replacing an amino acid in one of the following groups with another amino acid in the same group (U.S. Pat. No. 5,767,063; Kyte and Doolittle, J. Mol. Biol. 157: 105-132 (1982)):

[0075] ■(1) Hydrophobic: norleucine, Met, Ala, Val, Leu, Ile;

[0076] ■(2) Neutral hydrophilic: Cys, Ser, Thr, Asn, Gln;

[0077] ■(3) Acidic: Asp, Glu;

[0078] ■(4) Basic: His, Lys, Arg;

[0079] ■(5) Residues that affect chain orientation: Gly, Pro;

[0080] ■(6) Aromatic: Trp, Tyr, Phe.

[0081] Table 1

[0082]

[0083] For example, substitutions can be made by, for example, changing Val to Leu, Ser to Thr, or Asp to Glu. Other substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role in the three-dimensional structure of the protein. For example, when it is necessary to change the pKa of the amino acid side chain while retaining the size and structure of the side chain, Glu can be replaced by Gln, and Asp can be replaced by Asn.

[0084] In some embodiments, the amino acid residue selected for modification (e.g., replacement with another amino acid residue) is selected from the group consisting of: His, Glu, Asp, Cys, Lys, and Tyr. In some embodiments, the amino acid residue selected for modification includes His and Glu residues. The pKa values ​​of these amino acid residues (even in the context of the entire protein) are typically between about pH 6 and about pH 8, and therefore have a high buffering capacity. In some embodiments, at least one conservative amino acid substitution is selected from the group consisting of: His is substituted with Arg, Glu is substituted with Gln, Asp is substituted with Asn, Lys is substituted with Arg, and Tyr is substituted with Phe.

[0085] In some embodiments, at least one of the one or more amino acid modifications comprises replacing an amino acid with an alanine residue. In applications where it is desired to reduce the buffering capacity of a peptide or protein, it may be advantageous to replace or substitute an amino acid residue with alanine residue that has a high buffering capacity. It is noteworthy that norleucine is not encoded, but rather modified after substitution.

[0086] bacteria

[0087] As described above, the present invention provides a probiotic vaccine comprising a recombinant phage and bacteria infected with the recombinant phage. In a specific embodiment, any probiotic vaccine having an F factor (F + Cells), i.e. sex factors, bacteria that can produce pili and sex pili to bind to other bacteria are suitable for use herein. When an F+ cell binds / mates with an F- cell, two F+ cells are produced, both of which can pass plasmids to other F- cells by binding. The pili on the F+ cell interact with the recipient cell to form a mating connection, and one strand of DNA is cut, untied and transferred to the recipient cell. Exemplary bacteria containing F factors include Escherichia coli Nissle 1917, Escherichia coli ER2738, etc.

[0088] Thus, in certain embodiments, examples of probiotics for use according to the present invention include, but are not limited to, Escherichia coli Nissle 1917, Escherichia coli ER2738, Bacillus coagulans GBI-30, 6086, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium longum subsp. infantis, Lactobacillus acidophilus NCFM, Lactobacillus paracasei Stl 1 (or NCC2461), Lactobacillus johnsonii Lai (also known as Lactobacillus LCI, Lactobacillus johnsonii NCC533), Lactobacillus plantarum 299v, Lactobacillus reuteri ATCC 55730 (Lactobacillus reuteri SD2112), Lactobacillus reuteri Protectis (a progeny strain of DSM 17938, ATCC 55730), Lactobacillus reuteri Prodentis (DSM 17938 / ATCC 55730 and ATCC PTA 5289 combination), Lactobacillus rhamnosus GG, Saccharomyces boulardii, a mixture of Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14, a mixture of Lactobacillus acidophilus NCFM and Bifidobacterium bifidum BB-12, a mixture of Lactobacillus acidophilus CL1285 and Lactobacillus casei LBC80R, a mixture of Lactobacillus plantarum HEAL 9 and Lactobacillus paracasei 8700:2, Lactobacillus bulgaricus, thermophilic lactococcus and / or Lactobacillus bifidum. In some embodiments, the probiotics used according to the present disclosure can be a mixture of any two or more of the aforementioned strains described herein. In a specific embodiment, the probiotic is Escherichia coli Nissle 1917 or Escherichia coli ER2738. In another embodiment, the probiotic is Escherichia coli Nissle 1917. In another embodiment, the probiotic is Escherichia coli ER2738.

[0089] In other embodiments, bacteria suitable for use herein are small (typical linear dimensions are about 1 micron), non-compartmentalized organisms having at least one circular DNA chromosome and 70S ribosomes. As used herein, the term "bacteria" encompasses all variants of bacteria (e.g., endogenous bacteria naturally present in closed systems, environmental bacteria, or bacteria released for bioremediation or other efforts).

[0090] In the probiotic vaccines of the present invention provided herein, the recombinant phage of the present invention is loaded (e.g., infected) into donor bacteria (e.g., probiotics and / or symbiotic bacteria) to be delivered to a subject in need (e.g., a human patient). For example, probiotics are live bacteria that can bring health benefits to the host and / or are at least harmless (e.g., not pathogenic) to the host (e.g., a human patient). Therefore, aspects of the present invention contemplate the use of donor bacteria (e.g., probiotics and / or symbiotic bacteria) loaded or infected with non-lytic or inducible phages, which can be expressed in situ and produce phage-based delivery particles. It has also been found that probiotics can penetrate into the intestinal mucosal layer, help harmful bacteria invade, and prevent a variety of intestinal infections.

[0091] In a specific embodiment, examples of probiotics for use herein that are infected with the recombinant phage of the present invention include probiotics listed in the "PROBIO" database (" / / bidd.group / probio / homepage.htm"; Shamekhi et al., Clin Transl Oncol (2020) 22(8): 1227–39.doi: 10.1007 / s12094-019-02270-0; which is incorporated herein by reference in its entirety for all purposes), which includes 329 currently commercially available probiotics and 115 probiotics that are undergoing clinical trials. In a specific embodiment, the recombinant phage of the present invention is infected or loaded into a specific probiotic with immunomodulatory ability, wherein the probiotic is selected from the group consisting of: Bacillus amyloliquefaciens; Bacillus multifermentans, strain Bispan; Bifidobacterium animalis lactis subsp., strain BB-12; Bifidobacterium animalis lactis subsp., strain GPS1209; Bifidobacterium animalis lactis subsp., strain HN019 (DR1064); Bifidobacterium bifidum, strain BB-12; Bifidobacterium bifidum, strain Rosell-71; Bifidobacterium breve, strain M-16V; Bifidobacterium longum; Bifidobacterium thermophilus; Lactobacillus acidophilus, strain La-1; Lactobacillus breve, strain HA-112; Lactobacillus fermentum, strain HA-179; Lactobacillus helveticus, strain Lafti L10; Lactobacillus helveticus, strain Rosell-52; Lactobacillus paracasei, strain Lafti L26; Lactobacillus paracasei subsp. paracasei, strain 431; Lactobacillus rhamnosus, strain HN001 (DR20); Streptococcus salivarius, strain DSM 13084; Streptococcus thermophilus. See, e.g., Table 1 of Singh et al., Front Immunol. 2022; 13: 1002674; published online Oct. 3, 2022. doi: 10.3389 / fimmu.2022.1002674; which is incorporated herein by reference in its entirety for all purposes.

[0092] In other embodiments, it is contemplated herein that the recombinant phage of the invention disclosed herein targets bacteria other than E. coli, including but not limited to Bacteroides thetaiotamicron (e.g., Bl), Bacteroides fragilis (e.g., ATCC 51477-B1, B40-8, Bf-1), Bacteroides caccae (e.g., phiHSC01), Bacteroides ovatus (e.g., phiHSC02), Clostridium difficile (e.g., phiC2, phiC5, phiC6, phiC8, phiCD119, phiCD27), Klebsiella pneumoniae (e.g., KP01K2, Kl l, Kpn5, KP34, JDOOl), Staphylococcus aureus (e.g., phiNM1, 80α), Enterococcus faecalis (e.g., phiNM1, 80α), faecalis) (e.g., IME-EF1), Enterococcus faecium (e.g., ENB6, C33), and Pseudomonas aeruginosa (e.g., phiKMV, PAK-P1, LKD16, LKA1, δ, σ-1, J1).

[0093] Thus, the bacteriophage of the present disclosure can target (eg, specifically target) bacterial cells from any one or more of the aforementioned bacterial genera and / or bacterial species. Other bacterial cells and microorganisms can also be targeted.

[0094] As used herein, "endogenous" bacterial cells may refer to non-pathogenic bacteria that are part of the normal internal ecosystem (eg, bacterial flora).

[0095] In other embodiments, the bacterial cells of the present disclosure are anaerobic bacterial cells (e.g., cells that do not require oxygen to grow). Anaerobic bacterial cells include facultative anaerobic cells, such as Escherichia coli, Shewanella oneidensis, and Listeria monocytogenes. Anaerobic bacterial cells also include obligate anaerobic cells, such as Bacteroides and Clostridium species. For example, in humans, anaerobic bacterial cells are most commonly found in the gastrointestinal tract. Therefore, the bacteriophages of the present disclosure can target (e.g., specifically target) anaerobic bacterial cells.

[0096] Recombinant phage

[0097] Also provided herein is a recombinant filamentous phage genome, the recombinant filamentous phage genome comprising a recombinant phage genome, the recombinant phage genome comprising a nucleic acid encoding a polypeptide comprising an exogenous peptide epitope or a fragment or variant thereof, the exogenous peptide epitope being selected from the group consisting of:

[0098] LPESFDGDPASNTAPLQPEQLQVF(SEQ ID NO:1),

[0099] PESFDGDPASNTAPLQPEQLQ(SEQ ID NO:2),

[0100] QPEKVQTLEAWVIHGG(SEQ ID NO:3),

[0101] ISKRNIQFSCKNIYR(SEQ ID NO:4),

[0102] TFGSVEVHNL (SEQ ID NO: 5),

[0103] QTLEA (SEQ ID NO: 6),

[0104] IQFSC (SEQ ID NO: 7), and

[0105] AFPEDRSQPG (SEQ ID NO: 8).

[0106] In a specific embodiment of the recombinant phage, the foreign peptide epitope is functionally expressed on a coat protein of a phage selected from the group consisting of: pill, pVI, pVII, pVIII and pIX. In a specific embodiment of the recombinant phage, the coat protein is pill. As used herein, the phrase "functional expression" refers to the expression of a foreign peptide epitope such that the epitope is displayed on the surface of the phage and can elicit an immune response.

[0107] In other embodiments, the phage is selected from the group consisting of: filamentous phage, including M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE; M13K3; Myoviridae (Pl-like viruses; P2-like viruses; μ-like viruses; SPOl-like viruses; phiH-like viruses); Long-tailed phage (λ-like viruses, γ-like viruses, Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses; N15-like viruses); Brachyviridae (phi29-like viruses; P22-like viruses; N4-like viruses ); phylogenetics (phylogenetic viruses); phylogenetics (covered viruses); phylogenetics (alpha phylogenetic viruses, beta phylogenetic viruses, gamma phylogenetic viruses, delta phylogenetic viruses); budding phylogenetics (budding viruses); microbaculoviruses (small baculoviruses); microspindle phylogenetics (small spindle shaped viruses); filamentous phylogenetics (filamentous viruses, short baculoviruses, M13-like viruses, fd-like viruses); microbaculoviruses (microbacteriophages, spiroplasma microbacteriophages, Bdellovibrio microbacteriophages, Chlamydia microbacteriophages); smooth phylogenetics (smooth viruses, heterosmooth viruses) and cystic phylogenetics (cystic viruses). In other embodiments, the phage is a filamentous phage selected from the group consisting of: M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE and M13K3. In a particularly preferred embodiment, the phage is M13K3. In other embodiments, the recombinant phage produces IgG antibodies that bind to foreign peptide epitopes.

[0108] In a particular embodiment of the present disclosure, nucleic acids encoding exogenous peptide epitopes are recombinantly combined into naturally occurring, engineered (e.g., rationally engineered) or adaptively evolved bacteriophages for delivery to a microbial cell population, such as probiotic cells. A bacteriophage is a virus that infects and replicates in bacteria. A bacteriophage is composed of proteins that encapsulate a DNA or RNA genome and may have a relatively simple or complex structure. Their genomes may encode as few as four genes and as many as hundreds of genes. A bacteriophage replicates in bacteria after its genome is injected into the cytoplasm and replicates by a lytic cycle (causing bacterial cell lysis) or a lysogenic (non-lytic) cycle (keeping the bacterial cell intact).

[0109] In some embodiments, the phages of the present disclosure are non-lytic (also referred to as lysogenic or mild). As used herein, the phrase "bacteria that continuously produce lysogenic phages" refers to non-lytic phage infection of bacteria (e.g., probiotics described herein) such that recombinant lysogenic phages are actively secreted from infected cells without lysis. Exemplary lysogenic (non-lytic) phages include, but are not limited to, filamentous phages, such as f1, M13, fd, IKe, CTX-φ, Pfl, Pf2, and Pf3. Therefore, after the phage delivers the exogenous peptide epitope to the bacterial cell, the bacterial cell can still maintain viability and can stably maintain the expression of the antigenic epitope. In some embodiments, lytic phages can be used as delivery vehicles. When used with a phage system, natural lytic phages can be used as cargo shuttles and will not inherently dissolve target cells.

[0110] Examples of non-lytic or non-lysogenic phages for use in accordance with the present disclosure include, but are not limited to, phages selected from the group consisting of: Myoviridae (Pl-like viruses; P2-like viruses; μ-like viruses; SPO1-like viruses; phiH-like viruses); Longoviridae (λ-like viruses, γ-like viruses, T1-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiM1-like viruses; phiC31-like viruses; N15-like viruses); Brachyviridae (phi29-like viruses; P22-like viruses; N4-like viruses); Multilaminaceous (multilaminaceous viruses); Covering phages The family of phages includes the family of phages (capped viruses); the family of phages (alpha phages, beta phages, gamma phages, delta phages); the family of phages (budding viruses); the family of phages (small phages); the family of phages (small phages); the family of phages (small phages); the family of phages (filamentous viruses, short phages, M13-like viruses, f1-like viruses, fd-like viruses); the family of phages (microphages, spiroplasma microphages, Bdellovibrio microphages, Chlamydia microphages); the family of phages (smooth viruses, heterosmooth viruses) and the family of phages (cystic viruses). Such phages may be naturally occurring or may be engineered phages. In some embodiments, the phage is an Escherichia coli phage (e.g., infecting E. coli). Those skilled in the art will readily appreciate that other phages may be used in accordance with the present disclosure.

[0111] In a specific embodiment, the phage used herein is a filamentous phage. Filamentous phage is a large family of bacterial viruses that can infect a variety of gram-negative bacteria. Suitable well-known filamentous phages include phages that infect Escherichia coli, such as f1, M13, fd, and Ike. Phage f1, M13, and fd are the phages used for filamentous phage display to date. Their genomes are more than 98% identical, and gene products can be interchangeable.

[0112] Unlike the assembly of many other phages, a unique feature of filamentous phage assembly is that it is a secretion process. The coat polypeptide is incorporated into the growing phage in the cytoplasmic membrane, and the new phage is squeezed out of the cell during assembly. Escherichia coli cells will not dissolve in this process. It is well known to those skilled in the art that five kinds of viral coat proteins (pIII, pVI, pVII, pVIII and pIX) are inserted into the cytoplasmic membrane before being incorporated into the phage particle. For example, most of pill is translocated to the periplasm through the membrane, and its C-terminal hydrophobic tail anchors the protein in the membrane.

[0113] In another embodiment, the phage used to prepare the recombinant phage of the present invention is M13 phage. M13 is a filamentous phage of the family of filamentous phages, composed of circular single-stranded DNA. M13 phage is about 900nm long, 6-7nm in diameter, and contains 5 proteins. The minor coat protein P3 is attached to the receptor at the tip of the F pili of the Escherichia coli host cell. Therefore, in a specific embodiment, the probiotic vaccine of the present invention and its use in the method for treating or preventing cancer include delivering the recombinant M13 phage of the present invention to bacterial cells, and the phage is engineered to functionally express at least one exogenous peptide epitope in a coat protein selected from the group consisting of pIII, pVI, pVII, pVIII and pIX. In a specific embodiment, the exogenous peptide epitope is functionally expressed in the gene pIII of the M13 phage.

[0114] The bacteriophage used herein can be isolated from any environment where bacteria are present. In some embodiments, the recombinant bacteriophage of the invention is isolated (eg, collected, obtained) from feces or sewage, terrestrial or marine environments.

[0115] Treatment

[0116] cancer

[0117] Also provided herein is a method for preventing or treating cancer or an infectious disease, the method comprising administering to a patient in need thereof the probiotic vaccine of the present invention as described herein or the recombinant bacteriophage of the present invention as described herein.

[0118] As used herein, the term "cancer" or its grammatical variants refers to a malignant tumor. Specifically, the term "cancer" refers in this article to any member of a class of diseases or disorders characterized by uncontrolled cell division and the cells being able to invade other tissues by direct growth into adjacent tissues or by implantation into distant sites through metastasis. Metastasis is defined as the stage at which cancer cells are transported through the blood or lymphatic system. In a specific embodiment, the cancer is selected from the group consisting of: multiple myeloma, epithelial cancer, epithelial ovarian cancer, mucosal melanoma, non-small cell lung cancer, melanoma, head and neck cancer, renal cell carcinoma, Hodgkin's lymphoma, squamous cell carcinoma of the skin, glioblastoma, esophageal cancer, gastric cancer, duodenal cancer, small intestine cancer, appendix cancer, large intestine cancer, colon cancer, rectal cancer, colorectal cancer, anal cancer, pancreatic cancer, liver cancer, gallbladder cancer, spleen cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, uterine cancer, endometrial cancer, ovarian cancer, vaginal cancer, vulvar cancer, breast cancer, Lung cancer, thyroid cancer, thymus cancer, brain cancer, nervous system cancer, glioma, oral cancer, skin cancer, blood cancer, lymphoma, eye cancer, bone cancer, bone marrow cancer, muscle cancer, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC) and / or triple negative breast cancer (TNBC), etc. In a specific embodiment, the cancer is multiple myeloma.

[0119] In a specific embodiment, as described above, provided herein is a method for preventing or treating breast cancer, bladder cancer, pancreatic cancer, ovarian cancer and / or gastric cancer, the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the following: LPESFDGDPASNTAPLQPEQLQVF (SEQID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2).

[0120] In another embodiment, as described above, provided herein is a method for preventing or treating multiple myeloma, the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the group consisting of QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7).

[0121] In another embodiment of using PD-1 exogenous peptide epitopes to treat cancer, at least one exogenous peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO: 8) or a fragment or variant thereof can treat or prevent PD-1-mediated cancers, such as mucosal cancer, gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC) and / or triple-negative breast cancer (TNBC), etc. In another embodiment, the exogenous peptide epitope comprises: AFPEDRSQPG (SEQ ID NO: 8), wherein there are five or less, four or less, three or less, two or less, or one amino acid substitution within SEQ ID NO: 8. Therefore, provided herein is a method for preventing or treating cancer, the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO: 8) or a fragment or variant thereof; wherein the cancer is selected from the group consisting of: gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC) and / or triple-negative breast cancer (TNBC).

[0122] infectious disease

[0123] Viral hemorrhagic fever (VHF) is a group of clinically similar diseases that can be caused by enveloped RNA viruses mainly from the Arenaviridae, Filoviridae, Hantaviridae, and Flaviviridae families. Clinically, this group of diseases often presents with fever, fatigue, dizziness, muscle aches, and other related symptoms, which can progress to vascular leakage, bleeding, and multiple organ failure. See, e.g., Perdomo-Celis et al., Vaccines 2019, 7(1), 11; … doi.org / 10.3390 / vaccines7010011; which is incorporated herein by reference in its entirety for all purposes.

[0124] VHFs can be transmitted from person to person through direct contact with contaminated body fluids or tissues. Most VHFs are also zoonotic, with each virus being transmitted through different mechanisms. Some are transmitted through consumption of raw meat or body fluids from infected animals, direct contact with rodents or bats, inhalation, or contact with materials contaminated with rodent excreta. Others are vector-borne diseases, transmitted through the bite of infected mosquitoes or ticks. These diseases are clinically dynamic, with rapid progression through several stages within hours or days, from asymptomatic to severe illness and death. The lack of approved specific therapies increases the disease burden and poor clinical outcomes.

[0125] In another embodiment, as described above, the present invention provides a method for preventing Korean fever virus (e.g., Hantaviridae or Hantavirus) infection and / or disease manifestations (e.g., viral hemorrhagic fever (VHF), etc.), the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the following: QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and IQFSC (SEQ ID NO: 7).

[0126] Administration of probiotic vaccines

[0127] The probiotic vaccine of the present invention can be delivered to a patient (e.g., a patient with cancer) or a test animal by any suitable delivery route. In some embodiments, live probiotic cells can be delivered in vivo by fermented dairy products and / or probiotic fortified foods. Exemplary delivery foods can be selected from: probiotic solutions, soft candies, pills, yogurt, pickled vegetables, fermented soybean paste (e.g., tempeh, miso, paste), kefir, buttermilk or milk (karnemelk) of spoiled taste, kimchi, kimchi, sauerkraut, soy sauce, mustard tuber. In other embodiments, probiotics can be delivered in vivo in the form of tablets, capsules, powders and / or pouches containing freeze-dried bacteria.

[0128] In other embodiments, the probiotic vaccine of the present invention can be delivered to the patient by injection, infusion, vaccination, direct surgical delivery, or any combination thereof. In some embodiments, the probiotic vaccine is administered to the deltoid region or axillary region of the person. For example, the vaccine is injected into the axillary region by intradermal injection. In other embodiments, the vaccine is administered intravenously.

[0129] Those skilled in the art can select suitable carriers for administering cells by conventional techniques. For example, the pharmaceutical carrier can be a buffered saline solution, such as a cell culture medium, and can include DMSO for maintaining cell viability. In certain embodiments, the cells are administered in a fusible cryopreservation medium. The composition comprising the cells can include DMSO and hydroxyethyl starch, Plasmalyte A and / or glucose solution as a cryoprotectant and human serum albumin as a protein component.

[0130] To implement the methods described herein, the amount of the probiotic vaccine administered to a patient as a cancer vaccine and the most convenient route of such administration are based on a variety of factors, as is the formulation of the vaccine itself. Some of these factors include the patient's physical characteristics (e.g., age, weight, and sex), the physical characteristics of the tumor (e.g., location, size, growth rate, and accessibility), and the extent to which other treatments (e.g., chemotherapy and beam radiation therapy) are implemented in conjunction with the overall treatment regimen. Although a variety of factors are considered when implementing the methods of the present invention to preventively or therapeutically treat cancer or infectious diseases, a mammal, preferably a human, may be administered about 5×10 50 μl of a solution (e.g., saline) in a single administration. 6 about 2×10 8 In other embodiments, about 1×10 probiotic vaccine cells in about 0.05 mL to about 2 mL of a solution (e.g., saline) may be administered to a mammal (preferably a human) in a single administration. 3 About 1×10 15 pcs, 1×10 4 About 1×10 14 pcs, 1×10 5 About 1×10 13 pcs, 1×10 5 About 1×10 12 pcs, 1×10 5 About 1×10 11 pcs, 1×10 5 About 1×10 10 pcs, 1×10 5 About 1×10 9 pcs, 1×10 5 About 1×10 8 pcs, 1×10 6 About 1×10 12 pcs, 1×10 6 About 1×10 11 pcs, 1×10 6 About 1×10 10 pcs, 1×10 6 About 1×10 9 pcs, 1×10 6 About 1×108 Probiotic vaccine cells.

[0131] Additional administrations may be performed based on the above and other factors (e.g., severity of tumor lesions). In other embodiments, about one to about five administrations are performed every two weeks: about 1×10 4 / ml, about 1×10 5 / ml, about 1×10 6 / ml, about 1×10 7 / ml, about 1×10 8 / ml, about 1×10 9 / ml, about 1×10 10 / ml, about 1×10 11 / ml, about 1×10 12 / ml, about 1×10 13 / ml, about 1×10 14 / ml, about 1×10 15 In one embodiment, about 1×10 8 Administration of / ml probiotic vaccine cells.

[0132] Combination therapy

[0133] The probiotic vaccination provided herein can be combined with other treatments. For example, patients receiving the probiotic vaccination of the present invention can also receive chemotherapy, immuno-oncology therapy, radiotherapy and / or surgical therapy before, at the same time or after direct and / or probiotic vaccination. Chemotherapy is used to shrink and slow cancer growth. For many cancers, chemotherapy is recommended after the initial cancer surgery; however, chemotherapy is sometimes performed before surgery to shrink the cancer. The number of cycles of chemotherapy treatment depends on the stage of the disease. Chemotherapy may neutralize the anti-tumor immune response produced by vaccine therapy. In addition, as long as the combination design is reasonable, chemotherapy can be safely combined with immunotherapy and may produce cumulative or synergistic effects. Examples of chemotherapeutic agents that can be used to treat cancer patients include, but are not limited to, carboplatin, cisplatin, cyclophosphamide, docetaxel, doxorubicin, etoposide, gemcitabine, oxaliplatin, paclitaxel, TAXOL TM, topotecan and vinorelbine. In some embodiments, the patient receiving the probiotic vaccination has already received chemotherapy, radiotherapy and / or surgery for gynecological cancer or peritoneal cancer. Immunotherapy (immuno-oncology therapy) refers to the creation, promotion and / or regulation of immune response by producing antibodies against selected targets (such as TNF and other targets). Immunotherapy used in combination with the probiotic vaccine of the present invention (or the recombinant phage of the present invention) includes the use of (pembrolizumab), (nivolumab) and other treatments.

[0134] In addition to chemotherapy treatment, or separately from chemotherapy treatment, patients receiving the probiotic vaccination of the present invention may also be treated with any other treatment that is beneficial for the specific cancer. For example, patients with ovarian cancer, fallopian tube cancer or peritoneal cancer may be treated with a COX-2 inhibitor before, simultaneously with, or after the probiotic vaccination of the present invention, as described by Yu and Akasaki in WO 2005 / 037995. In another embodiment, patients receiving the probiotic vaccination of the present invention may be treated with bevacizumab before, simultaneously with, or after the probiotic vaccination. treat.

[0135] Also provided herein is a kit comprising the probiotic vaccine of the present invention or the recombinant bacteriophage of the present invention, and instructions for administering the probiotic vaccine or the recombinant bacteriophage.

[0136] Example

[0137] The following examples are provided to better illustrate the claimed disclosure, but should not be construed as limiting the scope of the present disclosure. When specific materials are mentioned, they are merely for illustrative purposes and are not intended to limit the present disclosure. Those skilled in the art can develop equivalent devices or reactants without using creative abilities and without departing from the scope of the present disclosure.

[0138] Materials and methods

[0139] Example 1 - Construction of a probiotic vaccine containing a HER2 epitope:

[0140] The present invention provides a phage oral vaccine comprising a HER2 epitope functionally expressed on M13KE phage infected with Nissle 1917 Escherichia coli bacterial cells. Specifically, the HER2 epitope is integrated into the coat protein gene pIII of MKE, fl and / or M13 phage to produce a vaccine to overcome immune tolerance to HER2. The carrier acts as an adjuvant to improve the stability and B cell presentation of the epitope.

[0141] Antibodies against two separate regions at the N-terminus and C-terminus of the fragment were found to exhibit growth inhibition. Epitope mapping of the C-terminal antibody revealed a 24 amino acid region (LPESFDGDPASNTAPLQP EQLQVF) with two different epitopes that mediated effective growth inhibition. The results showed that antibodies against this region of HER2 domain III (unlike the well-known monoclonal antibodies trastuzumab and pertuzumab) bind to HER2 on living cells and exhibit growth inhibition.

[0142] In a specific embodiment of the present invention provided herein, the P4378-394 B cell epitope (PESFDGDPASNTAPLQPEQLQ) from the HER2 extracellular domain is displayed by inserting the gene III (i.e., pIII) of the filamentous phage. Previously, it was found in preclinical studies that immunization with the P4378-394 epitope as a single epitope or a multi-epitope preparation can induce HER2-specific IgG antibodies with strong anti-tumor activity. In addition, a clinical phase I study using a multi-epitope vaccine containing the P4378-394 epitope showed that the vaccine is safe, well tolerated, and can effectively overcome immune tolerance to HER2.

[0143] The mRNA sequence encoding the amino acid sequence -ESFDGDPASNTAPLQPEQL- was inserted between the pIII signal peptide and the pIll protein coding sequence of the M13KE RF I DNA to construct the M13KE-HER2 RF I DNA, as shown in Example 3 below.

[0144] Preparation of M13KE vector

[0145] E. coli ER2738 in logarithmic growth phase was infected with M13KE phage. Bacteria were collected by centrifugation after incubation and plasmids were extracted using Axygen MidiPrep Plasmid Extraction Kit. M13KE RF I DNA was further purified and then loaded into agarose gel for QC.

[0146] M13KE RF I DNA was digested with Kpn 1 / Eag I and then separated by agarose gel electrophoresis.

[0147] Construction of M13KE-HER2 phage

[0148] DNA encoding the HER2 epitope was synthesized, digested with Kpn 1 / Eag I, and ligated with M13KE RF I DNA. The HER2-M13KE RF I DNA construct was transformed into E. coli ER 2738 competent cells. After recovery, E. coli ER2738 in the logarithmic growth phase was infected and cultured overnight at 32°C on TOP-Agar LB (containing IPTG / X-gal) plates. The results showed that after M13KE-HER2 was transformed into E. coli ER2738, many blue spots appeared on the plate, while no blue spots were observed in the control group. Several blue spots were selected and verified by sequencing. The results showed that all clones had the correct construct corresponding to the following mRNA sequence: GAATCATTTGACGGAGATCCCGCTAGTAACACCGCGCCGCTGCAGCCGGAGCAGTTG.

[0149] Phage preparation

[0150] Escherichia coli ER2738 in the logarithmic growth phase was infected with M13KE phage inserted with the correct HER2 epitope sequence. After overnight culture, the culture supernatant was collected, glycerol was added to a final concentration of 10%, and stored at -20°C.

[0151] The above-mentioned M13K3-HER2 phage is used to infect Nissle 1917 E. coli, which has been identified as male and can be used as a probiotic. This Nissle-infected bacteria with phage expressing the HER2 epitope is then used as a probiotic oral vaccine to cause patients to produce anti-HER2 antibodies against their cancer (e.g., breast cancer, bladder cancer, pancreatic cancer, ovarian cancer and / or gastric cancer). Probiotic phage containing the above-mentioned epitope is produced (i.e., phage + E. coli). This article considers oral administration of M113KE-HER2 probiotics to produce IgA and IgG antibodies in patients; while injection of phage alone (separate from probiotics) can produce IgG reactive to HER2 on the patient's human cancer cells in the patient.

[0152] Example 2-Construction of a probiotic vaccine containing the CD38 epitope:

[0153] The mRNA sequence encoding one of the amino acid sequences QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and / or IQFSC (SEQ ID NO: 7) was inserted between the pIII signal peptide and the pIll protein coding sequence of M13KE RF I DNA to construct M13KE-CD38 RF I DNA.

[0154] Preparation of M13KE vector

[0155] E. coli ER2738 in logarithmic growth phase was infected with M13KE phage. Bacteria were collected by centrifugation after incubation and plasmids were extracted using Axygen MidiPrep Plasmid Extraction Kit. M13KE RF I DNA was further purified and then loaded into agarose gel for QC.

[0156] M13KE RF I DNA was digested with Kpn 1 / Eag I and then separated by agarose gel electrophoresis.

[0157] Construction of M13KE-CD38 phage

[0158] DNA encoding CD38 epitopes (encoding QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and / or IQFSC (SEQ ID NO: 7)) was synthesized, digested with Kpn 1 / Eag I, and ligated with M13KE RF I DNA. The HER2-M13KE RFI DNA construct was transformed into E. coli ER2738 competent cells. After recovery, E. coli ER2738 in the logarithmic growth phase was infected and cultured overnight at 32°C on TOP-Agar LB (containing IPTG / X-gal) plates. The results showed that after M13KE-CD38 was transformed into E. coli ER2738, many blue spots appeared on the plate, while no blue spots were observed in the control group. Several blue spots were selected and verified by sequencing. The results showed that all clones had the correct constructs corresponding to the mRNA sequences encoding: QPEKVQTLEAWVIHGG (SEQ ID NO:3), ISKRNIQFSCKNIYR (SEQ ID NO:4), TFGSVEVHNL (SEQ ID NO:5), QTLEA (SEQ ID NO:6) and / or IQFSC (SEQ ID NO:7).

[0159] Phage preparation

[0160] E. coli ER2738 in logarithmic growth phase was infected with M13KE phage inserted with the correct CD38 exogenous peptide epitope. After overnight culture, the culture supernatant was collected, glycerol was added to produce a final concentration of 10%, and stored at -20°C.

[0161] The above-mentioned M13K3-CD38 phage is used to infect Nissle 1917 E. coli and used as a probiotic. This Nissle-infected bacteria with phage expressing the CD38 epitope is then used as a probiotic oral vaccine to cause patients to produce anti-CD38 antibodies against their cancer (e.g., multiple myeloma). Probiotic phage containing the above-mentioned epitope is produced (i.e., phage + E. coli). This article considers oral administration of M113KE-CD38 probiotics to produce IgA and IgG anti-CD38 antibodies in patients; while injection of phage alone (separate from the probiotic) can produce IgG reactive to CD38 on the patient's human cancer cells in the patient.

[0162] Example 3 - Construction of a probiotic vaccine containing the PD-1 / AFP10 epitope:

[0163] The mRNA sequence encoding the amino acid sequence -AFPEDRSQPG- (SEQ ID NO: 8; referred to herein as "AFP10") was inserted between the pIII signal peptide and the pIll protein coding sequence of the M13KE RF I DNA to construct the M13KE-AFP10 RF I DNA, and the sequence information is as follows Figure 1 shown.

[0164] Preparation of M13KE vector

[0165] E. coli ER2738 in logarithmic growth phase was infected with M13KE phage. Bacteria were collected by centrifugation after incubation and plasmids were extracted using Axygen MidiPrep Plasmid Extraction Kit. M13KE RF I DNA was further purified and then loaded into agarose gel for QC.

[0166] M13KE RF I DNA was digested with Kpn 1 / Eag I and then separated by agarose gel electrophoresis.

[0167] Construction of M13KE-AFP10 phage

[0168] DNA encoding AFP10-epitope was synthesized, digested with Kpn 1 / Eag I, and ligated with M13KE RF I DNA. The AFP10-M13KE RF I DNA construct was transformed into E. coli ER2738 competent cells. After recovery, E. coli ER2738 in logarithmic growth phase was infected and cultured overnight at 32°C on TOP-Agar LB (containing IPTG / X-gal) plates. The results showed that after M13KE-AFP10 was transformed into E. coli ER2738, many blue spots appeared on the plate, while no blue spots were observed in the control group. Several blue spots were selected and verified by sequencing. The results showed that all clones had the correct construct corresponding to the correct mRNA sequence.

[0169] Phage preparation

[0170] E. coli ER2738 in logarithmic growth phase was infected with M13KE phage inserted with the correct AFP10 epitope sequence. After overnight culture, the culture supernatant was collected, glycerol was added to give a final concentration of 10%, and stored at -20°C.

[0171] The above-mentioned M13K3-AFP10 phage is used to infect Nissle 1917 E. coli and used as a probiotic. Then, this Nissle-infected bacterium with a phage expressing the AFP10 epitope is used as a probiotic oral vaccine to cause the patient to produce anti-PD-1 antibodies against their cancer, such as gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophage or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC) and / or triple negative breast cancer (TNBC). Probiotic phage containing the above-mentioned epitope is produced (i.e., phage + E. coli). Here we consider oral administration of M113KE-AFP10 probiotics to produce IgA and IgG anti-PD-1 antibodies in patients; whereas injection of phages alone (separate from the probiotics) can produce IgG reactive to PD-1 on human cancer cells in patients.

[0172] The above description of the disclosed embodiments is provided to enable any person skilled in the art to adopt or use the present invention. Those skilled in the art will readily appreciate the various modifications to these embodiments, and the underlying principles described herein may be applied to other embodiments without departing from the spirit or scope of the present invention. Therefore, it should be understood that the description and accompanying drawings presented herein represent the current preferred embodiments of the present invention, and therefore represent the subject matter broadly contemplated by the present invention. It should also be understood that the scope of the present invention fully encompasses other embodiments that may become apparent to those skilled in the art, and the scope of the present invention is accordingly not limited thereto.

Claims

1. A probiotic vaccine, comprising: A recombinant filamentous phage genome comprising a nucleic acid encoding a polypeptide comprising an exogenous peptide epitope or a fragment or variant thereof, wherein the exogenous peptide epitope is selected from the group consisting of: LPESFDGDPASNTAPLQPEQLQVF(SEQ ID NO:1), PESFDGDPASNTAPLQPEQLQ(SEQ ID NO:2), QPEKVQTLEAWVIHGG(SEQ ID NO:3), ISKRNIQFSCKNIYR(SEQ ID NO:4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), IQFSC (SEQ ID NO: 7), and AFPEDRSQPG (SEQ ID NO: 8); and Bacteria infected with the recombinant phage.

2. The probiotic vaccine of claim 1, wherein the exogenous peptide epitope is functionally expressed on a coat protein selected from the group consisting of: pill, pVI, pVII, pVIII and pIX.

3. The probiotic vaccine according to claims 1-2, wherein the coat protein is pill.

4. The probiotic vaccine of claims 1-3, wherein the phage is selected from the group consisting of: filamentous phages, including M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE; M13K3; Myoviridae (Pl-like viruses; P2-like viruses; μ-like viruses; SPOl-like viruses; phiH-like viruses); Long-tailed phages (λ-like viruses, γ-like viruses, Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses; N15-like viruses); Brachyviridae (phi29-like viruses; P22-like viruses); The family includes the following: phyloviruses (N4-like viruses); phyloviruses (phyloviruses); phyloviruses (coated viruses); phyloviruses (alpha phyloviruses, beta phyloviruses, gamma phyloviruses, delta phyloviruses); phyloviruses (budding viruses); phyloviruses (small rod-shaped viruses); phyloviruses (small spindle-shaped viruses); phyloviruses (filoviruses, short rod-shaped viruses, M13-like viruses, fd-like viruses); phyloviruses (microphages, spiroplasma microphages, Bdellovibrio microphages, Chlamydia microphages); phyloviruses (smooth viruses, heterosmooth viruses) and phyloviruses (cystic viruses).

5. The probiotic vaccine according to claims 1-4, wherein the bacteriophage is M13K3.

6. The probiotic vaccine according to claims 1-5, wherein the bacteria are selected from: Escherichia coli Nissle 1917, Escherichia coli ER2738, Bacillus amyloliquefaciens; Bacillus multifermentans, strain Bispan; Bifidobacterium animalis subsp. lactis, strain BB-12; Bifidobacterium animalis subsp. lactis, strain GPS1209; Bifidobacterium animalis subsp. lactis, strain HN019 (DR1064); Bifidobacterium bifidum, strain BB-12; Bifidobacterium bifidum, strain Rosell-71; Bifidobacterium breve, strain M-16V; Bifidobacterium longum; Bifidobacterium thermophilus; Lactobacillus acidophilus, strain La-1; Lactobacillus breve, strain HA-112; Lactobacillus fermentum, strain HA-179; Lactobacillus helveticus, strain LaftiL10; Lactobacillus helveticus, strain Rosell-52; Lactobacillus paracasei, strain LaftiL26; Lactobacillus paracasei subsp. casei, strain 431; Lactobacillus rhamnosus, strain HN001 (DR20); Streptococcus salivarius, strain DSM 13084; Streptococcus thermophilus; Bacillus coagulans GBI-30, 6086, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium longum subsp. infantis, Escherichia coli Nissle 1917, Lactobacillus acidophilus NCFM, Lactobacillus paracasei Stl 1 (or NCC2461), Lactobacillus johnsonii Lai (also known as Lactobacillus LCI, Lactobacillus johnsonii NCC533), Lactobacillus plantarum 299v, Lactobacillus reuteri ATCC 55730 (Lactobacillus reuteri SD2112), Lactobacillus reuteri Protectis (DSM17938, a progeny strain of ATCC55730), Lactobacillus reuteri Prodentis (DSM 17938 / ATCC 55730 and ATCC PTA 5289 combination), Lactobacillus rhamnosus GG, Saccharomyces boulardii, a mixture of Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14, a mixture of Lactobacillus acidophilus NCFM and Bifidobacterium bifidum BB-12, a mixture of Lactobacillus acidophilus CL1285 and Lactobacillus casei LBC80R, a mixture of Lactobacillus plantarum HEAL 9 and Lactobacillus paracasei 8700:2, Lactobacillus bulgaricus, Lactococcus thermophilus and Lactobacillus bifidum.

7. The probiotic vaccine of claims 1-6, wherein the bacteria is F-factor positive; and is selected from E. coli Nissle 1917 or E. coli ER2738.

8. The probiotic vaccine of claims 1-7, wherein the probiotic vaccine produces IgG and IgA antibodies that bind to the exogenous peptide epitope.

9. A recombinant filamentous phage genome, the recombinant filamentous phage genome comprising A recombinant phage genome comprising a nucleic acid encoding a polypeptide comprising an exogenous peptide epitope or a fragment or variant thereof, wherein the exogenous peptide epitope is selected from the group consisting of: LPESFDGDPASNTAPLQPEQLQVF(SEQ ID NO:1), PESFDGDPASNTAPLQPEQLQ(SEQ ID NO:2), QPEKVQTLEAWVIHGG(SEQ ID NO:3), ISKRNIQFSCKNIYR(SEQ ID NO:4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), IQFSC (SEQ ID NO: 7), and AFPEDRSQPG (SEQ ID NO: 8).

10. The recombinant phage of claim 9, wherein the foreign peptide epitope is functionally expressed on a coat protein selected from the group consisting of pill, pVI, pVII, pVIII and pIX. The recombinant bacteriophage according to claim 9 , wherein the coat protein is pill.

12. The recombinant phage of claims 9-11, wherein the phage is selected from the group consisting of: filamentous phage, including M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE; M13K3; Myoviridae (Pl-like virus; P2-like virus; μ-like virus; SPOl-like virus; phiH-like virus); Long-tailed phage (λ-like virus, γ-like virus, Tl-like virus; T5-like virus; c2-like virus; L5-like virus; psiMl-like virus; phiC31-like virus; N15-like virus); Brachyviridae (phi29-like virus; P22-like virus; Viruses; N4-like viruses); Multilaminaceae (multilaminaceous viruses); Capping Viruses (covered viruses); Lipotrichum (alpha, beta, gamma, delta); Budding Viruses (budding viruses); Microbaculoviruses (small rod-shaped viruses); Microspindle-shaped viruses (small spindle-shaped viruses); Filvoviraceae (filamentous viruses, short rod-shaped viruses, M13-like viruses, fd-like viruses); Microbiophages (microphages, Spiroplasma microphages, Bdellovibrio microphages, Chlamydia microphages); Smooth Viruses (smooth viruses, heterosmooth viruses) and Cystic Viruses (cystic viruses).

13. The recombinant phage of claims 9-12, wherein the phage is a filamentous phage selected from the group consisting of: M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE, and M13K3.

14. The recombinant phage of claims 9-13, wherein the phage is M13K3.

15. The recombinant phage of claims 9-14, wherein the recombinant phage produces IgG antibodies that bind to the foreign peptide epitope.

16. A method for preventing or treating cancer, the method comprising administering one or more probiotic vaccines according to claims 1-8 or one or more recombinant phages according to claims 9-15 to a patient in need thereof.

17. The method of claim 16, wherein the cancer is selected from the group consisting of: multiple myeloma, epithelial cancer, epithelial ovarian cancer, mucosal melanoma, non-small cell lung cancer, melanoma, head and neck cancer, renal cell carcinoma, Hodgkin lymphoma, cutaneous squamous cell carcinoma, glioblastoma, esophageal cancer, gastric cancer, duodenal cancer, small intestine cancer, appendix cancer, large intestine cancer, colon cancer, rectal cancer, colorectal cancer, anal cancer, pancreatic cancer, liver cancer, gallbladder cancer, spleen cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, uterine cancer, endometrial cancer, ovarian cancer, vaginal cancer, vulvar cancer. cancer of the lung, thyroid, thymus, brain, nervous system, glioma, oral cancer, skin cancer, blood cancer, lymphoma, eye cancer, bone cancer, bone marrow cancer, muscle cancer, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple-negative breast cancer (TNBC).

18. The method of claim 16, wherein the cancer is multiple myeloma.

19. A method for preventing or treating breast cancer, bladder cancer, pancreatic cancer, ovarian cancer and / or gastric cancer, the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the following: LPESFDG DPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2).

20. A method for preventing or treating leukemia, lymphoma, myeloma, multiple myeloma and / or chronic lymphocytic leukemia (CLL), the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the group consisting of QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6) and IQFSC (SEQ ID NO: 7).

21. A method for preventing Korean fever virus infection, the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope or fragment or variant thereof selected from the group consisting of QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7).

22. A method for preventing or treating cancer, the method comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one exogenous peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO: 8) or a fragment or variant thereof; wherein the cancer is selected from the group consisting of: gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC) and / or triple negative breast cancer (TNBC).

23. The probiotic vaccine of claims 1-8, wherein the bacteria continuously produces lysogenic phages.

24. The probiotic phage of claims 1-8 or the recombinant phage of claims 9-15, wherein -TSGSGSGSGSGSGSG- is used as a linker between the coat protein and the foreign peptide epitope.

25. A kit comprising the probiotic vaccine according to claims 1-8 or the recombinant bacteriophage according to claims 9-15 and instructions for administering the probiotic vaccine or the recombinant bacteriophage.

Images