A SNP mutation site associated with melanization in turbot, molecular marker and its application

Abstract

The present invention provides a SNP mutation site, molecular marker and application associated with the melanization of turbot, belonging to the field of molecular marker technology. The present invention finds a SNP site associated with the melanization of turbot through pathway analysis, SNP site screening, SNP site typing, and SNP site screening associated with the melanization of the eyeless side of turbot. The SNP site is located on the gene tyrosinase‑related protein 1b, and the base G at the 835bp position is mutated to A, which can change aspartic acid to asparagine, resulting in the eyeless side of turbot being less likely to melanize. When breeding turbot, the SNP site associated with the melanization of the eyeless side of turbot of the present invention can be used to perform pre-breeding molecular screening of turbot, thereby reducing the incidence of melanization of the eyeless side of turbot offspring from the germplasm and reducing the melanization phenomenon during turbot breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP mutation site associated with turbot melanization, a molecular marker and applications. Background Art

[0002] Turbot is a bottom-dwelling flatfish with both eyes on the same side of its body: the eyed side is at the top, and the eyeless side is at the bottom, close to the ground. The eyeless side refers to the lower, eyeless side. As a high-quality, commercial marine fish, turbot is farmed industrially in most regions. Normally, the eyed side of turbot is black, and the eyeless side is white. However, during industrial farming, some melanocytes on the eyeless side of turbot become connected, a phenomenon known as melanization. This melanization affects the aesthetics of the turbot and reduces its commercial value. There are many reasons for melanization in turbot, including: 1. Changes in the culture environment, such as water temperature, water quality, light intensity, and light direction, can affect the flatfish's coloration; 2. Nutritional factors: The levels of DHA, EPA, ARA, and vitamin D3 in the feed can affect the flatfish's coloration; and 3. Genetic factors. At present, in the process of factory farming, the proportion of blackened body color on the eyeless side is very high, and the selling price of blackened individuals is usually low. This not only affects the economic benefits of farmers, but also limits the market competitiveness of turbot. Inhibiting the occurrence of blackened body color on the eyeless side of turbot has become an urgent problem that needs to be solved in the turbot farming industry.

[0003] In recent years, numerous studies have focused on color abnormalities in the flatfish, the Japanese flounder. These studies have examined the effects of the Japanese flounder's aquaculture environment, such as light intensity, water velocity, water depth, water temperature, and stocking density, as well as nutritional factors. These studies have shown some success in improving color abnormalities in Japanese flounder. Other research has addressed the issue of color abnormalities from a genetic perspective, such as the genetic mutations adc-2677-C / A, itpr2-7032-C / T, and itpr2-554-T / C in Japanese flounder. However, no relevant research has been reported in turbot.

[0004] Therefore, solving the problem of turbot melanization from a genetic perspective is crucial to the turbot farming industry. Summary of the Invention

[0005] The purpose of the present invention is to provide a SNP mutation site associated with turbot melanization, a molecular marker and its application. The application of the SNP mutation site in turbot breeding can effectively reduce the melanization phenomenon during turbot cultivation.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a SNP mutation site associated with turbot melanization, wherein the SNP mutation site is the base G / A located at the 835bp position on the gene tyrosinase-related protein 1b.

[0008] The present invention also provides a SNP molecular marker associated with turbot melanization. The SNP molecular marker associated with turbot melanization is a SNP molecular marker based on a SNP mutation site associated with turbot melanization.

[0009] Preferably, the SNP molecular marker is the base sequence shown in SEQ ID NO.1; the base G at the 835 bp position of the base sequence shown in SEQ ID NO.1 is mutated into base A, and aspartic acid is changed into asparagine.

[0010] Preferably, the SNP molecular marker associated with turbot melanization is a marker linked to the eyeless side body color trait of turbot.

[0011] The present invention also provides an application of a SNP mutation site associated with turbot melanization or a SNP molecular marker associated with turbot melanization in turbot breeding.

[0012] The present invention also provides a product for detecting SNP mutation sites associated with turbot melanization or SNP molecular markers associated with turbot melanization, wherein the product comprises primers or probes capable of detecting SNP mutation sites or SNP molecular markers associated with turbot melanization.

[0013] The beneficial effects of the present invention compared with the prior art are:

[0014] (1) The present invention found a SNP site associated with the melanization of turbot through pathway analysis, SNP site screening, SNP site typing, and SNP site screening associated with the blackening of the eyeless side of turbot. The SNP site is located on the gene tyrosinase-related protein 1b. The base G at the 835bp position mutates to A, which can change aspartic acid to asparagine, making the eyeless side of turbot less likely to melanize.

[0015] (2) When breeding turbot, the SNP loci associated with the blackening of the eyeless side of the turbot of the present invention can be used to perform pre-breeding molecular screening of turbot, thereby reducing the incidence of blackening in turbot offspring from the germplasm and reducing the blackening phenomenon during turbot breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] Figure 1 This is the peak diagram of the GG gene sequencing in Example 1 of the present invention (GGCGACCC);

[0018] Figure 2 The GA genotype sequencing peak diagram (GGCG / AACCC) in Example 1 of the present invention is shown in FIG.

[0019] Figure 3 This is the peak diagram of the sequencing of the AA genotype in Example 1 of the present invention (GGCAACCC);

[0020] Figure 4 These are the sequencing results of the tyrp1b-835-G / A site of 12 normal turbot samples and 13 blackened turbot samples in Example 1 of the present invention. DETAILED DESCRIPTION

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0023] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0024] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0025] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0026] In the present invention, the sequence of the gene associated with melanization of turbot (SEQ ID NO.1) is as follows:

[0027] GTGTTGGGTGTAGGTGATTACTCAAGCTCCAAAAAGTCGGATCATGCGCTCGGTAGCTATTTAAGCCAGGAGAGGGGATCGGGCCGACTCTTGGTGGGATACAGTTCTGCAGACCGAGAGGAGCAGC ATGCACAGTCAGAGCATGTGGAGAGCAGGTCTCGTGGTGGTCACCCTGTGTGCCACTGTAACGCTGGCCCAGTTCCCCCGGGAGTGCGTTACCCCCGAGGGGCTGCGCAGTGGCCAGTGCTGCCCGTCCCCTACAGGGGTGGCAGGGGACGAGTGTGGCGCGGGCACAGGACGGGGGCAGTGTGTTGCCATTGCGGCAGACAACCGCCGCCACGGACCCCAGTACCCCTACGCTGGACGAGATGACAGGGAGAGGTGGCCGCTGACATTTTTCAACCGCACTTGCCAGTGTAATGGGAACTTCAGTGGCTACAACTGTGGGCAATGCCGACACGGGTTCACTGGACCAAACTGTGATCAGAGGATCTCTGTGGTGAGGAGGAATATCATGCAGATGAGCACATCTGAGAAGCAAGCATTTGTGAATGCTCTGGACCAAGCTAAGAGGACCGTCCACCCTGACCTGGTCATCTGTACAAGAAGATACCAGGACGTGTTTGGGCCCGATGGCATCACCCCACAGTTTGAGAACATCACCATTTATAACTACTTTGTGTGGAGCCACTACTACTCCGTCAGTAAAACCTACCTGGGGCCAGGCCAGACCAGCTTCGGAGGTGTGGACTTCTCCCACGAGGGCCCGGGTTTTGTCACCTGGCACCGTTTTCATCTGTTGCAACTGGAGAGAGACATGCAGGACATGCTGGGC A

[0028] The underlined portion is the start codon, and the bold underlined portion is the mutation position from base G to base A.

[0029] Example 1

[0030] Example 1 of the present invention provides a method for screening SNP molecular markers associated with melanization of turbot, which specifically comprises the following steps:

[0031] (1) Pathway analysis

[0032] Normal skin, white skin with black eyeless side, and black skin with black eyeless side were collected from Yellow Sea Aquatic Products Co., Ltd., Haiyang City, Shandong Province. RNA was extracted and bidirectional transcriptome sequencing was performed. SNP analysis was then performed on the sequencing data to preliminarily detect SNP sites. Gene annotation, differential gene expression analysis, GO enrichment analysis, and KEGG enrichment analysis were performed to identify pathways significantly enriched in the differentially expressed genes. Five pathways related to body color were identified: phototransduction pathway, retinol metabolism pathway, thyroid hormone synthesis pathway, PPAR signaling pathway, and melanogenesi pathway.

[0033] (2) SNP site screening

[0034] SNP analysis was performed on the five pathways related to body color in step (1). There were 59 genes with SNP sites in the five pathways. SNP sites with non-synonymous mutations in the coding regions were screened using Blast software on the NCBI website. Finally, 32 SNP sites in the coding regions of 42 genes were obtained.

[0035] (3) SNP locus typing

[0036] Use SNP locus typing primers:

[0037] Upstream primer (SEQ ID NO. 2): 5′-GCCCAAAGAGTCGTAGTCGT-3′;

[0038] Downstream primer (SEQ ID NO. 3): 5'-ACAAGGTGACATGTTCTTTCCCTAT-3'; 32 SNP sites obtained in step (2) were used to genotype turbot.

[0039] Twelve normal turbot and 13 blackened turbot samples were collected from the Yellow Sea Aquatic Products Co., Ltd. in Haiyang City, Shandong Province under the same growth environment. DNA was extracted, primers were designed for each SNP site, PCR was performed using the extracted DNA as a template, and the SNP sites were typed by direct sequencing.

[0040] Typing rules: If there is only a G peak at the corresponding position in the sequencing peak graph, the individual genotype is GG. If there are double peaks of G and A, the individual genotype is G / A. If there is only an A peak, the individual genotype is AA. The results are shown in Figures 1 to 3 .

[0041] (4) Screening for SNPs associated with the blackening of the eyeless side of turbot

[0042] The genotypes of each SNP locus of 12 normal turbot samples and 13 melanized turbot samples were statistically analyzed. The genotype statistical results of normal turbot samples and melanized turbot samples were subjected to one-way analysis of variance using SPSS27.0 software (P<0.05: significant difference; P<0.01: extremely significant difference). The SNP loci with significant differences were retained. Finally, a SNP locus with extremely significant difference in genotype distribution between normal turbot and melanized turbot samples was obtained (see Table 1), namely, tyrp1b-835-G / A at the 835 bp position of the tyrosinase-related protein 1b gene (XM 035638489.2), as shown in SEQ ID NO.1.

[0043] From Table 1 and Figure 4 It can be seen that the base G at the 835bp position of the sequence shown in SEQ ID NO.1 mutated into A, and aspartic acid became asparagine, making the eyeless side of the turbot less likely to melanize.

[0044] The genotype of normal turbot was 41.67% GG, 33.33% GA, and 25% AA, while the genotype of black turbot was 84.62% GG, 15.38% GA, and 0% AA.

[0045] Table 1 Statistical results of genotype distribution among different types of samples at the tyrp1b-835-G / A locus

[0046]

[0047]

[0048] Table 2 Significance X of comparison between samples 2 distributed

[0049] Blackened turbot Normal turbot 7.104*

[0050] Note: X 2 0.05(2) =5.991, X 2 0.01(2) =9.21, P=0.029

[0051] According to the typing results, the normal dominant genotype of the tyrp1b-835-G / A locus is GG homozygous, accounting for 41.67%; the dominant genotype of the blackened turbot is GG homozygous, accounting for 84.62%.

[0052] SPSS software was used to perform inter-group significance test. The significance test results of normal turbot and blackened turbot were X 2 =7.104>X 2 0.05 , P < 0.05, indicating that there was a significant difference in the genotype distribution between normal turbot samples and melanized turbot samples at this site, and this SNP site was associated with the melanization of turbot.

[0053] Example 2

[0054] Example 2 of the present invention verifies whether the SNP site screened in Example 1 has universal characteristics in normal turbot and turbot with blackened eyeless side. The specific implementation method is as follows:

[0055] Different types of turbot samples were collected: 50 normal turbot samples and 50 blackened turbot with eyeless side body color. DNA of the samples was extracted, and PCR amplification was performed using the primers provided by SEQ ID NO.2 and SEQ ID NO.3 with the extracted sample DNA as a template. The products were sequenced and the sequencing results were analyzed. The genotypes of the tyrp1b-835-G / A locus of the samples were statistically analyzed. The genotype statistical results of the normal turbot samples and the blackened turbot samples with eyeless side body color were analyzed by chi-square test using SPSS27.0 software (P < 0.05: significant difference; P < 0.01: extremely significant difference). The statistical results are shown in Tables 3 and 4.

[0056] Table 3 Statistical results of genotype distribution among different types of samples at the tyrp1b-835-G / A locus

[0057]

[0058]

[0059] Table 4 Significance X of comparison between samples 2 distributed

[0060] Blackened turbot Normal turbot 6.210*

[0061] Note: X 2 0.05(2)=5.991, X 2 0.01(2) =9.21 P=0.045

[0062] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Application of a SNP molecular marker associated with turbot melanization in turbot breeding, characterized in that: The SNP molecular marker is the base sequence shown in SEQ ID NO.1; the 835 bp position of the base sequence shown in SEQ ID NO.1 is obtained by mutation of base G to base A, and aspartic acid is changed to asparagine, which makes the eyeless side of turbot less likely to melanize.

Images