Rice AFR1 gene and its application in controlling the development of leaf collar and leaf angle

By regulating leaf pulvinus development and leaf angle using the rice AFR1 gene, the problem of difficulty in controlling leaf pulvinus development and leaf angle in existing technologies has been solved, thereby improving the photosynthetic efficiency and yield of rice.

CN119307511BActive Publication Date: 2026-02-06INST OF AGRI RESOURCES & REGIONAL PLANNING CHINESE ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411565534.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-05
Publication Date
2026-02-06
Estimated Expiration
2044-11-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control the development of rice leaf pillows and the size of leaf angles, which affect the photosynthetic efficiency and nutrient absorption of rice, thereby limiting the increase in rice yield.

Method used

By identifying and utilizing the rice AFR1 gene and its protein, the development of the leaf pulvinus and the leaf angle can be regulated. Through gene editing and overexpression technology, the length and cell size of the leaf pulvinus can be altered, thereby increasing or decreasing the leaf angle.

Benefits of technology

It significantly alters the leaf angle of rice, improves photosynthetic efficiency and nutrient acquisition capacity, enhances the growth potential of rice, and increases yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119307511B_ABST
    Figure CN119307511B_ABST
Patent Text Reader

Abstract

The application discloses a rice AFR1 gene and application thereof in controlling development of leaf cushions and leaf clamping angles. The gene sequence is shown in the sequence table SEQ ID No:1, and the protein sequence is shown in the sequence table SEQ ID No:2. The application identifies for the first time that AFR1 gene expression can obviously control development of rice leaf cushions and size of leaf clamping angles. Mutations of rice AFR1 protein make the length of leaf cushions increased, cells enlarged, and the leaf clamping angles increased. Overexpression of the rice AFR1 protein makes the length of leaf cushions shortened, cells reduced, and the leaf clamping angles reduced. The protein and the coding gene thereof have important theoretical and practical significance for improving plant close-planting and crop yield, will play an important role in crop genetic breeding, and have a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the rice AFR1 gene and its application in controlling leaf pulvinus development and leaf angle size. Background Technology

[0002] Rice is a staple food for about half the world's population, especially in Asian countries where it is an indispensable part of daily diets. Under high-density planting conditions, excessive rice planting density can impair the plant's light sensitivity and nutrient absorption, leading to reduced yields. Therefore, implementing a reasonable dense planting strategy is crucial in agricultural production. Improving rice plant architecture and optimizing space utilization between plants can effectively enhance photosynthetic efficiency and nutrient acquisition, thereby increasing overall yield. This strategy not only helps enhance rice's growth potential but is also an important pathway to achieving sustainable agricultural development.

[0003] The main traits of ideal rice plant type include plant height, number of tillers, panicle type, leaf shape, leaf angle, and tillering angle (CHENL, XIAO Y, TANG W, et al. Practices and Prospects of Super Hybrid Rice Breeding[J]. Rice Science, 2007, 14(2): 71-77.). Among them, tillering angle and leaf angle are considered important agronomic traits affecting rice planting density, and ideal tillering angle and leaf angle can maximize yield per unit area. The leaf pulvinus consists of the leaf pulvinus band, auricle, and ligule, and is a unique mechanical tissue of monocotyledonous grasses. The presence and development degree of the leaf pulvinus directly affect the size of the leaf angle. Appropriately reducing the leaf angle helps to improve light transmittance, thereby enhancing the leaf's ability to capture light energy. Therefore, further identification and isolation of genes involved in controlling the leaf angle of rice has high application value. Summary of the Invention

[0004] The purpose of this invention is to provide the AFR1 gene and its application in controlling the development of rice leaf pillow and the size of leaf angle.

[0005] The rice AFR1 gene, wherein the polynucleotides of the AFR1 gene are shown in (a), (b), (c), or (d):

[0006] (a) a polynucleotide as shown in SEQ ID No: 1; or

[0007] (b) A polynucleotide whose complementary sequence to SEQ ID No: 1 can hybridize under strict hybridization conditions, and the protein encoded by the polynucleotide still has the function of controlling leaf pulvinus development and leaf angle.

[0008] (c) A polynucleotide that is at least 90% homologous to the polynucleotide shown in SEQ ID No: 1; or

[0009] (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, wherein the protein encoded by the polynucleotide mutant still has the function of controlling leaf pulvinus development and leaf angle.

[0010] Rice AFR1 protein, wherein the amino acid sequence of the AFR1 protein is shown in (a), (b), or (c):

[0011] (a) The amino acid sequence as shown in SEQ ID No: 2 of the sequence listing; or

[0012] (b) Amino acids that are at least 90% homologous to the amino acid shown in SEQ ID No: 2; or

[0013] (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids based on the protein shown in SEQ ID No: 2, and the protein still has the function of controlling leaf pulvinus development and leaf angle.

[0014] A vector containing the rice AFR1 gene.

[0015] Engineered bacteria containing the rice AFR1 gene vector.

[0016] Primers for amplifying any segment of the rice AFR1 gene.

[0017] The application of the rice AFR1 gene in controlling rice leaf pillow development and leaf angle size.

[0018] A method to increase the leaf angle in rice to reduce the expression level of AFR1 protein in rice.

[0019] A method to reduce the leaf angle in rice to increase the expression level of AFR1 protein in rice.

[0020] The beneficial effects of this invention are as follows: This invention is the first to identify that AFR1 gene expression can significantly control the development of the leaf pulvinus and the size of the leaf angle in rice. Mutations in the rice AFR1 protein increase the length of the leaf pulvinus, increase cell size, and increase the leaf angle, while overexpression of the rice AFR1 protein shortens the length of the leaf pulvinus, decreases cell size, and decreases the leaf angle. The protein and its encoding gene of this invention have important theoretical and practical significance for improving plant density and crop yield, and will play an important role in crop genetics and breeding, with broad application prospects. Attached Figure Description

[0021] Figure 1Obtained from rice AFR1 mutant;

[0022] In the figure, a represents the target site of the AFR1CDS sequence; b represents the wild-type and three mutant sequences.

[0023] Figure 2 The expression level of AFR1 in the overexpression line is shown.

[0024] Figure 3 The whole plant phenotype of rice mutants and overexpressing plants;

[0025] In the figure, a is the mutant plant; b is the overexpressing plant.

[0026] Figure 4 The leaf angle of rice mutants and overexpressing plants;

[0027] In the figure, a represents the phenotype; b represents the data statistics.

[0028] Figure 5 The dorsal lateral leaf phenotype of rice mutants and overexpressing plants.

[0029] Figure 6 The result is the measurement of the dorsal side length of the leaf bolus.

[0030] Figure 7 Longitudinal section of the dorsal side of the leaf pulvinus (a) and cell length analysis (b). Detailed Implementation

[0031] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0032] Example 1: Obtaining the AFR1 mutant in rice

[0033] The target site was selected from the 45-66 bp of the CDS sequence of gene AFR1 (Os10g21460). Figure 1a) The homologous arm primers were AFR1-u3-F: ggcACGAGATGTCCGTGCTACCG (SEQ ID NO: 3), AFR1-u3-R: aaacCGGTAGCACGGACATCTCG (SEQ ID NO: 4), and the identification primers were AFR1-cas9-Seq-F: CCAACTGTCCCTGCAAGAAA (SEQ ID NO: 5), AFR1-cas9-Seq-R: TGGAACCCTAGATGCACAAC (SEQ ID NO: 6). For the specific steps of CRISPR / Cas9 vector construction, please refer to Zeng Dongchang et al. (Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors [J]. Science in China: Life Sciences, 2018, 48(07): 783-794.). The constructed vector was transferred into Nippon Haru-Chung (contracted to the Institute of Crop Science, Chinese Academy of Agricultural Sciences) using Agrobacterium EHA105-mediated transgenic method, resulting in three independent afr1 mutants: one with a deletion of one A base, one with a deletion of two TA bases, and one with TA replaced by C. These were named afr1-1, afr1-2, and afr1-3, respectively. Figure 1 b.

[0034] Example 2: Obtaining AFR1 overexpression materials

[0035] Using Nipponbare rice as background material, the CDS sequence of AFR1 was cloned using PCR amplification. This sequence was then ligated into the pCAMBIA1300 vector via restriction enzyme digestion and ligation. The restriction sites were KpnI and SalI. The primers used were AFR1-CDS-F: CGGGGTACCATGATTGCGGCGGTCGGC (SEQ ID NO: 7) and AFR1-CDS-R: CGCGTCGACTCAGGCCACTTTCACGTTTGTCT (SEQ ID NO: 8). After successful sequencing, transgenic plants were obtained using Agrobacterium-mediated transgenic methods (commissioned to the Institute of Crop Science, Chinese Academy of Agricultural Sciences). The rice lines identified as positive and exhibiting high gene expression levels were named AFR1-OE-1, AFR1-OE-2, and AFR1-OE-3, respectively. All AFR1-OE lines used in this study were homozygous transgenic lines. After 14 days of pot culture, RNA was extracted from the aboveground parts of AFR1-overexpressing rice and reversed. Then, ACTIN-qRT-F was used to analyze the RNA.

[0036] TGACGGAGCGTGGTTACTCAT (SEQ ID NO: 9), ACTIN-qRT-R: GCAATGCCAGGGAACATAGTG (SEQ ID NO: 10), AFR1-qRT-F: CACAATCACCAAAGCCACAGA (SEQ ID NO: 11), AFR1-qRT-R: GAGCCCTTGAGGAGGAAGAAA (SEQ ID NO: 12) primers to detect AFR1 expression, Figure 2 The results showed that the AFR1 expression level in the AFR1 overexpression lines was significantly higher than that in the wild type, with the AFR1-OE-1 line showing the highest relative expression level of the AFR1 gene.

[0037] Example 3 Phenotypic Identification of Rice Mutants and Overexpression Materials

[0038] The obtained rice mutants and overexpressing plants were cultured in pots for 50 days, and their phenotypes were observed. The whole plant was compared with... Figure 3 Randomly select individual rice plants of various types for photography. Figure 4 a) with the pulvinus as the intersection point, and the leaf sheath and blade each as one side line ( Figure 4 (a) The white dashed line area was used, and the angle between the fourth leaf at the tip of the main tiller was measured and statistically analyzed using ImageJ software. Figure 4 (b) It was found that the AFR1 mutant material exhibited a significantly increased leaf angle phenotype compared to the wild type, while the material overexpressing the gene clearly showed a decreased leaf angle phenotype. This indicates that AFR1 can alter the leaf angle in rice.

[0039] Example 4: Observation of leaf pulvinus development in rice mutants and overexpression materials

[0040] The leaf pulvinus was cut from the rice seedling, and its length on the dorsal side was observed and measured under a microscope. Figure 5 (The location indicated by the red double-headed arrow) shows the analysis results as follows: Figure 6 The mutants were found to have significantly longer leaf pulvinus lengths than the wild type, while the overexpressing plants had significantly shorter leaf pulvinus lengths than the wild type. Longitudinal sections of the dorsal side of the leaf pulvinus were prepared and cell morphology was observed under a UV microscope. Figure 7 a) Cell length was measured and analyzed using the software included with the microscope. Figure 7 b) It was found that the mutant cells were larger than the wild type, while the overexpression lines had more cells, smaller cells, and more compact arrangement compared to the wild type.

[0041] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Oryza sativa AFR1 application of the gene in controlling development of the leaf sheath and size of the leaf angle in rice, characterized in that, Overexpression of rice AFR1 gene makes the length of the leaf sheath shorter, the cell smaller, and the leaf angle smaller, and the AFR1 The nucleotide sequence of the gene is shown as SEQ ID No:

1.

2. A method of reducing leaf angle in rice, characterized by, increasing the expression level of AFR1 protein in rice; the amino acid sequence of the AFR1 protein is shown as SEQ ID No: 2.