A SNP site related to rice tocotrienol content or a detection reagent and application thereof

Abstract

The present application relates to a SNP site or a detection reagent and application thereof related to the tocotrienol content of rice, and belongs to the field of plant molecular biotechnology. The application of the SNP site or the detection reagent related to the tocotrienol content of rice in the present application includes the following (I) or (II): (I) application in predicting the tocotrienol content of rice; (II) application in the breeding of rice lines with high tocotrienol content; The SNP site related to the tocotrienol content of rice is located at the 23781761st base of chromosome 7 of rice. Based on the mutation of the SNP site at the 23781761st base of chromosome 7 of rice, the present application designs and develops a three-primer combination with a short amplification fragment and strong specificity, which can clearly distinguish the homozygous T, homozygous G and heterozygous H genotypes, and predict whether the tocotrienol content in rice is increased.

Description

Technical Field

[0001] The present application relates to the field of plant molecular biotechnology, and in particular to a SNP site associated with the tocotrienol content in rice or a detection reagent and application thereof. Background Art

[0002] Rice is one of the main food crops in my country, and its nutritional quality is essential to human health. Vitamin E is an important fat-soluble vitamin that has attracted the attention of researchers a long time ago. Initial studies focused on the antioxidant effect of vitamin E, and found that it can protect cells from damage by free radicals. Vitamin E contains two types of compounds, tocopherol and tocotrienol, each of which is divided into four isomers: α, β, γ, and δ. As the research deepened, researchers gradually separated tocotrienol from vitamin E. Compared with tocopherol, tocotrienol has an unsaturated side chain in its structure, which gives it some unique biological activities and physiological functions.

[0003] It has been found that tocotrienols are widely present in some natural plants, such as palm oil, rice bran oil, barley, etc. The study of these natural products has prompted researchers to focus on the active ingredients in them, and tocotrienols have therefore received more attention. For example, rice contains a relatively high content of tocotrienols, which provides a rich source for its research.

[0004] Studies have found that tocotrienols have a variety of biological activities, such as anti-oxidation, hypolipidemic, anti-cancer, neuroprotection, etc. These properties make them potential candidate drugs or health care products for the prevention and treatment of chronic diseases. Therefore, the research on tocotrienols has received more and more attention and support. Summary of the invention

[0005] In view of this, the present application provides a SNP site related to the tocotrienol content in rice or a detection reagent and application thereof, and predicts the tocotrienol content in rice by genotyping the SNP site that regulates the tocotrienol content in rice.

[0006] In a first aspect, the present application provides an application of a SNP site associated with the tocotrienol content of rice or a detection reagent thereof, wherein the application includes the following (I) or (II):

[0007] (I) Application in predicting tocotrienol content in rice;

[0008] (II) Application in the breeding of rice lines with high tocotrienol content;

[0009] The SNP site is located at the 23781761st base of rice chromosome 7. Specifically, the SNP site is located at the 23781761st base of chromosome 7 of the rice genome version Os-Nipponbare-Reference-IRGSP-1.0.

[0010] This application uses whole-genome association analysis to locate SNP sites associated with tocotrienol content: 533 rice germplasm resources collected from all over the world are used as research objects, resequencing technology is used to determine the nuclear genome sequence of each variety, and high-performance liquid chromatography-mass spectrometry combined with broad targeted metabolite determination technology is used to determine the relative content of tocotrienols in polished rice; based on the above genome and tocotrienol relative content data, metabolite-based whole-genome association analysis is carried out to locate a SNP site that is significantly correlated with the relative content of tocotrienols in rice; this site is located at base 23781761 of chromosome 7 of rice (genome version Os - Nipponbare - Reference - IRGSP-1.0).

[0011] In some embodiments, which may include the above embodiments, the rice is polished rice / brown rice.

[0012] In some embodiments that may include the above embodiments, the reagent includes a primer set, and the nucleotide sequence of the primer set is shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0013] In some embodiments that may include the above embodiments, the nucleotide sequence containing the SNP site is shown as SEQ ID NO.6; wherein the SNP site is located at the 201st position of the sequence shown as SEQ ID NO.6.

[0014] In some embodiments that may include the above embodiments, the method for predicting the tocotrienol content of rice is: detecting the genotype of the SNP site related to the tocotrienol content of the sample to be tested, if the genotype of the sample to be tested is a homozygous T genotype, then the probability that the sample to be tested has a high tocotrienol content is significantly higher than other genotypes; if the genotype of the sample to be tested is a heterozygous H genotype, then the sample to be tested has a medium tocotrienol content; if the genotype of the sample to be tested is a homozygous G genotype, then the sample to be tested has a low tocotrienol content.

[0015] The second aspect of the present application also provides a primer set for detecting a SNP site related to the tocotrienol content in rice, wherein the SNP site is located at base 23781761 of chromosome 7 of rice (genomic version Os-Nipponbare-Reference-IRGSP-1.0); the nucleotide sequence of the primer set is shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0016] The third aspect of the present application also provides a method for predicting the tocotrienol content of rice, by detecting the genotype of the SNP site related to the tocotrienol content of the sample to be tested and predicting the tocotrienol content of rice. If the genotype is a homozygous T genotype, the probability that the sample to be tested has a high tocotrienol content is significantly higher than other genotypes; if the genotype of the sample to be tested is a heterozygous H genotype, the sample to be tested has a medium tocotrienol content; if the genotype of the sample to be tested is a homozygous G genotype, the sample to be tested has a low tocotrienol content; the SNP site is located at the 23781761st base of chromosome 7 of rice.

[0017] In some embodiments that may include the above embodiments, the following steps are included: the detection method includes: using the genomic DNA of the sample to be tested as a template, using the above primer set to perform PCR amplification, determining the genotype of the SNP site related to the tocotrienol content of the sample to be tested and rice according to the PCR reaction result, and judging the tocotrienol content of the sample to be tested according to the genotype.

[0018] The fourth aspect of the present application also provides a method for breeding rice lines with high tocotrienol content, comprising the following steps:

[0019] (1) Detecting the genotype of a SNP site related to the tocotrienol content of rice, hybridizing a recipient parent with a genotype of TT as the male parent with a rice genotype of GG to obtain F1; the SNP site is located at base 23781761 of chromosome 7 of rice;

[0020] (2) Using primers with sequences such as SEQ ID No. 1 to 3 to detect the genotype of the F1 hybrid, selecting a true hybrid as the female parent, and backcrossing it with the recipient parent with the genotype T to obtain BC1F1;

[0021] (3) Planting BC1F1, using primers with sequences such as SEQ ID No. 1 to 3 to detect the genotype of the BC1F1 plant; selecting plants with a heterozygous genotype at the SNP site;

[0022] (4) Identify the genetic background of the individual plants selected in step (3) and select plants with high genotype similarity to the recurrent parent;

[0023] (5) backcrossing the plant selected in step (4) with the recipient parent of genotype T to obtain BC2F1;

[0024] (6) Planting BC2F1, repeating steps (3) and (4), selecting plants with heterozygous genotypes at the SNP loci and high genetic background recovery rates, and harvesting them from the hybrid BC2F2;

[0025] (7) Planting BC2F2, repeating steps (3) and (4), selecting plants with a SNP locus genotype of T and the highest genetic background homozygosity rate, and harvesting them from the hybrid BC2F3;

[0026] (8) Select BC2F3 inbred rice plants with significantly increased tocotrienol contents in both brown rice and polished rice to breed into rice lines with high tocotrienol content.

[0027] In some embodiments, which may include the above embodiments, the recipient parent with genotype T is NTD615.

[0028] Among them, NTD615 germplasm was introduced from the Crop Genetic Improvement Laboratory of Huazhong Agricultural University and was the research material used in the unit's publicly published literature (Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection. W. Xie, G. Wang, M. Yuan, W.Yao, K. Lyu, H. Zhao, et al.Proc Natl Acad Sci USA 2015 Vol. 112 Issue 39Pages E5411-9).

[0029] Compared with the prior art, this application has the following beneficial effects:

[0030] The present application designs and develops a three-primer combination with a short amplified fragment and strong specificity based on a mutation in which the base G at position 23781761 of chromosome 7 of rice that is related to the tocotrienol content of rice is replaced by T. The marker is used to perform PCR amplification using detection primers with different fluorescence, and the detection primers corresponding to the specific sequence grow exponentially with the PCR reaction. After a signal is generated, the corresponding signal is detected, and the homozygous T, homozygous G and heterozygous H genotypes can be clearly distinguished, thereby completing the genotyping of the SNP site that regulates the tocotrienol content in rice and predicting whether the tocotrienol content in rice is increased. The present application has the advantages of simple operation, rapid typing, accurate results, and low cost, and can improve the efficiency of trait selection, shorten the breeding period, and meet the needs of large-scale auxiliary selection of SNP sites related to the tocotrienol content of rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0032] Figure 1 The genotype of the SNP locus of variety 608 black is homozygous G;

[0033] Figure 2 The genotype of the SNP locus of variety NTD615 is homozygous T;

[0034] Figure 3 The results of detecting KASP fluorescence signals of genomic DNA of eight rice samples using VEQ7-F1, VEQ7-F2 and VEQ7-Ra;

[0035] Figure 4 The results are obtained by using primer sets VEQ7-F1, VEQ7-F2 and VEQ7-Ra to detect the fluorescence signal readings of 10 rice varieties (excluding the control variety), the homozygous G control variety 608 Black, the homozygous T control variety NTD615, the mixed DNA of the heterozygous control 608 Black and NTD615, and two ddH2O of the negative control;

[0036] Figure 5 This is the result of the F1 generation genotype test;

[0037] Figure 6 The effect of VEQ7 genotype on tocotrienol content in brown rice;

[0038] Figure 7Effect of VEQ7 genotype on tocotrienol content in polished rice. DETAILED DESCRIPTION

[0039] In order to make the purpose, technical solution and advantages of the embodiments of the present application clearer, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0040] Mapping the VEQ7L locus associated with α-tocopherol content using genome-wide association analysis

[0041] A total of 533 rice germplasm resources collected from all over the world were used as the research objects. The nuclear genome sequences of various varieties were determined using resequencing technology, and the relative content of α-tocopherol in polished rice was determined using high-performance liquid chromatography-mass spectrometry combined with broad targeted metabolite determination technology.

[0042] Based on the above genome and α-tocopherol relative content data, a metabolite-based genome-wide association analysis was conducted, and a SNP locus VEQ7 significantly associated with the relative content of α-tocopherol in rice was located (P = 0.5 × 10 -2 ). The SNP locus is located at base 23781761 of rice chromosome 7 (genome version Os-Nipponbare-Reference-IRGSP-1.0). Resequencing data showed that two genotypes were detected at the VEQ7L locus in the 533 varieties. Among them, there were 406 varieties with homozygous TT genotype and 127 varieties with homozygous GG genotype. (See Table 1)

[0043] Table 1: Genotypes of VEQ7L locus and relative content of α-tocopherol in 533 rice materials

[0044]

[0045] Example 1: SNP site genotype Sanger sequencing verification:

[0046] From the above 533 varieties, NTD615 and 608 black with homozygous T and homozygous G genotypes were selected. Tocotrienol, the sequence of 200 bp upstream and downstream of the VEQ7 SNP site is as follows (the bold part is the SNP site):

[0047] CTTAACCTGTTGCGGCTTGTTTGTTAACTCGAGGGAAGGGGATTGGGAGTTTACATGAGGGAATTGATGATGAGATTAATATGGGAATTTGATTTTTAATCCCAATATCTTGTTTGGTAGAGGTAATGGAAATTGATAGGGAGTTTAGTTGGAGATTAGGTCATTAATAAAAACGGATGGCTGAGATTTGCTTAGACAAAGT AAAGGAGGAATTCCCTCCCAATTACCTACCCCTATCCAGATATTGAAAAGGAGGGAGTTCCTTCCTCAATTCCTCATCCTCATCCCACAAAAATTCCCATGTCTCCCAACCAAACAAACACTTAATAGGCTTATCCCTCTAAACTCCCAATATCTCCTAAAAACTCCCTACAACCAAAAGCACCGTTGGTGTTGGAAA (SEQ ID No. 6).

[0048] The following primers were designed based on the 200 bp sequence upstream and downstream of the above SNP site:

[0049] VEQ7CXF (SEQ ID No. 4): TTAACTCGAGGGAAGGGGAT; VEQ7CXR (SEQ ID No. 5): ATGGTAATTTCCTCGAGCCTTC. Using the genomic DNA of varieties 608 black and NTD615 as templates, primers were used to amplify VEQ7CXF and VEQ7CXR respectively, and the amplified products were sequenced by Sanger sequencing. The sequencing results showed that the SNP site genotype of variety NTD615 was homozygous T ( Figure 2 ), the SNP locus genotype of variety 608 black is homozygous G (such as Figure 1 ).

[0050] Example 2, SNP site KASP marker development:

[0051] (1) Primer design: According to the instructions of the KASP kit (KASP-TF V4.0 2X Master Mix) of LGC (Laboratory of the Government Chemist) and the sequence of 200bp genomic DNA upstream and downstream of the SNP site, three sets of three primer combinations for identifying the genotype of the tocotrienol SNP site were designed, namely, the primer combinations VEQ7-F1, VEQ7-F2 and VEQ7-Ra. The primer sequences are as follows:

[0052] Q7L-F1 (SEQ ID No. 1):

[0053] GAAGGTGACCAAGTTCATGCTGGCTGAGATTTGCTTAGACAACG;

[0054] Q7L - F2 (SEQ ID No. 2): GAAGGTCGGAGTCAACGGATTGGCTGAGATTTGCTTAGACAACT;

[0055] Q7L-Ra (SEQ ID No. 3):

[0056] CCTTTTCAATATCTGGATAGGGGTA.

[0057] (2) Expected amplification results of different primer combinations: Based on the primer sequences, the above three primer combinations were used to amplify the genomic DNA of rice varieties, and the fluorescence signals of the amplified products were detected using a SNP genotyping detector (LGC; Fluostar Omega; SNP LineLite Omega F). If the fluorescence signal released by the amplified product is red, it indicates that the sample to be tested has a homozygous G genotype, i.e., GG; if it releases a blue fluorescence signal, it indicates that the sample to be tested has a homozygous T genotype, i.e., TT; if it releases a green fluorescence signal, it indicates that the sample to be tested has a heterozygous genotype H.

[0058] (3) Actual amplification effects of different primer combinations: Figure 3 The results of detecting the KASP fluorescence signal of genomic DNA of 8 rice samples using VEQ7-F1, VEQ7-F2 and VEQ7-Ra. One sample was aggregated with NTD615, and its KASP fluorescence was blue, indicating that its genotype was homozygous T. Four samples were aggregated with 608 Black, and its KASP fluorescence was red, indicating that its genotype was homozygous G. One sample was mixed with genomic DNA of 608 Black and NTD615 at equal concentrations and volumes, and its KASP fluorescence was green, indicating that its genotype was H. The black dots are the KASP results of the negative control ddH2O. Figure 4 The fluorescence signal reading results of 10 rice varieties (excluding the control variety) were detected using primer sets VEQ7-F1, VEQ7-F2 and VEQ7-Ra. Figure 4 also includes the mixed DNA of the homozygous G control variety 608 Black, the homozygous T control variety NTD615, and the heterozygous control 608 Black and NTD615, as well as the fluorescence signal reading results of the two ddH2O negative controls. Figure 4As shown, the fluorescence signal of ddH2O is black, indicating that no fluorescence is produced. In summary, the primer sets of VEQ7-F1, VEQ7-F2 and VEQ7-Ra can effectively distinguish the genotypes of SNP loci.

[0059] Example 3: Identification of genotypes of SNP sites in F2 segregating populations using KASP markers:

[0060] (1) Experimental materials: The recipient parent, such as 608 Black, is hybridized with the donor parent NTD615 to obtain F1, and the F1 is self-pollinated to obtain F2.

[0061] (2) PCR amplification and detection: The parent variety 608 Black was used as the homozygous G genotype control, the parent variety NTD615 was used as the homozygous T genotype control, and the genomic DNA of 608 Black and NTD615 was mixed in equal amounts as the heterozygous genotype control. The leaf genomic DNA of the individual plants of the F2 population was extracted using the KASP primer combination (VEQ7-F1, VEQ7-F2, VEQ7-Ra) obtained by actual screening for PCR amplification. The KASP-TF V4.0 2X Master Mix kit from LGC Genomics was used for amplification. The PCR reaction system was 10 μL, including 4.86 μL of 2×KASP Master mix, 36 μM of VEQ7-F1, VEQ7-F2 primers, and 90 μM of VEQ7-Ra primer. The three primers were mixed in a volume ratio of 1:1:1 to form KASP Asssymix. 0.14 μL of KASP Asssy mix and 5 μL of 10 ng / μL template DNA were taken.

[0062] (3) Results and analysis: Genotype test results are as follows Figure 5 As shown (see Table 2 for specific results). 18 individual PCR products emitted blue fluorescent signals, and their signal points were clustered together with the parent variety NTD615 that also emitted blue fluorescent signals in the coordinate system, indicating that the genotype of its SNP site was homozygous T. 13 individual PCR products emitted red fluorescent signals, and their signal points were clustered together with the parent variety 608 that also emitted red fluorescent signals in the coordinate system, indicating that the genotype of its SNP site was homozygous G. 39 individual PCR products emitted green fluorescent signals, and their signal points were clustered together with the heterozygous control that also emitted green fluorescent signals in the coordinate system, indicating that the genotype of its SNP site was H.

[0063] Table 2: Genotypes of SNP loci in F2 segregating population

[0064]

[0065] Example 4: Effect of SNP sites on tocotrienol content in brown rice of F2 plants:

[0066] (1) Experimental materials: F2 population.

[0067] (2) Detection of relative content of tocotrienols: 10 g of rice grains were collected from each F2 plant, husked, and ground into brown rice powder. 0.1 g of the powder was weighed and 1 mL of extraction solution (70% methanol) was added to extract the metabolites. The relative content of tocotrienols was detected using a high performance liquid chromatography-triple quadrupole-linear ion trap mass spectrometry detection system (HPLC-6500 QTRAP, AB SCIEX) using a broad targeted metabolomics detection method.

[0068] (3) Results and analysis: According to the genotype of the VEQ7 locus, the 62 F2 plants described in this example were divided into genotype groups of TT, GG and H. Figure 6 The effect of VEQ7 genotype on the content of tocotrienols in brown rice (see Table 3 for specific data). In the brown rice of TT genotype plants, except for abnormal values, the lowest relative content of tocotrienols was 357087.2, the highest was 959479.7, and the average was 645323.6478. In the brown rice of GG genotype plants, except for abnormal values, the lowest relative content of tocotrienols was 294590.5, the highest was 678266.5, and the average was 531727.7936. In the brown rice of H genotype plants, except for abnormal values, the lowest relative content of tocotrienols was 339595.9738, the highest was 785893.0518, and the average was 559136.4812. The t test showed that the relative content of tocotrienols in brown rice of plants with homozygous TT genotype was significantly higher than that of plants with homozygous GG genotype (P = 0.045), and the average relative content of tocotrienols in brown rice of plants with H genotype was significantly higher than that of plants with GG genotype (P = 0.587). The above results indicate that the SNP locus has the function of regulating the tocotrienol content of rice brown rice. Among them, the average content of tocotrienols in brown rice was lower when the SNP locus genotype was homozygous GG genotype, while the average content of tocotrienols in brown rice was higher when the SNP locus genotype was TT.

[0069] Table 3: Relative content of tocotrienols in brown rice of different genotypes at SNP sites

[0070]

[0071] Example 5: Effect of SNP loci on the content of tocotrienols in polished rice of F2 plants:

[0072] (1) Experimental materials: F2 population.

[0073] (2) Detection of relative content of tocotrienols: 10 g of rice grains were collected from each F2 plant, husked, and ground into polished rice powder. 0.1 g of the powder was weighed and 1 mL of extraction solution (70% methanol) was added to extract the metabolites. The relative content of tocotrienols was detected using a high performance liquid chromatography-triple quadrupole-linear ion trap mass spectrometry detection system (HPLC-6500 QTRAP, AB SCIEX) using a broad targeted metabolomics detection method.

[0074] (3) Results and analysis: Based on the genotypes of the SNP loci, the 84 F2 plants described in this example were divided into genotype groups of TT, GG and H. Figure 7 The effect of VEQ7 genotype on the content of tocotrienols in polished rice is shown in Table 4. In the polished rice of TT genotype plants, except for abnormal values, the lowest value of the relative content of tocotrienols is 85539.92179, the highest value is 543475.1797, and the average value is 250273.4925. In the polished rice of GG genotype plants, except for abnormal values, the lowest value of the relative content of tocotrienols is 42565.7378, the highest value is 201201.0414, and the average value is 128476.9374. In the polished rice of H genotype plants, except for abnormal values, the lowest value of the relative content of tocotrienols is 43586.75385, the highest value is 352592.3268, and the average value is 174625.3792. The t test showed that the relative content of tocotrienols in polished rice of TT genotype plants was significantly higher than that of GG genotype plants (P=0.002152441), and the relative content of tocotrienols in polished rice of H genotype plants was significantly higher than that of GG genotype plants (P=0.0.02134743). The above results indicate that the SNP locus has the function of regulating the tocotrienol content of polished rice. Among them, the average content of tocotrienols in polished rice was lower when the SNP locus genotype was GG, while the average content of tocotrienols in polished rice was higher when the SNP locus genotype was TT and H.

[0075] Table 4: Relative content of tocotrienols in polished rice of different genotypes at SNP sites

[0076]

[0077] Example 6: Using VEQ7 marker to increase the tocotrienol content in rice:

[0078] The donor parent 608 Black is hybridized, backcrossed and selfed with a recipient with normal fertility, such as NTD615, and the SNP loci and genetic background are selected in the process, and finally a strain with a TT genotype at the SNP loci in the background of NTD615 and an increased tocotrienol content in polished rice is obtained. The specific implementation steps are as follows:

[0079] (1) Use the recipient parent (such as NTD615) as the male parent and hybridize it with 608 black to obtain F1.

[0080] (2) Use primers with sequences such as SEQ ID No. 1 to 3 to detect the genotype of the F1 hybrid, select a true hybrid (i.e., a plant whose PCR product produces a green fluorescent signal) as the female parent, and backcross it with the recipient parent (such as NTD615) to obtain BC1F1.

[0081] (3) Plant BC1F1 and detect the genotype of the BC1F1 plant using primers with sequences such as SEQ ID No. 1 to 3. Select plants with heterozygous genotypes at the SNP site.

[0082] (4) Using a set of genotypes (e.g., 100, or 200, etc.) that are polymorphic and evenly distributed between the genomes of 608 Black and the recipient parent (e.g., NTD615), the genetic background of the individual plants selected in step (3) is identified, and plants with high genotype similarity to the recurrent parent (e.g., greater than 88% similarity, or 2% selection rate, etc.) are selected.

[0083] (5) Backcross the plant selected in step (4) with the recipient parent (such as NTD615) to obtain BC2F1.

[0084] (6) Plant BC2F1 and repeat steps (3) and (4) to select plants with heterozygous VEQ7 genotype and high genetic background recovery rate (e.g., greater than 98%, or 2% selection rate, etc.) and collect them as self-cross BC2F2.

[0085] (7) Plant BC2F2 and repeat steps (3) and (4) to select plants with a VEQ7 genotype of TT and the highest genetic background homozygosity rate, and collect them from the hybrid BC2F3.

[0086] (8) Determine the tocotrienol contents of brown rice and polished rice in BC2F3 inbred varieties and NTD615; and select individual plants with significantly increased tocotrienol contents in brown rice and polished rice from BC2F3 inbred varieties and propagate them into rice lines with high tocotrienol contents by comparing them with the tocotrienol contents in NTD615.

[0087] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. The use of a detection reagent for a SNP site associated with the tocotrienol content in rice, characterized in that: The application includes the following (I) or (II): (I) Application in predicting tocotrienol content in rice; (II) Application in the breeding of rice lines with high tocotrienol content; The nucleotide sequence containing the SNP site is shown in SEQ ID NO.6; wherein the SNP site is located at position 201 of the sequence shown in SEQ ID NO.6; The genotype of the SNP site related to the tocotrienol content of rice in the sample to be tested is detected. If the genotype of the sample to be tested is a homozygous T genotype, the probability that the sample to be tested has a high tocotrienol content is significantly higher than that of other genotypes; if the genotype of the sample to be tested is a heterozygous H genotype, the sample to be tested has a medium tocotrienol content; if the genotype of the sample to be tested is a homozygous G genotype, the sample to be tested has a low tocotrienol content.

2. The use of the detection reagent for SNP sites related to the tocotrienol content in rice according to claim 1, characterized in that: The rice is polished rice / brown rice.

3. The use of the detection reagent for SNP sites related to tocotrienol content in rice according to claim 1, characterized in that: The reagents include a primer set, and the nucleotide sequences of the primer set are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

4. A method for predicting the tocotrienol content of rice, characterized in that: The tocotrienol content of rice is predicted by detecting the genotype of the SNP site related to the tocotrienol content of the sample to be tested. If the genotype is a homozygous T genotype, the probability that the sample to be tested has a high tocotrienol content is significantly higher than other genotypes; if the genotype of the sample to be tested is a heterozygous H genotype, the sample to be tested has a medium tocotrienol content; if the genotype of the sample to be tested is a homozygous G genotype, the sample to be tested has a low tocotrienol content; the SNP site is located at the 201st position of the sequence shown in SEQ ID NO.

6.

5. The method for predicting the tocotrienol content in rice according to claim 4, characterized in that: The following steps are involved: The detection method comprises: using the genomic DNA of the sample to be tested as a template, using the primer set described in claim 3 to perform PCR amplification, determining the genotype of the SNP site related to the tocotrienol content of the sample to be tested and rice according to the PCR reaction result, and judging the tocotrienol content of the sample to be tested according to the genotype.

6. A method for breeding rice strains with high tocotrienol content, characterized in that: The following steps are involved: (1) Detecting the genotype of a SNP site related to the tocotrienol content of rice, hybridizing a recipient parent with a genotype of TT as the male parent with a rice with a genotype of GG to obtain F1; the SNP site is located at position 201 of the sequence shown in SEQ ID NO.6; (2) Using primers with sequences such as SEQ ID No. 1 to 3 to detect the genotype of the F1 hybrid, selecting a true hybrid as the female parent, and backcrossing it with the recipient parent with the genotype T to obtain BC1F1; (3) Planting BC1F1, using primers with sequences such as SEQ ID No. 1 to 3 to detect the genotype of the BC1F1 plant; selecting plants with a heterozygous genotype at the SNP site; (4) Identify the genetic background of the individual plants selected in step (3) and select plants with high genotype similarity to the recurrent parent; (5) backcrossing the plant selected in step (4) with the recipient parent of genotype T to obtain BC2F1; (6) Planting BC2F1, repeating steps (3) and (4), selecting plants with heterozygous genotypes at the SNP loci and high genetic background recovery rates, and harvesting them from the hybrid BC2F2; (7) Planting BC2F2, repeating steps (3) and (4), selecting plants with a SNP locus genotype of T and the highest genetic background homozygosity rate, and harvesting them from the hybrid BC2F3; (8) Select BC2F3 inbred rice plants with significantly increased tocotrienol contents in both brown rice and polished rice to breed into rice lines with high tocotrienol content.

7. The method for breeding rice lines with high tocotrienol content according to claim 6, characterized in that: The recipient parent with genotype T is NTD615.

Images