A strain of meiomicrozyma pulcherrima for delaying early leaf fall of pear and its application

Abstract

The application discloses a strain of Mei Ji Maydomyces for delaying early leaf fall of pears and application thereof, and belongs to the technical field of microorganisms. The strain has a preservation number of CGMCC NO.31969 and a preservation date of September 13, 2024. The Mei Ji Maydomyces provided by the application is separated from the surface of healthy pear fruits, is harmless to human bodies, is high in safety, has strong bacteriostatic activity, and can effectively inhibit the growth of early leaf fall pathogenic bacteria of pear, such as Guibao anthracnose, Alternaria alternata and Neofusicoccum parvum. The application makes up for the deficiency of existing plant growth regulators and widens the application range of plant senescence delaying agents.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a strain of Meiromyces metschnikovii for delaying early leaf fall of pear and application thereof. BACKGROUND

[0002] Early leaf fall of pear is mainly caused by Colletotrichum gloeosporioides, Alternaria alternata, Neofusicoccum parvum and Botryosphaeria berengeriana, which leads to early leaf and fruit drop of pear, resulting in secondary flowering and fruiting of pear in autumn, and seriously affecting the yield and quality of pear in the coming year. In production, it mainly relies on chemical agents for prevention and control. Long-term and large-scale use of chemical agents increases the drug resistance of pathogens, and also causes serious pesticide residues, which seriously threatens the healthy and sustainable development of pear industry. Therefore, developing efficient and non-toxic methods for controlling fruit tree diseases has become a research hotspot.

[0003] Previous studies have shown that antagonistic yeast can effectively reduce the occurrence of diseases and pests. For example, the Chinese patent application document with publication number CN112342147A discloses a strain of Pichia guilliermondii that can antagonize multiple pathogens and its application. It is found that Pichia guilliermondii can antagonize the growth of Alternaria alternata and Myceliophthora dregmata, thereby reducing the occurrence of fruit and vegetable diseases. The Chinese patent application document with publication number CN108118004A discloses a Pichia xishanensis strain that can effectively prevent postharvest diseases of fruits, as well as its preparation and use method. It is found that the Pichia xishanensis strain BY35 can inhibit the occurrence of pear fruit penicillium disease, gray mold and anthracnose, as well as citrus penicillium disease. Yeast mainly distributes in environments with high sugar content and slightly acidic pH, and there are relatively rich yeast species in some fruits. Although the yeast strains found so far can effectively inhibit the occurrence of fruit and vegetable diseases, there is still no report on yeast strains that can antagonize the pathogenic bacteria of early leaf fall of pear. SUMMARY

[0004] The technical problem to be solved by the present application is how to provide a yeast strain that can antagonize the pathogenic bacteria of early leaf fall of pear, and screen more efficient and broad-spectrum antagonistic yeast to solve the problem of narrow inhibition range of existing antagonistic yeast.

[0005] The present application solves the above technical problems through the following technical means:

[0006] The first aspect of the present application provides a Meiromyces metschnikovii strain, which has a preservation number of CGMCC NO.31969 and a preservation date of September 13, 2024.

[0007] The Meiromyces metschnikovii strain screened in the present study was preserved in the China General Microbiological Culture Collection Center (CGMCC) on September 13, 2024, and the preservation address is No. 1, Beichen West Road, Yard 3, Chaoyang District, Beijing, with a preservation number of CGMCC NO.31969.

[0008] The 26S rRNA nucleotide sequence of the above-mentioned M. pulcherrima strain is shown as SEQ ID NO: 1.

[0009] The second aspect of the present application provides the above-mentioned M. pulcherrima strain or its fermentation liquor for use in inhibiting the pathogenic bacteria of pear early defoliation.

[0010] Preferably, the pathogenic bacteria include one or more of Elsinoe ampelina, Alternaria alternata, Cytospora mandshurica and Botryosphaeria berengeriana.

[0011] The third aspect of the present application provides a pear early defoliation retardant, which comprises the above-mentioned M. pulcherrima strain or its fermentation liquor.

[0012] Preferably, the fermentation liquor is obtained by the following process: picking a single colony of M. pulcherrima in YPDA liquid medium, and then culturing at 28℃ with 200r / min for 16-24h, and then collecting by centrifugation.

[0013] Preferably, it further comprises melatonin (MT), 6-benzyladenine (6-BA), L-proline and linoleic acid.

[0014] Preferably, it comprises M. pulcherrima with OD 600 =0.6, 25mg / L L-proline and 50μmol / L 6-benzyladenine.

[0015] The fourth aspect of the present application provides a pear early defoliation retardant, which comprises the above-mentioned M. pulcherrima strain or its fermentation liquor.

[0016] Preferably, the amount of each spraying is specifically to ensure that there is liquid dripping on the leaves after spraying.

[0017] The present application has the following advantages:

[0018] 1. The M. pulcherrima provided by the present application is separated from the surface of healthy pear fruits, which is harmless to human body and has high safety, has strong bacteriostatic activity, widens the application range of antagonistic yeast, and helps to improve the broad-spectrum disease resistance of fruits and vegetables, and can effectively inhibit the growth of the pathogenic bacteria of pear early defoliation, i.e. Elsinoe ampelina, Alternaria alternata, Cytospora mandshurica and Botryosphaeria berengeriana.

[0019] 2. The applicant has verified through a large number of experiments that the compound combination with good prevention and treatment effect is: OD 600The M. pulcherrima yeast body with a purity of 0.6, 25 mg / L L-proline and 50 μmol / L 6-benzyladenine can enhance the resistance of the M. pulcherrima yeast to Colletotrichum gloeosporioides, Alternaria alternata, Neofusicoccum parvum and Botryosphaeria berengeriana. The present application makes up the deficiency of the existing plant growth regulator and widens the application range of the plant senescence delaying agent. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 The M. pulcherrima yeast 26S rRNA nucleotide evolution analysis result in the embodiment 1 of the present application;

[0021] Figure 2 The morphological observation result of the M. pulcherrima yeast in the embodiment 1 of the present application, wherein A is the morphological characteristic diagram of the M. pulcherrima yeast on YPDA, and B is the morphological characteristic diagram of the M. pulcherrima yeast under the 10 times and 40 times objective lens of the electron microscope;

[0022] Figure 3 The inhibition effect of the M. pulcherrima yeast body on the Pyricularia piricola, Alternaria alternata, Cercospora beticola and Phaeosphaeria berengeriana in the embodiment 2 of the present application, wherein A is the influence diagram of the M. pulcherrima yeast body on the growth of the Pyricularia piricola, B is the influence diagram of the M. pulcherrima yeast body on the growth of the Alternaria alternata, C is the influence diagram of the M. pulcherrima yeast body on the growth of the Botryosphaeria berengeriana, D is the influence diagram of the M. pulcherrima yeast body on the growth of the Neofusicoccum parvum, and E is the lesion area diagram of the four kinds of fungi in the 2d and 4d of the M. pulcherrima yeast and the control treatment group;

[0023] Figure 4 The inhibition effect of the M. pulcherrima yeast fermentation liquor on the Pyricularia piricola, Alternaria alternata, Cercospora beticola and Phaeosphaeria berengeriana in the embodiment 3 of the present application, wherein A is the influence diagram of the M. pulcherrima yeast supernatant on the growth of the Pyricularia piricola, B is the influence diagram of the M. pulcherrima yeast supernatant on the growth of the Alternaria alternata, C is the influence diagram of the M. pulcherrima yeast supernatant on the growth of the Botryosphaeria berengeriana, D is the influence diagram of the M. pulcherrima yeast supernatant on the growth of the Neofusicoccum parvum, E is the lesion diameter diagram of the Pyricularia piricola in the 3d and 6d of the M. pulcherrima yeast supernatant and the control treatment group, F is the lesion diameter diagram of the Alternaria alternata in the 5d and 10d of the M. pulcherrima yeast supernatant and the control treatment group, G is the lesion diameter diagram of the Botryosphaeria berengeriana in the 2d and 4d of the M. pulcherrima yeast supernatant and the control treatment group, and H is the lesion diameter diagram of the Neofusicoccum parvum in the 2d and 4d of the M. pulcherrima yeast supernatant and the control treatment group;

[0024] Figure 5Figure for resistance evaluation of leaf anthracnose, leaf spot and leaf blotch of pear in 5 treatment groups and 1 control group in Example 4 of the present application, wherein A is the figure for resistance evaluation of leaf anthracnose, leaf spot and leaf blotch of Huangguan pear in 5 treatment groups and 1 control group, B is the figure for lesion diameter of anthracnose of Huangguan pear in 5 treatment groups and 1 control group, C is the figure for lesion diameter of leaf spot of Huangguan pear in 5 treatment groups and 1 control group, and D is the figure for lesion diameter of leaf blotch of Huangguan pear in 5 treatment groups and 1 control group;

[0025] Figure 6 Figure for resistance evaluation of leaf anthracnose, leaf spot and leaf blotch of pear in 5 treatment groups and 1 control group in Example 4 of the present application, wherein A is the figure for resistance evaluation of leaf anthracnose, leaf spot and leaf blotch of Huangguan pear in 5 treatment groups and 1 control group, B is the figure for lesion diameter of anthracnose of Huangguan pear in 5 treatment groups and 1 control group, C is the figure for lesion diameter of leaf spot of Huangguan pear in 5 treatment groups and 1 control group, and D is the figure for lesion diameter of leaf blotch of Huangguan pear in 5 treatment groups and 1 control group;

[0026] Figure 7 Figure for resistance evaluation of leaf anthracnose, leaf spot and leaf blotch of pear in 5 treatment groups and 1 control group in Example 4 of the present application, wherein A is the figure for resistance evaluation of leaf anthracnose, leaf spot and leaf blotch of Huangguan pear in 5 treatment groups and 1 control group, B is the figure for lesion diameter of anthracnose of Huangguan pear in 5 treatment groups and 1 control group, C is the figure for lesion diameter of leaf spot of Huangguan pear in 5 treatment groups and 1 control group, and D is the figure for lesion diameter of leaf blotch of Huangguan pear in 5 treatment groups and 1 control group;

[0027] Figures 3-6 In the table, * represents significant difference at P<0.05 level, ** represents extremely significant difference at P<0.01 level, *** represents extremely significant difference at P<0.001 level, and **** represents extremely significant difference at P<0.001 level. DETAILED DESCRIPTION

[0028] In order to make the objectives, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described below in connection with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.

[0029] In the following examples, the test materials and reagents used, unless otherwise specified, can be obtained from commercial channels.

[0030] In the embodiments, the specific techniques or conditions not specified can be carried out according to the techniques or conditions described in the literature in the art or according to the product instructions.

[0031] Example 1 Isolation, identification and morphological observation of Mei Mei Menge yeast

[0032] The separation sample is a healthy early crisp pear fruit, the sample is taken from the pear germplasm resource garden of Anhui Agricultural University High-tech Agricultural Park, the early crisp pear peel is placed in a conical flask with YPDA liquid medium, and it is ensured that the YPDA liquid medium completely submerges the pear peel. It is cultured at 28°C for 6h at 200r / min on a shaker, and then it is diluted according to 10 -1 , 10 -2 and 10 -3 , 100μL is taken after dilution for plating, and the plate is placed at 28°C for 2-3d. After single colonies grow, single colonies with different morphologies are picked for streaking and purification, and then round, convex, cream-colored or milk-white single colonies are selected for streaking on WL medium, and cultured at 28°C for 3-5d on a shaker. The yeast strains grown on the WL medium are identified, and the 26S rRNA gene sequence primers are used for amplification:

[0033] Forward NL-1: 5'-GCATATCAATAAGCGGAAAAG-3'(SEQ ID NO:2)

[0034] Reverse NL-4: 5'-GGTCCGTGTTTCAAGACGG-3'(SEQ ID NO:3). The amplification system is 25μL, and the amplification program is 94°C for 10min, 94°C for 30s, 55°C for 30s, 72°C for 30s for 30 cycles, and 72°C for 10min. The amplification product is sent to Hefei Youkang Gene Biotechnology Co., Ltd. for sequencing.

[0035] The sequencing results are subjected to sequence alignment and evolutionary analysis in the GenBank database, and the results show that the strain is clustered with known yeast strains Metschnikowia pulcherrima isolate (UTAD1429) and Metschnikowia pulcherima isolate (NXU 20-245) (as shown in Figure 1 ), which indicates that the strain is Metschnikowia pulcherrima, which is named Mp1, and is preserved in the China General Microbiological Culture Collection Center, with the preservation number CGMCC NO.31969.

[0036] The Metschnikowia pulcherrima single colony is streaked on YPDA plate medium, and the colony and cell morphology are observed after 2d of culture. The results show that the surface of the single colony of the strain is smooth and opaque, and is a round, convex, cream-colored, round, convex, with a neat edge, and produces red pigment (as shown in Figure 2 A). Under 10x and 40x microscopes, it is found that the strain is oval or nearly spherical, and single or multiple buds (as shown in Figure 2 B).

[0037] Example 2 Inhibition test of Metschnikowia pulcherrima yeast

[0038] Pick up a single colony of M. extremum in YPDA liquid medium, cultivate at 28°C with 200r / min for 16-24h, collect the yeast cells when OD 600 =1.5-2.0, dilute the collected yeast cells with sterile water to OD 600 =1.0, put 4 round filter paper pieces with 5mm in diameter around the 60mm culture dish, drop 5μL yeast cell suspension on each filter paper piece, drop 5μL sterile water on each control, then put 5mm size of C. gloeosporioides (isolated from the fruit of autumn pear in Henan Academy of Agricultural Sciences in 2024), A. alternata (isolated from the leaf of crystal pear in the high-tech agricultural park of Anhui University of Science and Technology in 2016, strain name: PL2, NCBI GenBank accession number: KX016032), and M. novoguineense (isolated from the leaf of Cui Guan pear in the high-tech agricultural park of Anhui University of Science and Technology in 2023) and B. berengeriana (donated by Professor Li-ping Wang of the College of Plant Science and Technology, Central China Agricultural University, strain name: LW-1) fungus cakes in the center of the culture dish, cultivate at 28°C for 2d and 4d, and take pictures.

[0039] Figure 3 The results showed that compared with the control, yeast cell treatment for 2d and 4d could significantly inhibit the mycelial growth of C. gloeosporioides, A. alternata, M. novoguineense and B. berengeriana, further indicating that yeast cells could secrete active antibacterial substances.

[0040] Example 3 Antifungal test of M. extremum fermentation broth

[0041] In order to explore the inhibitory effect of fermentation broth on early defoliation pathogens, a single colony of M. extremum was picked up in YPDA liquid medium, cultivated at 28°C with 200r / min for 16-24h, and the fermentation supernatant was collected by centrifugation when the OD 600 =1.5-2.0, the above fermentation supernatant was added to YPDA solid medium according to the volume ratio of 0, 10%, 25% and 50%, then C. gloeosporioides, A. alternata, M. novoguineense and B. berengeriana fungus cakes with a size of 5mm were placed in the center of the culture dish. The results are shown in Figure 4 When the concentration of fermentation broth reached 10%, the growth of the four kinds of fungi was significantly inhibited, and the lesion diameter showed a decreasing trend with the increase of fermentation broth concentration.

[0042] Example 4 Effect of M. extremum on mycelial growth of pear early defoliation pathogens

[0043] In order to explore the antibacterial effect of M. extremum and growth regulators on pear early defoliation pathogens, this study

[0044] First, the yeast cells of M. extremum (OD600 =1.0), 25 mg / L L-proline, 50 μmol / L 6-BA, 50 mg / L linoleic acid, 0.1 mmol / L MT are sprayed on the leaves of the pear after fruit harvesting, and the second spraying is performed after 7 days, for a total of 2 times, and the amount of each spraying is determined according to the size of the tree, and specifically, the liquid dripping on the leaves after spraying is ensured. The resistance evaluation of anthracnose, black spot and leaf spot is performed after 2 days of treatment, and the results show that the spraying of the above-mentioned substances can significantly inhibit the expansion of the pathogen (as shown in Figure 5 ), which indicates that the above-mentioned substances can induce plant resistance.

[0045] Further, the above-mentioned substances are compounded with Mei Ji Meiji yeast, and 5 treatment combinations are designed:

[0046] Mei Ji Meiji yeast bacteria (MJMQ) and H1: 0.1 mmol / L MT and 50 μmol / L 6-BA;

[0047] MJMQ and H2: 25 mg / L L-proline and 50 μmol / L 6-BA;

[0048] MJMQ and H3: 50 mg / L linoleic acid, 25 mg / L L-proline and 50 μmol / L 6-BA;

[0049] MJMQ and H4: 25 mg / L L-proline, 0.1 mmol / L MT and 50 μmol / L 6-BA;

[0050] MJMQ and H5: 50 mg / L linoleic acid, 25 mg / L L-proline, 0.1 mmol / L MT and 50 μmol / L 6-BA.

[0051] The above-mentioned 5 treatment groups and 1 control group (the control group is sprayed with sterile water) are sprayed on the leaves of the pear, and the second spraying is performed after 7 days, for a total of 2 times. The resistance evaluation of anthracnose, black spot and leaf spot is performed after 2 days of treatment, and the results show that the combination of Mei Ji Meiji yeast and H1, 2, 3 and 4 can significantly reduce the lesion diameters of the three pathogenic bacteria, and the MJMQ and H2: 25 mg / L L-proline and 50 μmol / L 6-BA treatment group has the best bacteriostatic effect (as shown in Figure 6 ).

[0052] Through observation on the phenotypes of the fallen leaves of Cuiyu and Huangguan pear trees after treatment, it is found that the leaves of the control group begin to yellow and fall off, while the leaves of the treatment group are mostly green (as shown in Figure 7 ), which indicates that the present application has a good prevention effect on delaying the early leaf fall of pear.

[0053] Meyerozyma guilliermondii yeast 26S rRNA nucleotide sequence: GTCCTTGTATTTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCCCCGGGAATTGTAATTTGAAGAGATTTGGGTCCGGCCGGCGGGGGTTAAGTCCACTGGAAAGTGGCGCCACAGAGGGTGACAGCCCCGTGAACCCCTTCAACGCCCTCATCCCAGATCTCCAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACTTAACTGGGCCAGCATCGGGGCGGCGGGAAACAAAACCACCGGGGAATGTACCTTTCGAGGATTATAACCCCGGTCCTTATTTCCTTGTTGCCCCGAGGCCTGCAATCTAAGGATGCTGGCGTAATGGTTGCAAGTCGCCCGTCTTGAACCACGGACCAAAGTGCCTCCCAAA (SEQ ID NO: 1)

[0054] Other parts not described in detail are prior art. Although the above embodiments have been described in detail for the present application, it is only a part of the embodiments of the present application, not all embodiments, and people can also obtain other embodiments according to the present embodiments without creativity, which all belong to the protection scope of the present application.

[0055] The above embodiments are only used to illustrate the technical solutions of the present application, not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A strain of Maggimycium yeast ( Metschnikowia pulcherima Mp1, characterized in that, The preservation number thereof is CGMCC NO.31969, and the preservation date is September 13, 2024.

2. The M. pulcherrima strain of claim 1, Metschnikowia pulcherima ) Mpl characterized in that, The 26S rRNA nucleotide sequence of the strain is shown as SEQ ID NO:

1.

3. The M. pulcherrima strain of claim 1, Metschnikowia pulcherima ) Mp1 or its fermentation liquor in inhibiting the pathogenic bacteria of pear early defoliation, the pathogenic bacteria including one or more of grapevine anthracnose, alternaria alternata, neofusicoccum paradoxum, botryosphaeria berengeriana; the fermentation liquor is obtained by the following process: picking up M. pulcherrima single colony in YPDA liquid medium, culturing at 28 o C shaker 200 r / min for 16-24 h, and collecting by centrifugation.

4. Use according to claim 3, characterized in that, The pathogenic bacteria are Colletotrichum gloeosporioides.

5. Use according to claim 3, characterized in that, The pathogenic bacteria are Alternaria alternata.

6. Use according to claim 3, characterized in that, The pathogenic bacteria are Neofusicoccum parvum.

7. A pear early leaf fall retardant, characterized by, a component is a meiomi chicha yeast strain according to claim 1 Metschnikowia pulcherima ) Mp1 or a fermentation broth thereof; The fermentation broth is obtained by the following process: picking up a single colony of M. metschnikoviae in YPDA liquid medium, culturing at 28 o C After 16-24 h of culture at 200 r / min on a shaker, it is collected by centrifugation.

8. The early leaf fall retardant for pear according to claim 7, characterized by OD 600 = 0.6 of M. pulcherrima, 25 mg / L L-proline and 50 μmol / L 6-benzylaminopurine.

9. A method of controlling the early leaf fall of pears, characterized in that, The method comprises the following steps: spraying the pear early defoliation retardant of any one of claims 7-8 on the leaves of the pear after the pear fruits are picked, and spraying the pear early defoliation retardant again after 7 days.

10. The method of claim 9, wherein the method is for delaying the early leaf fall of a pear. The amount of each spraying is specifically to ensure that there are liquid drops on the leaves after spraying.

Images