Application of CX3CR1 gene inhibitor in preparation of medicine for treating depression

Abstract

The invention provides an application of a CX3CR1 gene inhibitor in preparation of a drug for treating depression. The inhibitor comprises at least one of the following two siRNAs: siRNA-1 and siRNA-2; the invention also provides a gene line containing the gene, a nucleic acid delivery system and application. The invention has the following advantages: on the basis of finding a new depression target CX3CR1, two siRNAs are designed, and the inhibition effect of the siRNAs is proved; the two siRNAs are loaded into a self-assembly nucleic acid drug delivery system which is independently designed and invented to form a novel gene inhibitor for targeted treatment of depression, and a very good treatment effect is obtained; the gene inhibitor can effectively inhibit nerve synapse and dendritic spine injury caused by excessive activation of microglial cells, and has great significance in clinical treatment of depression.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of a CX3CR1 gene inhibitor in the preparation of a drug for treating depression. Background Art

[0002] Depression is a common mental disorder, known as the "cold in psychiatry". Its lifetime prevalence is as high as 10% to 20%, and there are 350 million patients worldwide. Depression is characterized by high incidence, high recurrence, and high disability. It is the leading cause of disability around the world and a major factor in the global burden of disease. The biological etiology and pathogenesis of depression are still unclear, but it is generally believed that its onset is the result of the combined effects of genetic and environmental factors. The heritability of major depression is about 40%-50%. The pathogenesis of depression involves a variety of highly complex and interrelated pathways, mainly including monoamines, HPA axis, neurotrophic factors and neurogenesis, excitatory and inhibitory neurotransmission, mitochondrial dysfunction, epigenetics, inflammation, opioid system, myelination and gut-brain axis. The unknown genetic etiology and pathological mechanism of depression and the lack of universal drug targets bring great difficulties to clinical treatment.

[0003] Since 2000, a total of 12 drugs have been approved for the treatment of depression in the global market. At present, there are more than 30 kinds of antidepressants in the domestic medical market. These antidepressants cover various mechanisms of action, but their curative effects on patients are not very different. There are still quite a few patients who have no obvious effect after drug treatment, and the antidepressant effect of drug treatment is very limited. Currently, almost all antidepressants currently in clinical use improve depressive symptoms by affecting the signal transmission of monoamine neurotransmitters (including serotonin and norepinephrine), and the drug target was discovered 30 years ago. The defect of this type of drug is that it can only relieve the symptoms of a small number of patients, and it takes weeks or even months to alleviate depressive symptoms, and the side effects are serious. On March 5, 2019, the U.S. Food and Drug Administration (FDA) approved a new antidepressant drug: Spravato (esketamine) esketamine for listing, which became the first fast-acting antidepressant on the market. This is the first drug to treat depression with a new mechanism of action in 30 years, and it is used together with oral antidepressants to treat refractory depression. Unlike most antidepressants, esketamine can improve a patient's mood within 2-3 hours, but the drug requires strict dosage control and is addictive. The field of depression urgently needs new genetic and pathogenesis guidance and support for drug development. Just one ketamine is far from enough. With the changes in people's quality of life and environment, depression has become more and more prevalent in our lives, and the size of its drug market will become larger and larger. More "safe, effective, and new" antidepressants are urgently needed in clinical practice. Summary of the invention

[0004] In view of the above-mentioned technical limitations, the present invention proposes the use of a CX3CR1 gene inhibitor in the preparation of a drug for treating depression; it overcomes the deficiencies and defects mentioned in the background technology.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The invention point of the present invention is to provide the use of a CX3CR1 gene inhibitor in the preparation of a drug for treating depression, wherein the CX3CR1 gene inhibitor comprises at least one of the following two siRNAs: siRNA-1, whose sense strand is shown in the sequence SEQ ID No.1, and whose antisense strand is shown in the sequence SEQ ID No.2; siRNA-2, whose sense strand is shown in the sequence SEQ ID No.3, and whose antisense strand is shown in the sequence SEQ ID No.4.

[0007] siRNA-1 (LOT.NO.R103306539) positive chain SEQ ID No.1:

[0008] CUCUCAAGUUCUACAACUUCU;

[0009] siRNA-1 (LOT.NO.R103306539) antisense strand SEQ ID No.2:

[0010] AGAAGUUGUAGAACUUGAGAG.

[0011] siRNA-2 (LOT.NO.R103306541) positive chain SEQ ID No.3:

[0012] ACAGCAUUCUGAGCAGUUUCA;

[0013] siRNA-2 (LOT.NO.R103306541) antisense strand SEQ ID No.4:

[0014] UGAAACUGCUCAGAAUGCUGU.

[0015] The second inventive point of the present invention is to provide a gene circuit for preparing a drug for treating depression, wherein the gene circuit includes at least one of the two siRNAs mentioned above that can inhibit the expression of the CX3CR1 gene and / or at least one targeting gene encoding a protein or peptide with a targeting function, and the targeting gene is inserted into the gene sequence encoding the lamp2b protein. The gene circuit is a sequence that can be enriched in the host organ tissue and self-assembled to form a composite structure. The gene circuit achieves the treatment of depression by inhibiting the expression of the gene through the siRNA.

[0016] Optionally, in the above-mentioned gene circuit, the protein or peptide with targeting function includes RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, MSP targeting peptide; preferably RVG targeting peptide.

[0017] Optionally, the above gene circuit further comprises a promoter; the types of the gene circuit include: promoter-siRNA, promoter-targeting gene and / or promoter-targeting gene-siRNA; the promoter is preferably the liver-specific promoter TBG.

[0018] Optionally, in the above-mentioned gene circuit, the organ tissue is liver, and the composite structure is exosome.

[0019] The third inventive aspect of the present invention is to provide a nucleic acid delivery system, which comprises the above-mentioned gene circuit and a delivery vector capable of delivering the gene circuit to the organ tissue of the host for enrichment.

[0020] Optionally, in the above-mentioned nucleic acid delivery system, the delivery vector containing the gene circuit can be enriched in the organ tissue of the host and self-assembled in the organ tissue of the host to form a composite structure, the targeting tag is located on the surface of the composite structure, and the composite structure searches for and binds to the target tissue through the targeting tag to deliver the RNA fragment into the target tissue.

[0021] Optionally, in the above-mentioned nucleic acid delivery system, the delivery vector is a viral vector or a non-viral vector, wherein the viral vector includes an adeno-associated viral vector, an adenoviral vector, a retroviral vector, preferably an adeno-associated viral vector AAV; the non-viral vector includes a plasmid vector, a liposome vector, a cationic polymer vector, a nanoparticle vector, a multifunctional envelope nanocarrier, preferably an LNP liposome nanoparticle.

[0022] The nucleic acid delivery system is a delivery system for use in mammals including humans.

[0023] The fourth invention point of the present invention is to provide the use of the above-mentioned nucleic acid delivery system in the preparation of a drug for treating depression, wherein the drug is administered orally, by inhalation, subcutaneously, intramuscularly, or intravenously; preferably, intramuscularly.

[0024] Optionally, in the above application, the drug for treating depression further includes a pharmaceutically acceptable carrier and pharmaceutical excipients.

[0025] The technology of the present invention studies and explains the genetic laws and pathogenesis of depression from a new perspective of intergenerational inheritance, discovers new drug targets based on this, and uses the independently developed nucleic acid drug delivery system to develop the first targeted therapeutic nucleic acid drug for depression (also the first in the central nervous system). Based on the naturally existing miRNA secretion and circulation system in mammals, combined with the design concept of synthetic biology, the theoretical systems and technical means of different fields are integrated, and the liver of mammals itself is used as a natural biological base (cell chassis). After the gene circuit composed of synthetic biology components (parts) is injected into the mouse body through the tail vein in the form of a plasmid, the liver cells expressing the gene circuit will be reshaped and serve the artificial design, and then use their own miRNA shearing and processing mechanism and secretion mechanism to efficiently produce, assemble, and encapsulate siRNA into exosomes. siRNA then reaches various tissues and organs through the endocrine circulation of exosomes, and finally realizes the in vivo self-assembly, endocrine and efficient delivery of exosome siRNA. This system has the following innovations and advantages compared to traditional siRNA drug delivery methods:

[0026] First, safety: Exosomes, which serve as siRNA transport carriers, are secreted by the body's own tissues and organs, thus ensuring the safety of siRNA delivery without introducing artificial carriers, and avoiding the toxicity, immunogenicity and other side effects of heterologous artificial carriers.

[0027] Second, it is convenient: Since the liver is the natural biological base for siRNA production and packaging, and the drug is transmitted entirely through the body's inherent circulatory system, large-scale cell culture, high-cost exosome separation and purification technology, precise stereotactic drug injection technology and physical auxiliary means are no longer required. Instead, only in vitro production and purification of plasmids containing gene loops are required, which greatly reduces production costs and technical requirements and increases the feasibility of clinical applications.

[0028] Third, high efficiency: Liver cells have the ability to assemble and secrete large amounts of exosomal siRNA, and exosomes are also quite efficient in material transport. Therefore, only a small amount of plasmids expressing gene loops need to be introduced to achieve effective silencing of target genes in vivo.

[0029] Fourth, personalized design: Since synthetic biology elements can be flexibly designed, arbitrarily replaced, and flexibly combined, the exosome siRNA delivery system is endowed with rich scalability. The gene circuit can be adjusted, modified, and upgraded according to treatment needs to meet the needs of personalized treatment, solving many problems of existing drugs such as slow action time, low efficacy, and serious side effects.

[0030] Compared with the prior art, the present invention has the following advantages:

[0031] The present invention provides an application of the CX3CR1 gene inhibitor in the preparation of a drug for treating depression. Based on the discovery of a new target for depression, CX3CR1, two siRNAs are designed and their inhibitory effects are demonstrated; further, the two siRNAs are loaded into a self-assembled nucleic acid drug delivery system, an AAV-based in vivo self-assembly delivery system, and an LNPs-based delivery system that are independently designed and invented, to form one or more novel gene inhibitors for targeted treatment of depression, achieving very good therapeutic effects; these gene inhibitors can effectively inhibit the damage to synapses and dendritic spines caused by excessive activation of microglia, and are of great significance for the clinical treatment of depression. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Shown is a schematic diagram of the entire process of designing a self-assembled drug delivery system for a CX3CR1 gene inhibitor in one embodiment of the present invention.

[0033] Figure 2 The figure shows the inhibitory effect detection on CX3CR1 when two siRNAs screened in one embodiment of the present invention are used alone or together.

[0034] Figure 3 The figure shows the knockdown effect detection (QT-PCR) on CX3CR1 mRNA when two siRNAs are used alone or together in one embodiment of the present invention.

[0035] Figure 4 Shown are the test results of the gene circuit and the positive drug (2R, 6R)-HNK treatment regimen in the CUMS model (Chronic Unpredictable Mild Stress Model) given in one embodiment of the present invention, as well as the behavioral statistics based on this model (n=15).

[0036] Figure 5 Shown are the western blot results of the gene circuit and the positive drug (2R, 6R)-HNK and the statistical results of the mRNA inhibition effect detection in the CUMS model given in one embodiment of the present invention.

[0037] Figure 6Shown are representative images of syn / psd95 immunofluorescence and cd68 / iba1 immunofluorescence of the gene circuit and the positive drug (2R, 6R)-HNK in the CUMS model given in one embodiment of the present invention.

[0038] Figure 7 Shown are the test results of the gene circuit and the positive drug (2R, 6R)-HNK treatment regimen in the LPS model (endotoxin model) given in one embodiment of the present invention, as well as the behavioral statistics based on this model (n=15).

[0039] Figure 8 Shown is a schematic diagram of the dosing regimen of the AAV-based self-assembled drug delivery system in the CUMS model according to one embodiment of the present invention.

[0040] Fig. 9 Shown is a behavioral statistical graph of the AAV-based self-assembled drug delivery system in the CUMS model according to an embodiment of the present invention (n=15).

[0041] Fig.10 Shown are the western blot results and QT-PCR results of the AAV-based self-assembled drug delivery system in the CUMS model of one embodiment of the present invention.

[0042] Fig.11 Shown is a graph of the mRNA expression levels of the inflammatory factors IL-6, IL-1β, and TNF-α in the brain of the AAV-based self-assembled drug delivery system in the CUMS model of one embodiment of the present invention.

[0043] Fig.12 Shown is the therapeutic effect of the LNPs-based in vivo self-assembly delivery system in the CUMS model, as shown by behavioral statistical graphs (n=15) in one embodiment of the present invention. DETAILED DESCRIPTION

[0044] In order to make the purpose, technical solution and advantages of the present invention more clear, the present invention is further described in detail below. However, it should be understood that the description herein is only used to explain the present invention and is not used to limit the scope of the present invention.

[0045] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention, and the terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The reagents and instruments used herein are all commercially available, and the characterization means involved can refer to the relevant descriptions in the prior art, which will not be repeated herein.

[0046] In the text of the present invention, the "gene circuit" recorded is actually a "gene loop", and the two actually indicate the same substance.

[0047] In order to further understand the present invention, the present invention is further described in detail below in conjunction with the best embodiment.

[0048] Example 1

[0049] The invention discloses an application of a CX3CR1 gene inhibitor in the preparation of a drug for treating depression. The CX3CR1 gene inhibitor comprises at least one of the following two siRNAs: siRNA-1, whose sense strand is shown in the sequence SEQ ID No.1, and whose antisense strand is shown in the sequence SEQ ID No.2; and siRNA-2, whose sense strand is shown in the sequence SEQ ID No.3, and whose antisense strand is shown in the sequence SEQ ID No.4.

[0050] siRNA-1 (LOT.NO.R103306539) positive chain SEQ ID No.1:

[0051] CUCUCAAGUUCUACAACUUCU;

[0052] siRNA-1 (LOT.NO.R103306539) antisense strand SEQ ID No.2:

[0053] AGAAGUUGUAGAACUUGAGAG.

[0054] siRNA-2 (LOT.NO.R103306541) positive chain SEQ ID No.3:

[0055] ACAGCAUUCUGAGCAGUUUCA;

[0056] siRNA-2 (LOT.NO.R103306541) antisense strand SEQ ID No.4:

[0057] UGAAACUGCUCAGAAUGCUGU.

[0058] The present invention also provides a gene circuit for preparing a drug for treating depression, wherein the gene circuit comprises at least one of the two siRNAs capable of inhibiting the expression of the CX3CR1 gene and / or at least one targeting gene encoding a protein or peptide with a targeting function, wherein the targeting gene is inserted into a gene sequence encoding the lamp2b protein, and the gene circuit is a sequence capable of being enriched in host organ tissues and self-assembled to form a composite structure, and the gene circuit achieves the treatment of depression by inhibiting the expression of genes through the siRNA.

[0059] The proteins or peptides with targeting function include RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; preferably, RVG targeting peptide.

[0060] The gene circuit also includes a promoter; the types of gene circuits include: promoter-siRNA, promoter-targeting gene and / or promoter-targeting gene-siRNA; the promoter is preferably the liver-specific promoter TBG.

[0061] The organ tissue is the liver, and the complex structure is the exosome.

[0062] The present invention also provides a nucleic acid delivery system, which comprises the above gene circuit and a delivery vector capable of delivering the gene circuit to the organ tissue of the host for enrichment.

[0063] The delivery vector containing the above gene circuit can be enriched in the host's organ tissue and self-assembled in the host's organ tissue to form a composite structure. The targeting tag is located on the surface of the composite structure. The composite structure searches for and binds to the target tissue through the targeting tag to deliver the RNA fragment into the target tissue.

[0064] The delivery vector is a viral vector or a non-viral vector, wherein the viral vector includes adeno-associated viral vector, adenoviral vector, retroviral vector, preferably adeno-associated viral vector AAV; the non-viral vector includes plasmid vector, liposome vector, cationic polymer vector, nanoparticle vector, multifunctional envelope nanocarrier, preferably LNP liposome nanoparticle.

[0065] The nucleic acid delivery system is a delivery system for use in mammals, including humans.

[0066] The present invention also provides the use of the above-mentioned nucleic acid delivery system in the preparation of a drug for treating depression. The drug administration methods include oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection; preferably intramuscular injection.

[0067] Example 2

[0068] 1. Modeling:

[0069] 1. CUMS modeling:

[0070] 8-week-old C57 BL / 6J male mice were subjected to chronic unpredictable stress modeling for 6 weeks, with 1-3 stimulations per day, including noise, strobe light, cage tilt, restraint, wet cage, and day and night reversal. Behavioral tests were performed after the modeling (García-Gutiérrez MS, Pérez-Ortiz JM, Gutiérrez-Adán A, Manzanares J. Depression-resistant endophenotype in mice overexpressing cannabinoid CB(2) receptors. BrJ Pharmacol. 2010.).

[0071] Table 1 shows the detailed modeling process.

[0072] Table 1

[0073]

[0074] 2. LPS modeling:

[0075] Eight-week-old C57 BL / 6J male mice were intraperitoneally injected with 0.5 mg / kg LPS and saline for seven consecutive days, and behavioral tests were performed after the model was established (Cui Y, Yang Y, Ni Z, Dong Y, Cai G, Foncelle A, Ma S, Sang K, Tang S, Li Y, Shen Y, Berry H, Wu S, Hu H. Astroglial Kir4.1 in the lateral habenula drives neuronal bursts in depression. Nature. 2018.).

[0076] 3. Behavioral testing methods:

[0077] 1) Open field experiment: The experimental device consists of an open field reaction box and an automatic data acquisition and processing system. The mouse open field reaction box is 25-30cm high, 72cm long at the bottom, with the inner wall painted black, and the bottom is evenly divided into 64 small squares. A digital camera is set up 2m above, and its field of view can cover the entire open field. The experiment is carried out in a quiet environment. Place the animal in the center of the bottom of the box, and take pictures and time it for 10 minutes. Clean the inner wall and bottom of the box to prevent the remaining information of the animal from the last time (such as the animal's urine, feces, and odor) from affecting the results of the next test. Replace the animal and continue the experiment.

[0078] 2) Tail suspension test: Use a small clip to clamp the mouse's tail 1 cm away, suspend it for 5 minutes, and detect its struggling and immobility time.

[0079] 3) Forced swimming: The mice were taught to swim in 25°C water for 15 min in advance. During the test, the mice were placed in 25°C warm water and recorded with a behavioral instrument for 5 min, recording their swimming, floating, and struggling time.

[0080] 4) Inhibition of eating in a new environment: The mice were fasted for 24 hours. During the test, the mice were placed from the corner into the open field, allowed to adapt to the environment for 1 minute, then taken out and a sugar pill / mouse chow was placed in the center of the open field. The instrument recorded the time taken by the mice from the time they were placed in the open field to the time they ate within five minutes.

[0081] 2. Design and screening of siRNA sequences and verification of mRNA knockdown effects:

[0082] First, drug design ( Figure 1 ), and further screened out two siRNA sequences with significant effects ( Figure 2 ), verifying that it also has a knockdown effect on mRNA ( Figure 3 ), and then loaded it into the independently designed and developed loop-based or AA8 vector with liver-specific promoter TBG, and the RVG-lamp2b structure was used to enable it to be enriched in the liver and targeted for brain disease treatment through exosomes secreted by the liver.

[0083] 1. Real-time quantitative QT-PCR analysis method:

[0084] Total RNA was purified using TRIzol (Invitrogen, 15596018) according to the manufacturer’s instructions and then III RT SuperMix for qPCR (+gDNA wiper) (Novizen, R323-01) was used to reverse transcribe mRNA. Briefly, 1 μg of total RNA was used to remove genomic DNA using 4×gDNA wiper under the following conditions: 42°C for 2 minutes; III qRT SuperMix was reverse transcribed into cDNA under the following conditions: 50°C for 15 min and 85°C for 5 min. Next, the RT products were amplified using ChamQ Universal SYBR qPCR Master Mix (NoviZan, Q711-02) and primers specific for CX3CR1, IL-6, IL-1β, TNFα, and GAPDH.

[0085] CX3CR1-specific primers:

[0086] Forward (SEQ ID No. 5): 5′-CTTCCCATCTGCTCAGGACC-3′;

[0087] Reverse (SEQ ID No. 6): 5′-ACCAGACCGAACGTGAAGAC-3′;

[0088] IL-6:

[0089] Forward (SEQ ID No. 7): 5′-TGTGCAATGGCAATTCTGAT-3′;

[0090] Reverse (SEQ ID No. 8): 5'-GGTACTCCAGAAGACCAGAGGA-3';

[0091] IL-1β:

[0092] Forward (SEQ ID No. 9): 5′-CCTGCAGCTGGAGAGTGTGGAT-3′;

[0093] Reverse (SEQ ID No. 10): 5′-TGTGCTCTGCTTGTGAGGTGCT-3′;

[0094] TNFα:

[0095] Forward (SEQ ID No. 11): 5′-AGCCCACGTCGTAGCAAACCAC-3′;

[0096] Reverse (SEQ ID No. 12): 5'-AGGTACAACCCATCGGCTGGCA-3';

[0097] GAPDH:

[0098] Forward (SEQ ID No. 13): 5′-TTGGCAGCACCAGTGGATGCAGGGA-3′;

[0099] Reverse (SEQ ID No. 14): 5'-AACTTTGGCATTGTGGAAGGGCTCA-3'.

[0100] The reaction was incubated at 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min. After the reaction was completed, the CT value was determined, and the relative level of mRNA was normalized to GAPDH and calculated by the 2-ΔΔCT method.

[0101] 2. Western blotting:

[0102] The cells were rinsed with PBS (pH 7.4) and then lysed on ice for 30 minutes in RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with a mixture of protease and phosphatase inhibitors (Thermo Scientific, Rockford, IL). Tissue samples were frozen solid in liquid nitrogen, ground into powder, and lysed on ice for 30 minutes in RIPA lysis buffer containing a mixture of protease and phosphatase inhibitors. When necessary, samples were sonicated in an ice bath. Cell lysates and tissue homogenates were centrifuged at 4°C for 10 min (12,000×g). The supernatant was collected and the protein concentration was determined using the Pierce BCA protein assay kit (ThermoScientific, 23225, CA, USA). Subsequently, the protein lysate (20 μg) was added to an acrylamide gel, the proteins were separated by electrophoresis under denaturing conditions, and transferred to a PVDF membrane. Total protein was stained with Ponceau (Solarbio, P0012, Beijing, China) to ensure uniform loading. The membrane was blocked for 1 hour at room temperature with 5% skim dry milk (TBS) containing 0.1% Tween-20 (for phosphorylated proteins, the membrane was blocked for 1 hour with 5% bovine serum albumin in TBS containing 0.1% Tween-20) and incubated with the primary antibody overnight at 4°C. Washed 3 times with 1x TBST, 20 min each time. Incubated with the secondary antibody at room temperature for 1 hour, and then washed 3 times with 1x TBST, 10 min each time. The membrane was incubated with ECL substrate (ThermoFisher, 46640, CA, USA) according to the manufacturer's instructions and detected with auto Article 643. The antibodies used for analyzing protein bands with ImageJ are as follows: anti-CX3CR1 (invitrogen, 1H14L7, 1:2000), anti-GAPDH (proteintech, 10494-1-AP, 1:10000).

[0103] 3. Verification of the effect of siRNA in inhibiting CX3CR1 overexpression in CUMS model mice:

[0104] The therapeutic effect was explored in the CUMS model, and it was found that the gene circuit showed milder depressive-like behavior after treatment, and had the same good efficacy as the positive drug (2R, 6R)-HNK ( Figure 4 ), and can significantly inhibit the overexpression of CX3CR1 and the excessive increase of inflammatory factors ( Figure 5 ).

[0105] 1. Real-time quantitative QT-PCR analysis method:

[0106] Total RNA was purified using TRIzol (Invitrogen, 15596018) according to the manufacturer’s instructions and then III RT SuperMix for qPCR (+gDNA wiper) (Novizen, R323-01) was used to reverse transcribe mRNA. Briefly, 1 μg of total RNA was used to remove genomic DNA using 4×gDNA wiper under the following conditions: 42°C for 2 minutes; III qRT SuperMix was reverse transcribed into cDNA under the following conditions: 50°C for 15 min and 85°C for 5 min. Next, the RT products were amplified using ChamQ Universal SYBR qPCR Master Mix (NoviZan, Q711-02) and primers specific for CX3CR1, IL-6, IL-1β, TNFα, and GAPDH.

[0107] CX3CR1-specific primers:

[0108] Forward: 5′-CTTCCCATCTGCTCAGGACC-3′;

[0109] Reverse: 5′-ACCAGACCGAACGTGAAGAC-3′;

[0110] IL-6:

[0111] Forward: 5′-TGTGCAATGGCAATTCTGAT-3′;

[0112] reverse: 5′-GGTACTCCAGAAGACCAGAGGA-3′;

[0113] IL-1β:

[0114] Forward: 5′-CCTGCAGCTGGAGAGTGTGGAT-3′;

[0115] Reverse: 5′-TGTGCTCTGCTTGTGAGGTGCT-3′;

[0116] TNFα:

[0117] Forward: 5′-AGCCCACGTCGTAGCAAACCAC-3′;

[0118] reverse: 5′-AGGTACAACCCATCGGCTGGCA-3′);

[0119] GAPDH:

[0120] Forward: 5′-TTGGCAGCACCAGTGGATGCAGGGA-3′;

[0121] Reverse: 5′-AACTTTGGCATTGTGGAAGGGCTCA-3′.

[0122] The reaction was incubated at 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min. After the reaction was completed, the CT value was determined, and the relative level of mRNA was normalized to GAPDH and calculated by the 2-ΔΔCT method.

[0123] 2. Immunofluorescence staining:

[0124] Mice were deeply anesthetized with sodium pentobarbital (50 mg / kg, intraperitoneal injection), perfused with 1× PBS and then cryopreserved with 4% PFA. The brain was fixed in 4% PFA overnight, dehydrated with 15% and 30% sucrose in 1× PBS at 4°C, and then frozen and sectioned. For immunofluorescence analysis, the sections were washed with 1× PBS and then blocked with 10% normal horse serum and 0.25% Triton X-100 in PBS (1 hour). Then, the sections were incubated overnight with primary antibodies diluted in blocking solution for CD68 (Bio-mad, MCA1957, 1:500) and Iba1 (Wako, 019-19714, 1:1000) as well as psd95 (Millipore, MAB1596, 1:500) and Synaptic I (Millipore, AB1543, 1:1000). On the second day, the sections were washed 6 times with 1x PBS for 5 min each time, and incubated in a blocking solution containing a secondary antibody for 1 hour. The sections were then washed 6 times with 1x PBS for 5 min each time, and mounted in an antifade containing DAPI (Biyuntian, P0131-25ml).

[0125] Figure 6 The figures show the results of syn / psd95 immunofluorescence and cd68 / iba1 immunofluorescence detection of the CUMS model. The cd68 / iba1 CD68 / IBA1 immunofluorescence detection graphs show that in the CUMS model, there is a significant abnormal increase in microglia activation, which can cause excessive pruning of neuronal synapses and lead to synaptic damage. Syn / psd95 immunofluorescence detection shows that the number of pre- and post-synapses of neurons in the CUMS model is significantly reduced, and siRNA treatment can significantly inhibit the above phenomenon.

[0126] 4. Verification of the therapeutic effect of gene circuits on depression in the LPS model:

[0127] The therapeutic effect was explored based on the LPS model. In the LPS model, 8-week-old C57 BL / 6J male mice were intraperitoneally injected with 0.5 mg / kg LPS and saline for seven consecutive days. On the seventh day, 10 mg / kg of the gene circuit and the positive drug (2R, 6R)-HNK were injected at the same time. Behavioral and molecular tests were performed 12 hours after the injection. The results showed that the gene circuit showed milder depressive-like behavior after treatment, and its efficacy was significantly better than that of the positive drug (2R, 6R)-HNK ( Figure 7 ).

[0128] 5. Verification of the effect of siRNA-loaded viral vector on depression resistance in the CUMS model:

[0129] The CUMS model was treated with AAV8-TBG adeno-associated virus loaded with siRNA. 8-week-old mice were injected with 100 μl of 10 12 After AAV8 virus was injected into the CUMS depression model for 6 weeks ( Figure 8 ), behavioral tests were performed 6 weeks later and found that injection of AAV8-TBG-siR 1+2 May show resistance to depression ( Fig. 9 ), and can effectively inhibit CX3CR1 overexpression and the increase of inflammatory factor levels ( Fig.10 , Fig.11 ).

[0130] 1. Real-time quantitative QT-PCR analysis method:

[0131] Total RNA was purified using TRIzol (Invitrogen, 15596018) according to the manufacturer’s instructions and then III RT SuperMix for qPCR (+gDNA wiper) (Novizen, R323-01) was used to reverse transcribe mRNA. Briefly, 1 μg of total RNA was used to remove genomic DNA using 4×gDNA wiper under the following conditions: 42°C for 2 minutes; III qRT SuperMix was reverse transcribed into cDNA under the following conditions: 50°C for 15 min and 85°C for 5 min. Next, the RT products were amplified using ChamQ Universal SYBR qPCR Master Mix (NoviZan, Q711-02) and primers specific for CX3CR1, IL-6, IL-1β, TNFα, and GAPDH.

[0132] CX3CR1-specific primers:

[0133] Forward: 5′-CTTCCCATCTGCTCAGGACC-3′;

[0134] Reverse: 5′-ACCAGACCGAACGTGAAGAC-3′;

[0135] IL-6:

[0136] Forward: 5′-TGTGCAATGGCAATTCTGAT-3′;

[0137] reverse: 5′-GGTACTCCAGAAGACCAGAGGA-3′;

[0138] IL-1β:

[0139] Forward: 5′-CCTGCAGCTGGAGAGTGTGGAT-3′;

[0140] Reverse: 5′-TGTGCTCTGCTTGTGAGGTGCT-3′;

[0141] TNFα:

[0142] Forward: 5′-AGCCCACGTCGTAGCAAACCAC-3′;

[0143] reverse: 5′-AGGTACAACCCATCGGCTGGCA-3′;

[0144] GAPDH:

[0145] Forward: 5′-TTGGCAGCACCAGTGGATGCAGGGA-3′;

[0146] Reverse: 5′-AACTTTGGCATTGTGGAAGGGCTCA-3′.

[0147] The reaction was incubated at 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min. After the reaction was completed, the CT value was determined, and the relative level of mRNA was normalized to GAPDH and calculated by the 2-ΔΔCT method.

[0148] 2. Western blotting:

[0149] The cells were rinsed with PBS (pH 7.4) and then lysed on ice for 30 minutes in RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with a mixture of protease and phosphatase inhibitors (Thermo Scientific, Rockford, IL). Tissue samples were frozen solid in liquid nitrogen, ground into powder, and lysed on ice for 30 minutes in RIPA lysis buffer containing a mixture of protease and phosphatase inhibitors. When necessary, samples were sonicated in an ice bath. Cell lysates and tissue homogenates were centrifuged at 4°C for 10 min (12,000×g). The supernatant was collected and the protein concentration was determined using the Pierce BCA protein assay kit (ThermoScientific, 23225, CA, USA). Subsequently, the protein lysate (20 μg) was added to an acrylamide gel, the proteins were separated by electrophoresis under denaturing conditions, and transferred to a PVDF membrane. Total protein was stained with Ponceau (Solarbio, P0012, Beijing, China) to ensure uniform loading. The membrane was blocked for 1 hour at room temperature with 5% skim dry milk (TBS) containing 0.1% Tween-20 (for phosphorylated proteins, the membrane was blocked for 1 hour with 5% bovine serum albumin in TBS containing 0.1% Tween-20) and incubated with the primary antibody overnight at 4°C. Washed 3 times with 1x TBST, 20 min each time. Incubated with the secondary antibody at room temperature for 1 hour, and then washed 3 times with 1x TBST, 10 min each time. The membrane was incubated with ECL substrate (ThermoFisher, 46640, CA, USA) according to the manufacturer's instructions and detected with auto Article 643. The antibodies used for analyzing protein bands with ImageJ are as follows: anti-CX3CR1 (invitrogen, 1H14L7, 1:2000), anti-GAPDH (proteintech, 10494-1-AP, 1:10000).

[0150] VI. Verification of the effect of LNP carrier loaded with siRNA on improving depression in the CUMS model:

[0151] The RVG-lamp2b-siRNA structure was encapsulated by LNP liposome nanoparticles and injected intramuscularly into CUMS depression model mice. 1+2 structure, and can also significantly improve behavioral indicators of depression ( Fig.12 ).

[0152] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of a CX3CR1 gene inhibitor in the preparation of a drug for treating depression, characterized in that: The CX3CR1 gene inhibitor includes at least one of the following two siRNAs: siRNA-1, whose sense strand is shown in sequence SEQ ID No.1, and whose antisense strand is shown in sequence SEQ ID No.2; siRNA-2, whose sense strand is shown in sequence SEQ ID No.3, and whose antisense strand is shown in sequence SEQ ID No.

4.

2. A gene circuit for preparing a drug for treating depression, characterized in that: The gene circuit comprises at least one of the two siRNAs according to claim 1 that can inhibit the expression of the CX3CR1 gene and / or at least one targeting gene encoding a protein or peptide with a targeting function, the targeting gene is inserted into the gene sequence encoding the lamp2b protein, the gene circuit is a sequence that can be enriched in the host organ tissue and self-assembled to form a composite structure, and the gene circuit achieves the treatment of depression by inhibiting the expression of the gene through the siRNA.

3. The gene circuit according to claim 2, characterized in that: The proteins or peptides with targeting function include RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; preferably, RVG targeting peptide.

4. The gene circuit according to claim 3, characterized in that: The gene circuit further includes a promoter; the types of the gene circuit include: promoter-siRNA, promoter-targeting gene and / or promoter-targeting gene-siRNA; the promoter is preferably the liver-specific promoter TBG.

5. The gene circuit according to claim 4, characterized in that: The organ tissue is the liver, and the composite structure is exosomes.

6. A nucleic acid delivery system, characterized in that The delivery system comprises the gene circuit according to any one of claims 2 to 5 and a delivery vector capable of delivering the gene circuit to a host organ tissue for enrichment.

7. The nucleic acid delivery system according to claim 6, characterized in that The delivery vector containing the gene circuit can be enriched in the organ tissue of the host and self-assembled in the organ tissue of the host to form a composite structure. The targeting tag is located on the surface of the composite structure. The composite structure searches for and binds to the target tissue through the targeting tag to deliver the RNA fragment into the target tissue.

8. The nucleic acid delivery system according to claim 7, characterized in that The delivery vector is a viral vector or a non-viral vector, wherein the viral vector includes an adeno-associated viral vector, an adenoviral vector, a retroviral vector, preferably an adeno-associated viral vector; the non-viral vector includes a plasmid vector, a liposome vector, a cationic polymer vector, a nanoparticle vector, a multifunctional envelope nanocarrier, preferably an LNP liposome nanoparticle.

9. Use of the nucleic acid delivery system according to any one of claims 6 to 8 in the preparation of a drug for treating depression, characterized in that: The administration methods of the drug include oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

10. The use according to claim 9, characterized in that: The medicine for treating depression also includes pharmaceutically acceptable carriers and pharmaceutical excipients.

Images