Directed evolution method and application

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a directed evolution method and application. The method comprises the following steps: dividing a full-length DNA (deoxyribonucleic acid) sequence of a target into at least two regions, respectively carrying out error-prone PCR (polymerase chain reaction), carrying out full-length sequence assembly on a mutation region and an unmutated region, screening a target mutant by adopting high throughput, carrying out regional amplification on the obtained target mutant to obtain a beneficial mutation region, the beneficial mutation region is amplified for full-length sequence assembly, and finally, a target mutant is obtained through high-throughput screening. According to the method disclosed by the invention, by carrying out segmented error-prone PCR and directional DNA shuffling on a full-length DNA sequence, limited digestion of DNase I or other restriction enzymes is not needed, so that reverse mutation of a recombinant DNA region can be prevented from occurring from the source, accumulation and average distribution of beneficial mutations are ensured, the screening difficulty and strength of beneficial mutants are reduced, and the screening efficiency of the beneficial mutants is improved. The method can be widely applied to molecular modification of proteins, enzymes or DNA sequences.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a directed evolution method and application. Background Art

[0002] DNA sequences and their translated products, proteins or enzymes, play extremely colorful and important roles in gene transcription expression regulation, catalysis and other biological functions. Therefore, it is still very attractive to obtain new DNA sequences that can meet our production and life needs. New DNA sequences can be found through traditional techniques and methods such as enrichment culture, metagenomics, and DNA database comparison, but these methods still cannot fully obtain sequences that meet our needs. With the increasing computing power and the improvement of mathematical models, de novo design based on homology modeling or deep learning can obtain DNA sequences, proteins or enzymes that do not exist in nature through rational transformation. However, research results show that many sites that affect the function of DNA sequences, proteins or enzymes are far away from the active or functional center, and we cannot fully explain the relationship between these regions and functions through theory. Therefore, it is difficult to perform precise molecular transformation in these areas.

[0003] Directed evolution solves the above theoretical and technical problems. Directed evolution or continuous directed evolution does not rely on the accurate 3D structural information of DNA sequences, proteins or enzymes, can simulate the evolutionary environment or conditions of natural DNA sequences, proteins or enzymes, and can quickly discover beneficial mutants by coupling high-throughput screening methods. At present, the most widely used directed evolution methods are error-prone PCR and DNA shuffling. However, traditional error-prone PCR, DNA shuffling and their combined techniques are prone to negative mutations and back mutations, and require tedious steps such as DNase I or other restriction endonucleases, recovery, etc., which increases the screening difficulty and intensity of beneficial mutants. Therefore, it is urgent to research and develop a new directed evolution method. Summary of the invention

[0004] The purpose of the present invention is to solve the deficiencies of the prior art and provide a method and application of directed evolution, which specifically adopts the following technical solutions: The first aspect of the present invention provides a method for directed evolution, comprising the following steps: The full-length DNA sequence of the target is divided into at least two regions for error-prone PCR, and the mutation region and the non-mutation region are assembled for full-length sequence. Then, high-throughput screening is used for target mutants, and the obtained target mutants are amplified in different regions to obtain beneficial mutation regions, and the beneficial mutation regions are amplified for full-length sequence assembly. Finally, the target mutants are obtained through high-throughput screening.

[0005] The present invention divides the gene into segments evenly, performs error-prone PCR on each segment, assembles the segments of error-prone PCR on each segment and the non-mutated part, obtains the beneficial mutations by high-throughput screening, and then performs full-length assembly on the screened beneficial mutations to obtain mutants with even distribution of beneficial mutations. The method is mainly aimed at the shortcomings of error-prone PCR, DNA shuffling and their combined technologies in the prior art, which require enzyme cutting into segments, thus easily leading to back mutations and negative mutations, and proposes a directed evolution method combining segmented error-prone PCR of full-length DNA sequence and directed DNA shuffling. Compared with the prior art, limited digestion by DNaseI or other restriction endonucleases is not required, so from a technical level, it can solve the shortcomings of the prior art that the recombined DNA region is prone to back mutations and negative mutations during the amplification process.

[0006] As a further preferred embodiment, the above-mentioned directed evolution method is used for the directed evolution of enzymes.

[0007] As a further preferred embodiment, the above method is used to carry out directed evolution of Penicillium oxalicum 16BGL.

[0008] As a further preferred embodiment, the steps of conducting directed evolution of Penicillium oxalicum 16BGL according to the above method are as follows: S1: The DNA sequence of Penicillium oxalicum 16BGL was divided into three fragment regions from the 5' end to the 3' end, and then the three fragment regions were subjected to error-prone PCR respectively; S2: using KOD high-fidelity DNA polymerase to perform PCR amplification on the first and second fragment regions, the second and third fragment regions, and the first and third fragment regions of the three fragment regions of the DNA sequence of Penicillium oxalicum 16BGL, respectively; S3: The first fragment region of the error-prone PCR in S1 and the second and third fragment regions of the KOD high-fidelity DNA polymerase in S2, the second fragment region of the error-prone PCR and the first fragment region of the KOD high-fidelity DNA polymerase in S2 and the third fragment region of the KOD high-fidelity DNA polymerase in S2, and the third fragment region of the error-prone PCR and the first and second fragment regions of the KOD high-fidelity DNA polymerase in S2 are connected to form complete genes, and then connected to the vector pYAT22, and then transformed into the competent cells of Saccharomyces cerevisiae MAY4741 by lithium acetate-PEG transformation method and cultured to obtain cloned mutant genes; S4: placing the cloned mutant gene obtained in step S3 in a culture medium for cultivation, placing it in formic acid for reaction after the cultivation to obtain positive mutants for primary screening, and then rescreening and sequencing the positive mutants to obtain three beneficial mutation regions; S5: The three beneficial mutation regions obtained in S4 were amplified separately and transformed into Saccharomyces cerevisiae MAY4741, screened, assembled, and finally the Penicillium oxalicum 16BGL mutant was obtained.

[0009] As a further preferred embodiment, the primers used in the above error-prone PCR and KOD high-fidelity DNA polymerase amplification are shown in SEQ ID NO: 5 to SEQ ID NO: 12.

[0010] As a further preferred embodiment, the reaction conditions of the error-prone PCR for the three fragments in the above S1 are: pre-denaturation at 94°C for 2 min; 40 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 51 sec; and 72°C for 10 min.

[0011] As a further preferred embodiment, the conditions for PCR amplification in S2 are pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, extension at 68°C at 2 kb / min, denaturation and extension for 40 cycles, and finally extension at 68°C for 10 min.

[0012] The second aspect of the present invention provides a Penicillium oxalicum 16BGL mutant obtained by the above-mentioned directed evolution method.

[0013] As a further preferred embodiment, the nucleic acid sequence of the Penicillium oxalicum 16BGL mutant is shown in SEQ ID NO:3.

[0014] The third aspect of the present invention also provides the application of the above-mentioned directed evolution method in the molecular modification of proteins, enzymes or DNA sequences.

[0015] The beneficial effects of the present invention are: The present invention uses segmented error-prone PCR and directional DNA shuffling of the full-length DNA sequence, which does not require limited digestion with DNaseI or other restriction endonucleases, can prevent the recombined DNA region from reverting mutations from the source, ensure the accumulation and average distribution of beneficial mutations, and reduce the difficulty and intensity of screening beneficial mutants. The combined method provided by the present invention is beneficial to the average distribution of mutation sites to the full-length sequence, and powerful mutants can be obtained, which can be widely used in the molecular modification of proteins, enzymes or DNA sequences. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Shown is a schematic diagram of the directed evolution method; Figure 2 The original Penicillium oxalicum 16BGL, the Penicillium oxalicum 16BGL mutant L2-1-C12 and the Penicillium oxalicum 16BGL mutant V 123Amino acid sequence mutation site map. DETAILED DESCRIPTION

[0017] The following will be combined with the embodiments and drawings to clearly and completely describe the concept, specific structure and technical effects of the present invention, so as to fully understand the purpose, scheme and effect of the present invention. It should be noted that the embodiments and features in the embodiments of this application can be combined with each other without conflict.

[0018] Example 1 The method for directed evolution of Penicillium oxalicum 16BGL, the specific process of which is as follows: Step 1: Error-prone PCR of three segments of the full-length DNA sequence (1) The DNA sequence of Penicillium oxalicum 16BGL (the nucleic acid sequence is shown in SEQ ID NO:1, and its amino acid sequence is shown in SEQ ID NO:2) is divided into three segments from the 5' end to the 3' end; then the first segment near the 5' end is amplified using specific primers SEQ ID NO:5 and SEQ ID NO:6; the middle segment (the second segment) is amplified using specific primers SEQ ID NO:7 and SEQ ID NO:8; and the third segment is amplified using specific primers SEQ ID NO:9 and SEQ ID NO:10.

[0019] The error-prone PCR reaction solution for the above three fragments consists of: 1 µL of 10×PCR buffer, 0.4 µL of 2.5mM dNTPmix, 0.2 µL of 100 mM dCTP, 0.2 µL of 100 mM dTTP, 0.3 µL of 10 pmol / μL downstream primer, 0.3 µL of 10 pmol / μL upstream primer (3 fragments), 0.1 µL of 5 U / μL rTaq DNA polymerase, 0.3 µL of 100 mM MgCl2, 0.3 µL of 10 mM MnCl2, 1 µL of 10 ng / μL pYAT22 template, and fill to 10 µL with sterile deionized water.

[0020] Error-prone PCR reaction conditions for the three fragments: pre-denaturation at 94°C for 2 min; 40 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 51 sec; and 72°C for 10 min.

[0021] SEQ ID NO:5 (FD5):TCTCGAGAAAAGAGAGGCTGAAGCTAAGGATCTTGCCTACTCTCCCCCCTT SEQ ID NO: 6 (FD2): ATAGACATGTCGAGACCGGCAAGGGCGTCACCGACACCGCTGTGGT SEQ ID NO:7 (FD1): ACCACAGCGGTGTCGGGTGACGCCCTTGCCGGTCTCGACATGTCTAT SEQ ID NO:8 (FD4): AACCAAGCTACGACCACTCTCTTGGCCGGGCATACCAGCCCACAGAAT SEQ ID NO:9 (FD3):ATTCTGTGGGCTGGTATGCCCGGCCAAGAGAGTGGTCGTAGCTTGGTT SEQ ID NO:10 (YE8): GTCATTTAAATTAGTGATGGTGATGGTGATGCTGCACCTTGGGCAGATCGGCTG (2) The "2nd fragment + 3rd fragment region" was amplified by KOD high-fidelity DNA polymerase using upstream primer SEQ ID NO: 7 (FD1) and downstream primer SEQ ID NO: 10 (YE8); the "1st fragment + 2nd fragment region" was amplified by KOD high-fidelity DNA polymerase using upstream primer SEQ ID NO: 5 (FD5) and downstream primer SEQ ID NO: 8 (FD4); the 1st fragment region was amplified by KOD high-fidelity DNA polymerase using upstream primer SEQ ID NO: 5 (FD5) and downstream primer SEQ ID NO: 6 (FD2). The 3rd fragment region was amplified by KOD high-fidelity DNA polymerase using upstream primer SEQ ID NO: 9 (FD3) and downstream primer SEQ ID NO: 10 (YE8).

[0022] The above KOD high-fidelity DNA polymerase amplification system was prepared according to the instructions of the high-fidelity enzyme KOD DNA polymerase, and 0.3 μL of specific primers (SEQ ID NO: 11 and SEQ ID NO: 12), 0.2 μL of enzyme, 1 μL of dNTP, 1 μL of PCR buffer, 0.6 μL of Mg 2+ The pYAT22 vector without the gene connected behind the alpha signal peptide was amplified (the preparation method of the vector has been disclosed in the patent with application number 202410176480.0, which will not be described in detail in the present invention). The PCR conditions were pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, and extension at 68°C for 3 min 10 sec (speed of 2 kb / min), denaturation and extension were performed for 40 cycles, and finally extension was performed at 68°C for 10 min.

[0023] SEQ ID NO:11 (FD6): AGGGGGGAGAGTAGGCAAGATCCTTAGCTTCAGCCTCTTTTCTCGAGAGATACC SEQ ID NO: 12 (E6): CAGCCGATCTGCCCAAGGTGCAGCATCACCATCACCATCACTAATTTAAATGAC After the amplification of (1) and (2) above is completed, all PCR products are recovered using a kit.

[0024] Step 2: Full-length sequence assembly S1: Gibson seamless cloning multi-fragment ligation [Novozymes seamless cloning kit; 5 μL 2 × CE Mix (enzyme), 0.3 pmol error-prone PCR fragment 1 region, 0.3 pmol KOD high-fidelity DNA polymerase amplified "fragment 2 + fragment 3 region", 0.06 pmol 6000 bp pYAT22, add sterile deionized water to 10 μL], and transform the ligation product into 360 μL of Saccharomyces cerevisiae MAY4741 competent medium by lithium acetate-PEG transformation method, then add 1 ml YPD liquid culture medium and culture at 30℃ for 1 h, then take 100 μL and spread it on uracil-free SD solid medium containing 10 mg / mL sodium formate and culture at 30℃ for 2-3 days.

[0025] The same method as above was used to transform the second fragment region amplified by error-prone PCR, the first fragment region amplified by KOD high-fidelity DNA polymerase, and the third fragment region amplified by KOD high-fidelity DNA polymerase into Saccharomyces cerevisiae MAY4741.

[0026] The same method as above was used to transform the error-prone PCR fragment 3 region and the "fragment 1 + fragment 2 region" amplified by KOD high-fidelity DNA polymerase into Saccharomyces cerevisiae MAY4741.

[0027] S2: High-throughput screening The large clones in the solid medium in S1 above were transferred to a 96-well plate containing 150µL SD medium without uracil and cultured at 30°C for 2-3 days. Take 10µL of supernatant in the 96-well plate, add formic acid with a final concentration of 10mg / mL and incubate at 37°C for 1h, add alkali to pH5, and then add 10µL 0.1% salicin (pH5) and react at 50°C for 10min to initially screen mutants with high activity. Inoculate positive mutants into test tubes or shake flasks for rescreening, and then send them to the company for sequencing to obtain beneficial mutation regions.

[0028] S3: Coupled Directed DNA Shuffling The total genome of the positive mutant verified by rescreening in S2 was extracted, and the three beneficial mutation regions were amplified respectively using KOD high-fidelity DNA polymerase according to the above amplification method. The complete gene assembled by beneficial mutation region 1, beneficial mutation region 2, and beneficial mutation region 3 was transformed into Saccharomyces cerevisiae MAY4741 using the same method as above. The positive mutant was inoculated into a test tube or a shake flask for rescreening using the same method, and finally, the full-length Penicillium oxalicum 16BGL mutant V with a cumulative superposition effect of beneficial mutations was obtained. 123 (The nucleic acid sequence is shown in SEQ ID NO: 3, and the amino acid sequence is shown in SEQ ID NO: 4).

[0029] Example 2 In this example, the original Penicillium oxalicum 16BGL (original 16BGL) was used as a control, and the mutant V of Penicillium oxalicum 16BGL prepared in Example 1 was compared. 123 The specific process of determining the organic acid tolerance is as follows: Under the conditions of incubation for 1 h at final formic acid concentrations of 15 mg / mL and 20 mg / mL, the original 16BGL and the mutant V of Penicillium oxalicum 16BGL were 123 The activity was tested under the reaction conditions of 50°C and pH 5.0.

[0030] In the presence of 0.5% cellobiose as substrate and after treatment with 10 mg / mL formic acid, the specific activity of 16BGL was 2.62 IU / mg. 123 Under the same conditions, the specific activity was 7.18 IU / mg, which was 2.74 times that of the original enzyme. This demonstrated their excellent stability in the formic acid environment. When the formic acid concentration climbed to 15 mg / mL, the activity of the original enzyme 16BGL dropped sharply to 18.7%, and it was completely inactivated at 20 mg / mL. However, the mutant V of Penicillium oxalicum 16BGL 123 After treatment with 15 mg / mL formic acid, the specific activity of Penicillium oxalicum 16BGL mutant V was still 4.77 IU / mg, which is 5.30 times that of 16BGL. 123 The activity of Penicillium oxalicum 16BGL mutant V 123 They have strong stability in high concentration formic acid environments, which makes them have great potential for application in organic acid environments.

[0031] Comparative Example 1 According to the traditional error-prone PCR and high-throughput screening method (Huang Qiuxia. Directed evolution of β-glucosidase activity and organic acid tolerance [D]. Jiangxi Normal University, 2021.), the Penicillium oxalicum 16BGL mutant L2-1-C12 was obtained, and its mutation site is as follows Figure 2 shown.

[0032] The organic acid tolerance of the Penicillium oxalicum 16BGL mutant L2-1-C12 obtained above was determined using the test method of Example 3. Under the same treatment conditions of 20 mg / mL formic acid, the activity was only 3.8% of the original, and the enzyme activity was almost completely lost.

[0033] Therefore, in summary, the segmented error-prone PCR and directional DNA shuffling method created by the present invention has the characteristics of not requiring tedious steps such as DNase I or other restriction endonucleases and recovery, which is superior to traditional error-prone PCR and DNA shuffling methods. In addition, the enzyme activity of the Penicillium oxalicum 16BGL mutant obtained by the method of the present invention under acidic conditions is significantly better than that of the traditional method, so that its application in organic acid environments has great potential.

[0034] Although the description of the present invention has been quite detailed and specifically describes several described embodiments, it is not intended to be limited to any of these details or embodiments or any particular embodiment, but should be regarded as providing a broad possible interpretation of these claims in view of the prior art by reference to the appended claims, thereby effectively covering the intended scope of the present invention. In addition, the above description of the present invention is based on the embodiments foreseeable by the inventor, and its purpose is to provide a useful description, and those non-substantial changes to the present invention that have not yet been foreseen may still represent equivalent changes to the present invention.

Claims

1. A method of directed evolution, characterized in that: The following steps are involved: The full-length DNA sequence of the target is divided into at least two regions for error-prone PCR, and the mutation region and the non-mutation region are assembled for full-length sequence. Then, high-throughput screening is used for target mutants, and the obtained target mutants are amplified in different regions to obtain beneficial mutation regions, and the beneficial mutation regions are amplified for full-length sequence assembly. Finally, the target mutants are obtained through high-throughput screening.

2. The directed evolution method according to claim 1, characterized in that The method is used for directed evolution of enzymes.

3. The directed evolution method according to claim 2, characterized in that: The method was used to carry out directed evolution of Penicillium oxalicum 16BGL.

4. The directed evolution method according to claim 3, characterized in that: The method specifically includes the following steps for conducting directed evolution of Penicillium oxalicum 16BGL: S1: The DNA sequence of Penicillium oxalicum 16BGL was divided into three fragment regions from the 5' end to the 3' end, and then the three fragment regions were subjected to error-prone PCR respectively; S2: using KOD high-fidelity DNA polymerase to perform PCR amplification on the first and second fragment regions, the second and third fragment regions, and the first and third fragment regions of the three fragment regions of the DNA sequence of Penicillium oxalicum 16BGL, respectively; S3: The first fragment region of the error-prone PCR in S1 and the second and third fragment regions of the KOD high-fidelity DNA polymerase in S2, the second fragment region of the error-prone PCR and the first fragment region of the KOD high-fidelity DNA polymerase in S2 and the third fragment region of the KOD high-fidelity DNA polymerase in S2, and the third fragment region of the error-prone PCR and the first and second fragment regions of the KOD high-fidelity DNA polymerase in S2 are respectively connected into complete genes, and then connected to the vector pYAT22, and transformed into the competent cells of Saccharomyces cerevisiae MAY4741 by the lithium acetate-PEG transformation method and cultured to obtain cloned mutant genes; S4: placing the cloned mutant gene obtained in step S3 in a culture medium for cultivation, placing it in formic acid for reaction after the cultivation to obtain positive mutants for primary screening, and then rescreening and sequencing the positive mutants to obtain three beneficial mutation regions; S5: The three beneficial mutation regions obtained in S4 were amplified separately and transformed into Saccharomyces cerevisiae MAY4741, screened, assembled, and finally the Penicillium oxalicum 16BGL mutant was obtained.

5. The directed evolution method according to claim 4, characterized in that: The primers used for error-prone PCR and KOD high-fidelity DNA polymerase amplification are shown in SEQ ID NO:5-SEQ ID NO:

12.

6. The directed evolution method according to claim 4, characterized in that: The reaction conditions for error-prone PCR of the three fragments in S1 were: pre-denaturation at 94°C for 2 min; 40 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 51 sec; and 72°C for 10 min.

7. The directed evolution method according to claim 4, characterized in that: The conditions for PCR amplification in S2 were pre-denaturation at 94 °C for 2 min, denaturation at 98 °C for 10 sec, extension at 68 °C at 2 kb / min, 40 cycles of denaturation and extension, and finally extension at 68 °C for 10 min.

8. A mutant of Penicillium oxalicum 16BGL, characterized in that: The Penicillium oxalicum 16BGL mutant is obtained by the directed evolution method described in claim 4.

9. The Penicillium oxalicum 16BGL mutant according to claim 8, characterized in that The nucleic acid sequence of the Penicillium oxalicum 16BGL mutant is shown in SEQ ID NO:

3.

10. Application of the directed evolution method of claim 1 in molecular modification of proteins, enzymes or DNA sequences.

Images