Preparation method of chicken IL-17A recombinant protein and application of chicken IL-17A recombinant protein in activation of cell inflammatory response

Abstract

The invention relates to the field of biological medicine, in particular to a preparation method of chicken IL-17A recombinant protein and application of the chicken IL-17A recombinant protein in activation of cell inflammatory response. The recombinant protein IL-17A is obtained by constructing recombinant plasmids, transforming the vector into Escherichia coli BL21 competent cells by a heat stress method, carrying out induced expression by utilizing IPTG (isopropyl-beta-d-thiogalactoside), washing, dissolving, denaturating and renaturating an inclusion body, and purifying. The recombinant IL-17A protein prepared by the invention can stimulate chicken bone source mononuclear cells to cause up-regulation of inflammatory factors IL-1beta, IL-6 and TNF-alpha. The purified recombinant protein IL-17A has biological activity and can be used as an immunopotentiator to provide immune protection for poultry.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a method for preparing a chicken IL-17A recombinant protein and an application thereof in activating a cell inflammatory response. Background Art

[0002] The IL-17 family consists of six similar cytokine members, named IL-17A (or IL-17), IL-17B, IL-17C, IL-17D, IL-17E, and IL-17F. IL-17A is a disulfide-linked homodimeric glycoprotein composed of 155 amino acids, and functions as a homodimer with a molecular weight of approximately 35 kDa. IL-17A is the most extensively studied cytokine in this family. As a proinflammatory cytokine, it plays an important role in the defense against microbial infections and is associated with various inflammatory diseases such as autoimmune diseases, metabolic disorders, and cancer.

[0003] IL-17A is produced by cells of the innate and adaptive immune systems. Th17 cells are considered the main source of IL-17A. Th17 cells are mainly located in barrier tissues and have the characteristics of effector memory T cells. + IL-17A expression can also be detected in T cells (Tc17), which can participate in host defense against viruses and contribute to autoimmunity. IL-17A can also be produced by other cell types, the most prominent of which is the innate immune cell population, which mediates the rapid release of IL-17A in response to pathogens or tissue damage.

[0004] IL-17A is a major contributor to host defense against bacterial and fungal pathogens and exerts its effects through neutrophil recruitment, antimicrobial molecules, and acute phase protein production. IL-17A represents an essential cytokine in host defense, particularly at the mucosal barrier against extracellular bacteria or fungi. Studies have demonstrated that intrapulmonary Klebsiella pneumoniae infection leads to increased mortality in mice in the viral infection model IL-17RA knockout mice. IL-17A overexpression modulates Th1 / Th2 responses, leading to an increase in vaccinia virus virulence in infected mice. Interleukin 17A (IL-17A) is a "double-edged sword" and in addition to its key role in influencing protective host immune responses, IL-17A is also implicated in promoting viral infection. Although IL-17A itself is a proinflammatory cytokine, it contributes to immune homeostasis, thereby leading to dysregulation and overproduction of other proinflammatory cytokines in the absence of its signaling.

[0005] Five homologous IL-17 cytokines, gg IL-17A, B, C, D, and F, have been described in the chicken genome. The sequence of gg IL-17A was isolated as a 917 bp cDNA from an EST cDNA library of chickens infected with Eimeria (GenBank accession number AJ 493595). The clone contains a 63-nucleotide (nt) 5'-UTR, a 507-nt open reading frame (ORF), and a 347-nt 3'-UTR. Comparison of the amino acid sequences showed that the avian IL-17A members are highly homologous to each other, with ChIL-17 sharing 46% identity with HuIL-17 and 37% identity with mouse IL-17 (MuIL-17). So far, most studies on IL-17A have focused on non-avian hosts, and little is known about the immune protective function of chicken IL-17A against avian viruses. Summary of the invention

[0006] Based on this, the present invention provides a method for preparing chicken IL-17A recombinant protein and its application in activating cellular inflammatory response.

[0007] A method for preparing chicken IL-17A recombinant protein comprises the following steps:

[0008] The coding sequence of chicken IL-17A was inserted into the expression plasmid to obtain a recombinant plasmid; the recombinant plasmid was transformed into BL21 competent cells for culture, and then the bacterial solution was inoculated in LB Kan+ When the OD value of the bacterial solution reaches 0.5-0.8, add 1mmol·L -1 Isopropyl β-D-thiogalactoside was cultured at 37°C with shaking for 16 h, and the upper culture medium was discarded by centrifugation and the cells were recovered;

[0009] The bacterial cells are lysed to obtain inclusion bodies, then the inclusion bodies are washed and dissolved, and then Ni column affinity purification is performed to obtain a target protein solution;

[0010] The target protein solution is dialyzed, renatured and concentrated, and then endotoxin is removed to obtain the chicken IL-17A recombinant protein.

[0011] In one embodiment, the lysis specifically includes the following steps: resuspending the bacteria at a ratio of 1 g of bacteria to 9 mL of TBS buffer, adding Tiehui E.coli Lysis Buffer to 1 / 9 of the volume of the bacterial resuspension and mixing evenly, lysing at 4°C for 10 minutes, centrifuging at 8000 rpm for 5 minutes, and collecting the precipitate to obtain inclusion bodies.

[0012] In one embodiment, the inclusion body washing specifically comprises the following steps: dissolving 10 mg of inclusion bodies in 5 mL of inclusion body washing solution, centrifuging at 12000 rpm at 4°C for 20 min, discarding the supernatant, repeating the process multiple times, and collecting the precipitate.

[0013] In one embodiment, the dissolving of inclusion bodies specifically comprises the following steps: mixing the inclusion bodies with the inclusion body dissolving solution, placing at room temperature for 30 minutes, centrifuging at 4°C and 12000 rpm for 10 minutes, collecting the supernatant, and filtering with a 0.22 μm filter membrane.

[0014] In one embodiment, the Ni column affinity purification specifically includes the following steps: take a 1 mL Ni-NTA pre-packed column, mix the inclusion body solution with Binding / Wash Buffer in a ratio of 1:1 to prepare a sample solution, so that the total volume of the sample solution is twice the column volume; add the sample solution to the column, and then wash the column with Binding / Wash Buffer; elute the target protein with Ni-NTA Elution-Buffer containing 100 mmol / L imidazole at a flow rate of 1 mL / min, and collect the effluent.

[0015] In one embodiment, the dialysis renaturation specifically includes the following steps: placing the target protein solution into a dialysis bag, placing it in renaturation buffers with different concentrations of urea in sequence, dialyzing at 4° for 6 hours, and finally placing the dialysis bag in PBS for dialyzing overnight.

[0016] In one embodiment, the concentration specifically includes the following steps: wipe the dialysis bag dry, completely cover the dialysis bag with PEG-8000, and replace it with dry PEG-8000 every 3 to 4 hours until the volume of the target protein solution is 200 to 300 μL.

[0017] In one embodiment, the removal of endotoxin specifically includes the following steps: taking the dialyzed and concentrated target protein solution, adding Endotoxin Removal Solution A and mixing, then adding Endotoxin Removal Solution B and mixing, then adding Separation Indicator and mixing, incubating at 4°C or on ice for 5 minutes, incubating at 37°C for 1 minute, centrifuging at 12000-14000g at 25°C or room temperature for 5 minutes to separate the two phases, and collecting the upper aqueous phase.

[0018] The present invention also provides the use of the chicken IL-17A recombinant protein prepared by the above preparation method in preparing a product for activating cellular inflammatory response.

[0019] In one embodiment, the product is an immunopotentiator, and the activation of cellular inflammatory response includes increasing the expression levels of IL-1β, IL-6 and TNF-β.

[0020] The beneficial effects of the present invention are:

[0021] The present invention constructs a recombinant plasmid pET-28a(+)-IL-17A, transforms the vector into Escherichia coli BL21 competent cells by heat stress method, uses IPTG to induce expression, washes, dissolves, denatures, and renatures the inclusion bodies, and then purifies the recombinant protein IL-17A protein by the characteristics of His tag binding to nickel ions. The recombinant IL-17A protein prepared by the present invention can stimulate chicken bone-derived mononuclear cells, leading to the upregulation of inflammatory factors IL-1β, IL-6, and TNF-α. The recombinant protein IL-17A purified by the present invention has biological activity and can be used as an immunopotentiator to provide immune protection for poultry. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 For the hydrophobicity analysis of chicken IL-17A protein;

[0023] Figure 2 For chicken IL-17A protein signal peptide analysis;

[0024] Figure 3 Prediction of transmembrane region of chicken IL-17A protein;

[0025] Figure 4 The secondary structure prediction of chicken IL-17A protein, A is the analysis result of PSIPRED online software, B is the analysis result of SignaIP 6.0 online software;

[0026] Figure 5 For the tertiary structure analysis of chicken IL-17A;

[0027] Figure 6 For chicken IL-17A phosphorylation site analysis;

[0028] Figure 7 For the analysis of glycosylation sites of chicken IL-17A protein;

[0029] Figure 8 For the double restriction enzyme digestion identification of recombinant plasmid pET28a-IL-17A, M: DNA molecular mass standard; 1: recombinant plasmid pET28a-IL-17A; 2: double restriction enzyme digestion product of recombinant plasmid pET28a-IL-17A;

[0030] Fig. 9 Schematic diagram of the recombinant plasmid pET28a-IL-17A;

[0031] Fig.10For SDS-PAGE detection of recombinant protein IL-17A, M: protein standard; 1-3 are: non-induced bacteria, non-induced supernatant, non-induced inclusion body; 4-6 are: induced bacteria, induced supernatant, induced inclusion body;

[0032] Fig.11 Western blot identification of recombinant protein IL-17A, M: protein standard; 1-3: non-induced bacteria, non-induced supernatant, non-induced inclusion body; 4-6: induced bacteria, induced supernatant, induced inclusion body;

[0033] Fig.12 This is the SDS-PAGE analysis of the products induced by different concentrations of IPTG at 37℃ for 16h. M: protein molecular weight standard; 1-3 are: non-induced bacteria, non-induced supernatant, non-induced inclusion body; 4-6 are: 0.5mmol·L -1 Bacteria, supernatant, inclusion bodies under IPTG induction; 7 to 9 are: 1mmol·L -1 Bacteria, supernatant, inclusion bodies under IPTG induction; 10-12 are: 1.5mmol·L -1 Bacteria, supernatant, inclusion bodies under IPTG induction; 13-15 are: 2mmol·L -1 Bacteria, supernatants, and inclusion bodies induced by IPTG;

[0034] Fig.13 Gray value analysis of SDS-PAGE detection images of expression induced by different concentrations of IPTG, where A is the bacterial cells, B is the supernatant, and C is the inclusion body;

[0035] Fig.14 This is the SDS-PAGE analysis of the products induced for 16 hours under different temperature conditions, M: protein molecular weight standard; 1-4 are: induced bacteria at 16℃, 20℃, 27℃, 37℃; 5-8 are: supernatants at 16℃, 20℃, 27℃, 37℃; 9-12 are: inclusion bodies at 16℃, 20℃, 27℃, 37℃;

[0036] Fig.15 Figure 1 is the SDS-PAGE analysis of the expression products induced by IPTG at different times. M: protein standard; 1-4 are the cells induced for 4h, 8h, 12h, and 16h, respectively; 5-8 are the supernatants induced for 4h, 8h, 12h, and 16h, respectively; 9-12 are the inclusion bodies induced for 4h, 8h, 12h, and 16h, respectively;

[0037] Fig.16This is the SDS-PAGE analysis of the purified recombinant protein IL-17A, M: protein standard; 1: protein before loading; 2: flow-through; 3: 50mmol / L imidazole elution; 4: 100mmol / L imidazole elution; 5: 150mmol / L imidazole elution; 6: 250mmol / L imidazole elution; 7: 500mmol / L imidazole elution;

[0038] Fig.17 This is the SDS-PAGE analysis of the recombinant protein IL-17A after dialysis and concentration. M: protein standard; 1: protein after dialysis and concentration with 100mmol / L imidazole eluent;

[0039] Fig.18 Endotoxin assay for recombinant protein IL-17A;

[0040] Fig.19 Relative expression levels of IL-1 (A), IL-6 (B), and TNF (C) in cells after treatment with recombinant protein IL-17A. DETAILED DESCRIPTION

[0041] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0042] Therefore, it is intended that the present invention covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are obvious from the following detailed description. Those of ordinary skill in the art will appreciate that this discussion is only a description of exemplary embodiments and is not intended to limit the broader aspects of the present invention.

[0043] The present invention is further described below in conjunction with specific examples, but the examples do not limit the present invention in any form. For those skilled in the art, any other changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principle of the present invention should all be equivalent replacement methods and are included in the protection scope of the present invention.

[0044] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0045] 1 Materials and methods

[0046] 1.1 Materials

[0047] 1.1.1 Gene sequence

[0048] The amino acid and nucleotide sequences of chicken IL-17A protein were obtained from the official website of NCBI (https: / / www.ncbi.nlm.nih.gov / ), and the FASTA files were downloaded for subsequent analysis.

[0049] 1.1.2 Genes, cells, and vectors

[0050] The optimized gene sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd.; Escherichia coli DH 5α strain and BL21 CodonPlus (DE3)-RIPL expression strain were purchased from Beijing Qingke Biotechnology Co., Ltd.; the prokaryotic expression vector pET-28a (+) and chicken macrophages (HD11) were preserved in this laboratory.

[0051] 1.1.3 Main reagents and materials

[0052] Protein standards, restriction endonucleases Xba I and Xho I were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; nickel ion affinity chromatography columns were purchased from Sangon Biotech (Shanghai) Co., Ltd.; gel recovery kits were purchased from Beijing Qingke Biotechnology Co., Ltd.; HRP-goat anti-rabbit IgG, BCA protein quantification kits, and protein endotoxin removal kits were purchased from Shanghai Biotech Co., Ltd.; endotoxin detection kits were purchased from GenScript Biotech Co., Ltd.; inclusion body protein solubilization and refolding buffer were purchased from Beijing Coolbo Technology Co., Ltd.; TieChui E.coli Lysis Buffer was purchased from Changzhou Boyi Biotechnology Co., Ltd.; chicken bone marrow mononuclear cell separation buffer kit was purchased from Tianjin Haoyang Biological Products Technology Co., Ltd.; PAGE gel preparation kit 12.5% ​​was purchased from Affinity (Wuhan) Life Science Co., Ltd.; 6×His-tag was purchased from Abcam (Shanghai) Trading Co., Ltd.

[0053] 1.2 Methods

[0054] 1.2.1 Analysis of the structure of chicken IL-17A protein

[0055] The physicochemical properties and signal peptide of M protein were analyzed using PortParam online software (https: / / web.expasy.org / cgi-bin / protparam / protparam), SnapGene4.3.6 software and SignalP 6.0-DTU Health Tech-BioinformaticServices online software. The hydrophobic structure of chicken IL-17A protein was analyzed using Expasy online tool ProtScale (https: / / web.expasy.org / protscale / ). The transmembrane domain of protein was predicted using TMHMM 2.0-DTUHealth Tech-Bioinformatic Services online software. The secondary structure of chicken IL-17A protein was predicted using PSIPRED online software. The position of disulfide bonds of protein was analyzed using Cyscon online software (http: / / www.csbio.sjtu.edu.cn). The AlphaFold protein structure database was used to predict the tertiary structure of chicken IL-17A protein. NetPhos3.1 and NetNGlyc 1.0Server online software were used to predict the phosphorylation sites and glycosylation sites of chicken IL-17A protein.

[0056] 1.2.2 Construction of recombinant plasmid pET-28a(+)-IL-17A

[0057] According to the CDS region of the chicken IL-17A gene sequence (GenBank accession number: AM773756.1), codon optimization was performed and a 6×His tag was added. The optimized sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. The pET28a(+) vector was linearized by double digestion with XhoⅠ and XbaⅠ. The recombinant plasmid pET-28a-IL-17A was constructed by homologous recombination. The IL-17A primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Table 1). The recombination reaction system (Table 2) was prepared on ice, placed in a PCR instrument, and reacted at 50℃ for 20min. After the reaction was completed, the reaction tube was placed on ice for 5min. The recombinant product was transformed into DH 5α. 900μL LB medium was added and shaken at 37℃ for 1h to restore the normal growth state of the cells. 100μL of bacterial solution was spread on the selection plate containing Kana antibiotics. After the bacterial solution was completely absorbed by the culture medium, the plate was inverted and cultured overnight at 37℃. Pick a single clone to extract the plasmid and sequence it. Perform double enzyme digestion verification with XhoⅠ and XbaⅠ at the same time, and prepare the enzyme digestion system reaction solution on ice (Table 3). Tap the tube wall to mix, then centrifuge it instantly to collect the droplets on the wall. Incubate at 37℃ for 15min, and incubate at 80℃ for 20min to inactivate the enzyme and stop the reaction.

[0058] Table 1 Primers used in IL-17A gene homologous recombination expression vector

[0059]

[0060]

[0061] The underlined part represents the homologous sequence at the end of the pET-28a(+) vector, the italic part CTCGAG represents the XhoⅠ restriction site, and the italic part TCTAGA represents the XbaⅠ restriction site.

[0062] Table 2 Homologous recombination reaction system

[0063] Components Volume (μL) 2×Hieff Clone Enzyme Premix 10 Linearized vector 3 Insert 7

[0064] Table 3 Recombinant plasmid pET28a-IL-17A double restriction enzyme digestion reaction system

[0065] Components Volume (μL) <![CDATA[10×FuniCut TM Buffer]]> 2 <![CDATA[FuniCut TM XhoⅠ]]> 1 <![CDATA[FuniCut TM XbaⅠ]]> 0.2 Recombinant plasmid pET28a-IL-17A 2 <![CDATA[ddH2O]]> 14.8

[0066] 1.2.3 Inducible expression of recombinant plasmid pET28a-IL-17A and SDS-PAGE and Western blot detection

[0067] Transform the recombinant plasmid pET28a-IL-17A into BL21 competent cells, spread the transformed cells on a solid plate containing Kana antibiotics, and culture them in a constant temperature incubator at 37°C overnight. Select 3 to 4 monoclonal colonies from the plate, inoculate them into test tubes containing 1 mL of LB culture medium containing Kana antibiotics, and shake them at 37°C overnight. The next day, expand the culture to 5 mL of bacterial solution until the bacterial OD 600 is 0.5-0.8. Add isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 1mmol / L, and induce protein expression at 37℃ for 16h. No IPTG was added to the control group. Take 2.5mL of bacterial solution and centrifuge at 8000r / min at room temperature for 4min, discard the supernatant, and resuspend the bacterial pellet with PBS; take an equal amount of bacterial solution at 4000r / min, centrifuge for 10min, discard the supernatant, and resuspend the bacterial pellet with TBS; add PMSF with a final concentration of 1mmol / L to the resuspended solution, add lysozyme to ultrasonically disrupt the bacteria, and the ultrasonic disruption parameter is 50% power. Take the bacterial cells, supernatant, and inclusion body samples for SDS-PAGE electrophoresis, and use Coomassie Brilliant Blue to stain the bands.

[0068] Take the sample for SDS-PAGE electrophoresis. After the electrophoresis is completed, wet transfer at 250mA for 1h, and transfer the protein band to the PVDF membrane. Wash and shake with TBST buffer three times. After the rinse is completed, add freshly prepared 5% skim milk powder to block for 1h to prevent non-specific binding. Dilute the mouse His-Tag at a ratio of 1:5000 and use it as the primary antibody to incubate at 4°C overnight. Incubate with a 2000-fold diluted secondary antibody Goat-AntiMouse for 1 hour. Perform chemiluminescent imaging after ECL development.

[0069] 1.2.4 Optimization of expression conditions of recombinant protein IL-17A

[0070] Optimization experiment of the best inducer concentration: overnight shaking culture to expand the bacterial OD 600 At 37°C, different IPTG concentrations (0, 0.5, 1, 1.5, 2 mmol·L -1 IPTG), 220 r·min -1 After induction for 16 h, the cells were collected by centrifugation, lysozyme was added and ultrasonically disrupted, and the inclusion bodies were collected for SDS-PAGE electrophoresis.

[0071] Optimal induction temperature optimization experiment: The method is the same as above. When the bacterial solution OD 600 When the concentration is 0.5-0.8, add the final concentration of 1mmol·L -1 IPTG was induced at 16°C, 20°C, 25°C, and 37°C for 16 h, and protein samples were taken for SDS-PAGE electrophoresis.

[0072] Optimal induction time optimization experiment: The method is the same as above. When the bacterial solution OD 600 When the concentration is 0.5-0.8, add the final concentration of 1mmol·L -1 IPTG was induced at 37°C for 4 h, 8 h, 12 h, and 16 h, respectively. Protein samples were taken for SDS-PAGE electrophoresis.

[0073] 1.2.5 Large-scale expression and purification of recombinant protein IL-17A

[0074] 1) Bacteria collection: The correctly identified recombinant plasmid pET28a-IL-17A was transformed into BL21 competent cells and cultured in LB Kana+ The culture was shaken at 37°C and 220 r / min overnight. The next day, the bacterial solution was inoculated into 500 mL LB at a ratio of 1:100. Kana+When the OD value of the bacterial solution reached 0.5-0.8, 1 mmol / L isopropyl β-D-thiogalactoside (IPTG) was added, and the culture was shaken at 220 r / min for 16 h. The culture was centrifuged at 8 000 r / min for 10 min, and the upper culture medium was discarded and the bacteria were recovered, and about 2.0 g of wet bacteria were collected.

[0075] 2) Lysis of bacteria: Resuspend the bacteria at a ratio of 1g wet bacteria to 9mL TBS buffer to ensure adequate dispersion. Add Tiechui E.coli Lysis Buffer to 1 / 9 of the volume of the resuspended bacteria, and stir or oscillate to mix evenly. Place the sample at 4°C and lyse for 10 minutes. It can be observed that the bacterial suspension gradually becomes clear and transparent. Centrifuge the sample at 8000rpm for 5min to separate the supernatant and inclusion body precipitate. Collect 0.6g of inclusion body precipitate.

[0076] 3) Washing inclusion bodies: Dissolve the inclusion body precipitate in 30 mL of inclusion body washing solution (20 mM Tris-Hcl, 2 M urea, 500 mM Nacl, 1% Triton X-100, 1 mM EDTA, PH 8.0), and mix thoroughly by blowing at a ratio of 10 mg of inclusion body precipitate to 5 mL of inclusion body washing solution. Centrifuge at 4°C 12000 rpm for 20 min and discard the supernatant. Repeat the washing step 3 times. The resulting precipitate is the inclusion body to be purified.

[0077] 4) Dissolve the inclusion bodies: Add 1 mL of inclusion body dissolving solution (20 mM Tris-Hcl, 8 M urea, 500 mM Nacl, 5 mM imidazole, 1 mM DTT, PH 8.0), shake thoroughly, and place at room temperature for 30 min. Centrifuge at 4°C 12000 rpm for 20 min and collect the supernatant, which is the inclusion body dissolving solution. Filter the inclusion body dissolving solution with a 0.22 μm syringe filter for later use.

[0078] 5) Inclusion body Ni column affinity purification: Take a 1mL Ni-NTA pre-packed column and drain the storage buffer by gravity. Equilibrate the column with two column volumes of Binding / Wash Buffer (20Mm Tris-Hcl, 8M urea, 500mM Nacl, 5mM imidazole, PH8.0) and use a flow rate of 0.5-1mL / min to allow the buffer to slowly drain from the resin. Mix the above inclusion body solution with Binding / Wash Buffer 1:1 to prepare the sample solution. Add the sample solution to the column and collect the flow-through into a centrifuge tube. Wash the column with two column volumes of Binding / Wash Buffer and collect the flow-through until the absorbance of the flow-through at 280nm is close to the baseline. The target protein was eluted with 50mmol / L, 100mmol / L, 150mmol / L, 250mmol / L, and 500mmol / L Ni-NTA Elution-Buffer (20mM Tris-HCl, X mM imidazole, 0.5M NaCl, 8M urea, pH 8.0) at a flow rate of 1mL / min, and the effluent was collected. The protein concentration in the eluate was determined using a BCA protein concentration determination kit. Sampling was performed on the 5 effluents for SDS-PAGE electrophoresis to determine in which effluent the protein was mainly distributed.

[0079] 6) Protein dialysis refolding: The flow-through containing the most target protein was placed in a dialysis bag, and then placed in refolding buffers with different concentrations of urea (50mM Tris-HCl, 100mM NaCl, 6M / 4M / 2M urea, 1% glycine, 5% glycerol, 0.2% PEG, 1mM oxidized glutathione, 1mM reduced glutathione, pH 8.5), and dialyzed at 4° for 6 hours. Finally, the dialysis bag was placed in PBS for overnight dialysis.

[0080] 7) Protein concentration: After dialysis, wipe the dialysis bag dry and completely cover it with PEG-8000. Replace it with dry PEG-8000 every 3-4 hours to concentrate the protein to a suitable volume.

[0081] 8) Protein endotoxin removal: Under the condition of no or very low endotoxin, use Protein Endotoxin Removal Kit to remove endotoxin from protein samples. Take the dialyzed and concentrated target protein solution and add Endotoxin Removal Solution A to mix, then add Endotoxin Removal Solution B to mix, then add Separation Indicator to mix, incubate at 4℃ or on ice for 5min, incubate at 37℃ for 1min, centrifuge at 12000~14000g for 5min at 25℃ or room temperature to separate the two phases, and collect the upper aqueous phase.

[0082] 9) Endotoxin detection: Using an endotoxin detection kit, prepare a 1EU / mL endotoxin solution to prepare a standard concentration series of solutions to generate a standard curve. Set the endotoxin standard concentrations to 0.1, 0.05, 0.025, and 0.01EU / mL. Transfer the standard and protein samples to a 96-well plate to read the absorbance at 545nm. After removing endotoxin from the protein, use the BCA method to determine the concentration of the target protein.

[0083] 1.2.6 Biological activity detection of recombinant protein IL-17A

[0084] Peel off the femur and tibia of 3-4 week old SPF chickens, cut the two ends of the bones with scissors to expose the inner cavity. Use a syringe to draw an appropriate amount of homogenate flushing solution to flush out the bone marrow in the inner cavity. Collect the bone marrow or bone marrow suspension into a 1.5 mL centrifuge tube, repeatedly blow to form a single cell suspension, and filter with a 70 μm cell mesh. Centrifuge at 450g for 10 minutes and discard the supernatant. Resuspend the cells with tissue sample diluent to a concentration of 2×10 8 -1×10 9 / mL of single cell suspension for later use. Use a 15mL centrifuge tube and add 5mL of separation solution and cell suspension respectively. Centrifuge at 500g for 25min at 20℃. After centrifugation, the centrifuge tube is divided into four layers from top to bottom. The first layer is the tissue diluent layer. The second layer is the ring-shaped milky white chicken mononuclear cell layer. The third layer is the transparent separation liquid layer. The fourth layer is the red blood cell and granulocyte layer. Carefully transfer the ring-shaped milky white chicken mononuclear cell layer in the centrifuge tube to a new centrifuge tube. Add 10mL of washing solution and mix the cells. Centrifuge at 250g for 10min. Discard the supernatant. Use a pipette to aspirate 5mL of washing solution and resuspend the obtained cells. Centrifuge at 250g for 10min and discard the supernatant. Repeat the washing twice, discard the supernatant, and resuspend the obtained cells with complete culture medium (DMEM+10% FBS+1% P / S). Mononuclear cells are cultured at 2×10 6cell / mL concentration, cultured in 6-well plates (2mL / well), and treated with 50ng / mL IL-17A for 24h. Add an equal volume of PBS as a negative control, and add 2μg / mL LPS as a positive control. Collect the supernatant after 24h, add 500μL of cell lysis buffer to the well plate to lyse the cells, extract total RNA, and measure the concentration. Reverse transcribe 1μg RNA into cDNA. Perform qPCR to detect the relative expression of IL-1β, IL-6, and TNF-α genes.

[0085] Table 4 qPCR primer sequence information

[0086] Primer Primer Sequence (5'-3') TNF-α-F (SEQ ID NO:3) CTTCTGAGGCATTTGGAAGC TNF-α-R (SEQ ID NO:4) ACTGGGCGGTCATAGAACAG IL-1β-F (SEQ ID NO:5) GGATTCTGAGCACACCACAGT IL-1β-R (SEQ ID NO:6) TCTGGTTGATGTCGAAGATGTC IL-6-F (SEQ ID NO:7) ATCCGGCAGATGGTGATAAA IL-6-R (SEQ ID NO:8) CCCTCACGGTCTTCTCCATA

[0087] 2 Results and discussion

[0088] 2.1 Gene acquisition and its characteristics

[0089] The amino acid sequence (GenBank: CAO79600.1) and nucleotide sequence (GenBank: AM773756) of chicken IL-17A protein were obtained from NCBI. The nucleotide sequence was derived from white-feathered chicken and was located on chromosome 3. The nucleotide sequence was 580 bp in length, and the nucleotides encoding the protein were 52 to 504 bp.

[0090] 2.2 Primary structure analysis of chicken IL-17A protein

[0091] 2.2.1 Analysis of physical and chemical properties

[0092] The analysis of PortParam online software showed that the chicken IL-17A protein is composed of 2368 atoms and its molecular formula is C 727 H 1192 N 222 O 218 S9; relative molecular mass is 17919.36Da (including His-Tag). The types and proportions of amino acids are shown in Table 2. Using PortParam online software analysis, it can be obtained that in aqueous solution (280nm), if all Cys of chicken IL-17A protein form disulfide bonds, its extinction coefficient is 8 855L / (mol·cm); if all Cys do not form disulfide bonds, its extinction coefficient is 8 480L / (mol·cm). The N-terminus of the protein sequence is M (Met), and the estimated half-life is 30 hours (mammalian reticulocytes, in vitro), greater than 20 hours (yeast, in vivo), and greater than 10 hours (Escherichia coli, in vivo). The instability coefficient of chicken IL-17A is 38.11. It shows that it has good stability and the protein is classified as a stable protein.

[0093] Table 5 Amino acid composition information of chicken IL-17A protein

[0094]

[0095] 2.2.2 Hydrophobicity analysis

[0096] The results were analyzed using the Expasy online tool ProtScale online analysis software. Figure 1 As shown: the lipophilic index of chicken IL-17A protein is 84.47, and the grand average of hydropathicity (GRAVY) is -0.459 (GRAVY is between -2 and 2, greater than 0 is hydrophobic, and less than 0 is hydrophilic). The analysis results show that chicken IL-17A protein has strong hydrophilicity.

[0097] 2.2.3 Analysis of chicken IL-17A protein signal peptide

[0098] The results of the online analysis software SignalP 6.0-DTU Health Tech-Bioinformatic Services are as follows Figure 2 As shown: the signal peptide value Sec / SPI of chicken IL-17A protein is 0.0626 (less than 0.5), indicating that the protein does not have a conventional secretion signal peptide.

[0099] 2.3 Prediction of the secondary structure of chicken IL-17A protein

[0100] 2.3.1 Transmembrane domain prediction

[0101] The TMHMM method was used to analyze the transmembrane region of the protein, and the results showed that ( Figure 3 ): Chicken IL-17A protein does not have a transmembrane region. The protein is a secretory protein located outside the cell membrane (Inside represents the intracellular region. The larger the inside value, the greater the possibility that the amino acid is located in the intracellular region; Outside represents the extracellular region. The larger the outside value, the greater the possibility that the amino acid is located in the extracellular region).

[0102] 2.3.2 Prediction of the secondary structure of chicken IL-17A protein

[0103] The PSIPRED online software analysis results are as follows Figure 4As shown: Figure A shows that chicken IL-17A protein has 1 α helix, 8 random coils and 10 β folds; chicken IL-17A protein does not have a secretion signal peptide and no disordered fragments. This is consistent with the results of the SignaIP 6.0 online software analysis; Figure B shows that the chicken IL-17A protein contains 29.3% small non-polar amino acids, 24.0% hydrophobic amino acids, and 38.6% polar amino acids. The results show that the secondary structure of the M protein is mainly random coils and β folds, and the hydrophobicity is average.

[0104] 2.3.3 Prediction of disulfide bond positions in chicken IL-17A protein

[0105] The analysis results using Cyscon online software showed that there were two pairs of disulfide bonds in the chicken IL-17A protein, located on the 30th, 124th and 89th, 139th cysteine ​​residues respectively.

[0106] 2.4 Prediction of the tertiary structure of chicken IL-17A protein

[0107] Predicted structures from the AlphaFold protein structure database using MMseq2 and Foldseek clustering. AlphaFold generates a per-residue model confidence score (pLDDT) between 0 and 100. Some regions with pLDDT below 50 may be isolated unstructured regions. Figure 5 As shown, the secondary structure of chicken IL-17A protein is mainly random coil and β-fold, which is consistent with the online prediction results of PSIPRED software.

[0108] 2.5 Analysis of phosphorylation and glycosylation sites of chicken IL-17A

[0109] 2.5.1 Phosphorylation analysis

[0110] Through NetPhos3.1 software analysis, it was found that ( Figure 6 ): There are 22 phosphorylation sites in M ​​protein, including 13 serines, 7 threonines and 2 tyrosines.

[0111] 2.5.2 Glycosylation analysis

[0112] NetNGlyc 1.0Server software was used to analyze the glycosylation modification of M protein ( Figure 7 ), there is a potential N-glycosylation modification at the 5th aspartic acid residue of the M protein.

[0113] 2.6 Construction of pET28a-IL-17A prokaryotic expression vector

[0114] The double enzyme digestion products were analyzed on 1% agarose gel. Figure 8As shown, a band consistent with the size of the pET28a(+) vector fragment was obtained at 5000 bp, and a band consistent with the size of the IL-17A target gene appeared at 500 bp. The plasmid was sequenced and compared with the sequence after codon optimization, indicating that the plasmid was successfully constructed and named pET28a-IL-17A( Fig. 9 ).

[0115] 2.7 Inducible expression and identification of recombinant plasmid pET28a-IL-17A

[0116] 2.7.1 Inducible expression of pET28a-IL-17A

[0117] When the IPTG concentration was 1 mmol / L and the induction temperature was 37°C, the target protein was expressed in the inclusion body after 16 h of induction. Only a small amount of protein was present in the supernatant. The target protein IL-17A band was 17.9 kDa. There was no obvious protein band in the uninduced control group ( Fig.10 ).

[0118] 2.7.2 Western blot identification of recombinant IL-17A protein

[0119] After incubation with primary antibody His-Tag (1:5000) and secondary antibody Goat-AntiMouse (1:2000), the target protein IL-17A with His-Tag specifically binds to the primary antibody. The pET-28a-IL-17A inclusion body protein has a target band at 17.9kDa ( Fig.11 ), combined with SDS-PAGE detection, showed that the induced expression of IL-17A gene was successful.

[0120] 2.8 Optimization of expression conditions of recombinant protein IL-17A

[0121] 2.8.1 Optimal IPTG induction concentration

[0122] The induction temperature was 37°C, and the IPTG concentrations were 0, 0.5, 1, 1.5, and 2 mmol·L -1 , induced for 16 h, the results showed that the IPTG concentration was 1.5 mmol·L -1 When the IPTG concentration was increased to 1 mmol·L -1 After PCR, the expression of protein in the inclusion body did not change significantly. However, as the concentration of IPTG increased, the expression of the target protein in the supernatant increased ( Fig.12 ). Divide the gray value of each target protein by the gray value of the marker for normalization and plot in GraphPrism software ( Fig.13Considering the expression cost, the optimal IPTG induction concentration is 1 mmol·L -1 .

[0123] 2.8.2 Optimal induction temperature

[0124] IPTG concentration was 1 mmol·L -1 , induced at different temperatures of 16℃, 20℃, 27℃, and 37℃ for 16h. The results showed that when the induction temperature was 27℃ and 37℃, the protein expression level was high and only existed in the form of inclusion bodies. When the induction temperature was 37℃, the amount of impurity protein was the least ( Fig.14 ).

[0125] 2.8.3 Optimal induction time

[0126] IPTG concentration was 1 mmol·L -1 , induced at 37°C for 4h, 8h, 12h, and 16h respectively. The results showed that when the induction time was 16h, the protein expression level was the highest and existed only in the form of inclusion bodies ( Fig.15 ).

[0127] 2.8.4 Large-scale expression and purification of recombinant protein IL-17A

[0128] like Fig.16 and Fig.17 As shown, 13% SDS-PAGE detection of protein purification samples showed that the recombinant protein IL-17A was well bound to the Ni affinity chromatography column, and the buffer containing 100mmol / L imidazole had a good elution effect on the recombinant protein IL-17A, with a purity of more than 90%. After the recombinant protein was endotoxin-removed, the endotoxin concentration was <0.1EU / mL. The protein concentration of the eluted sample was determined by the BCA method to be 1.7mg / mL.

[0129] 2.9 Endotoxin detection of recombinant protein IL-17A

[0130] Using ToxinSensor TM Chromogenic LAL Endotoxin Assay Kit detects IL-17A endotoxin content, such as Fig.18 The endotoxin content of IL-17A was 0.026EU / mL (less than 0.1EU / mL, determined to be endotoxin-free).

[0131] 3.0 Biological activity detection of recombinant protein IL-17A

[0132] In order to explore whether the recombinant protein IL-17A has biological activity, mononuclear cells were stimulated with IL-17A for 24 hours, LPS stimulation was used as a positive control, and an equal volume of PBS was added as a negative control. After 24 hours, the cells were collected and RNA was extracted, and RT-qPCR was performed to detect the relative expression of IL-1β, IL-6, and TNF-β genes. Fig.19 The results showed that compared with the untreated cells (Control group), the expression of proinflammatory factors IL-1β, IL-6, and TNF-β in mononuclear cells increased significantly after LPS stimulation. IL-17A also stimulated the upregulation of IL-1β, IL-6, and TNF-β, with the most significant effect on IL-6. In summary, recombinant IL-17A activated the cellular inflammatory response, and it was determined that the recombinant protein IL-17A expressed in this study had biological activity.

[0133] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0134] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A method for preparing chicken IL-17A recombinant protein, characterized in that: The following steps are involved: The coding sequence of chicken IL-17A was inserted into the expression plasmid to obtain a recombinant plasmid; the recombinant plasmid was transformed into BL21 competent cells for culture, and then the bacterial solution was inoculated in LB Kan+ When the OD value of the bacterial solution reaches 0.5-0.8, add 1mmol·L -1 Isopropyl β-D-thiogalactoside was cultured at 37°C with shaking for 16 h, and the upper culture medium was discarded by centrifugation and the cells were recovered; The bacterial cells are lysed to obtain inclusion bodies, then the inclusion bodies are washed and dissolved, and then Ni column affinity purification is performed to obtain a target protein solution; The target protein solution is dialyzed, renatured and concentrated, and then endotoxin is removed to obtain the chicken IL-17A recombinant protein.

2. The preparation method according to claim 1, characterized in that: The lysis specifically includes the following steps: resuspending the bacteria at a ratio of 1 g of bacteria to 9 mL of TBS buffer, adding Tiehui E. coli Lysis Buffer at 1 / 9 of the volume of the resuspended bacteria and mixing evenly, lysing at 4° C. for 10 minutes, centrifuging at 8000 rpm for 5 minutes, and collecting the precipitate to obtain inclusion bodies.

3. The preparation method according to claim 1, characterized in that: The washing of inclusion bodies specifically comprises the following steps: dissolving 10 mg of inclusion bodies in 5 mL of inclusion body washing solution, centrifuging at 4° C. and 12,000 rpm for 20 min, discarding the supernatant, repeating the process for multiple times, and collecting the precipitate.

4. The preparation method according to claim 1, characterized in that: The dissolving of inclusion bodies specifically comprises the following steps: mixing the inclusion bodies with the inclusion body dissolving solution, placing at room temperature for 30 minutes, centrifuging at 4°C and 12000 rpm for 10 minutes, collecting the supernatant, and filtering with a 0.22 μm filter membrane.

5. The preparation method according to claim 1, characterized in that: The Ni column affinity purification specifically includes the following steps: taking a 1 mL Ni-NTA pre-packed column, mixing the inclusion body solution with Binding / Wash Buffer at a ratio of 1:1 to prepare a sample solution, so that the total volume of the sample solution is twice the column volume; adding the sample solution to the column, and then washing the column with Binding / Wash Buffer; eluting the target protein with Ni-NTA Elution-Buffer containing 100 mmol / L imidazole at a flow rate of 1 mL / min, and collecting the effluent.

6. The preparation method according to claim 1, characterized in that: The dialysis renaturation specifically includes the following steps: placing the target protein solution into a dialysis bag, placing it in renaturation buffers with different concentrations of urea in sequence, placing it at 4° for 6 hours, and finally placing the dialysis bag in PBS for dialysis overnight.

7. The preparation method according to claim 1, characterized in that: The concentration specifically includes the following steps: after dialysis, wipe the dialysis bag dry, completely cover the dialysis bag with PEG-8000, and replace it with dry PEG-8000 every 3 to 4 hours until the volume of the target protein solution is 200 to 300 μL.

8. The preparation method according to claim 1, characterized in that: The endotoxin removal specifically includes the following steps: taking the dialyzed and concentrated target protein solution, adding Endotoxin Removal Solution A and mixing, then adding Endotoxin Removal Solution B and mixing, and then adding Separation Indicator and mixing, incubating at 4°C or on ice for 5 minutes, incubating at 37°C for 1 minute, centrifuging at 25°C or room temperature at 12000-14000g for 5 minutes to separate the two phases, and collecting the upper aqueous phase.

9. Use of the chicken IL-17A recombinant protein prepared by the preparation method according to any one of claims 1 to 8 in the preparation of a product for activating cellular inflammatory response.

10. The use according to claim 9, characterized in that: The product is an immunopotentiator, and the activation of cellular inflammatory response includes increasing the expression levels of IL-1β, IL-6 and TNF-β.

Images