MicroRNA derived from extracellular vesicles of Clonorchis sinensis and its application in cholangiocarcinoma induced by Clonorchis sinensis

By extracting CsEVs from the supernatant of adult Clonorchis sinensis and screening out Csi-miR-190-3p, the problem of lack of effective treatment for Clonorchis sinensis-induced cholangiocarcinoma was solved, and the migration and invasion of cholangiocarcinoma cells were inhibited, thus improving the treatment effect.

CN119320773BActive Publication Date: 2025-10-28SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411448380.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-17
Publication Date
2025-10-28
Estimated Expiration
2044-10-17

AI Technical Summary

Technical Problem

The lack of effective early diagnostic markers and highly effective anti-tumor drugs in current technologies leads to a low five-year survival rate for patients with cholangiocarcinoma caused by Clonorchis sinensis, and Clonorchis sinensis infection suppresses the effectiveness of immunotherapy, affecting patient prognosis.

Method used

Extracellular vesicles (CsEVs) were extracted from the supernatant of adult Clonorchis sinensis, and the microRNA Csi-miR-190-3p was screened out. The migration and invasion of CsEVs in cholangiocarcinoma cells were inhibited by an overexpression reagent, thus preparing a drug to treat cholangiocarcinoma caused by Clonorchis sinensis.

Benefits of technology

Csi-miR-190-3p can inhibit the migration and invasion of cholangiocarcinoma cells in vitro, providing a new direction for the treatment of Clonorchis sinensis-induced cholangiocarcinoma and enhancing the efficacy of immunotherapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119320773B_ABST
    Figure CN119320773B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedical technology, specifically relating to microRNA derived from extracellular vesicles of Clonorchis sinensis and its application in Clonorchis sinensis-induced cholangiocarcinoma. This invention extracts CsEVs from the supernatant of adult Clonorchis sinensis and sequences them, ultimately selecting Csi-miR-190-3p as the research subject. It is confirmed that Csi-miR-190-3p can inhibit the migration and invasion of RBE cells in vitro; its target gene is CXCL5, and this inhibitory effect is alleviated after co-transfection with the CXCL5 plasmid, indicating that Csi-miR-190-3p derived from Clonorchis sinensis extracellular vesicles holds promise for providing a new direction for the preparation of drugs to treat Clonorchis sinensis-induced cholangiocarcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to microRNA derived from extracellular vesicles of Clonorchis sinensis and its application in cholangiocarcinoma caused by Clonorchis sinensis. Background Technology

[0002] Clonorchiasis is a major public health problem, posing a significant threat to the health of people in endemic areas. Epidemiological studies have confirmed a close link between Clonorchiasis infection and the development of cholangiocarcinoma; based on this, in 2009, the International Agency for Research on Cancer (IARC) classified Clonorchiasis as a Group 1 carcinogen.

[0003] Currently, the mechanism by which Clonorchis sinensis infection leads to hepatobiliary carcinoma remains unclear. Possible causes include mechanical stimulation from the parasite, stimulation from its metabolic products, abnormal host immune responses, and the combined effects of mixed infections and multiple factors. Due to the lack of effective early diagnosis, biomarkers for assessing disease progression, and highly effective antitumor drugs, the five-year survival rate for cholangiocarcinoma patients is only around 5%. With the development of tumor biology and cell and molecular biology, identifying the specific molecules involved in the pathogenesis of hepatobiliary carcinoma and their mechanisms of action has gradually become a focus of research.

[0004] A recent research finding by Professor Kuang Ming's team at the First Affiliated Hospital of Sun Yat-sen University (FASN-mediated fatty acid biosynthesis remodels immune environment in Clonorchis sinensis infection-related intrahepatic cholangiocarcinoma[J]. Journal of Hepatology[2024-10-14].DOI:10.1016 / j.jhep.2024.03.016.) shows that Clonorchis sinensis infection can significantly shorten the survival of patients with intrahepatic cholangiocarcinoma and inhibit their response to immunotherapy. The expression levels of fatty acid biosynthesis and fatty acid synthase are significantly upregulated in cholangiocarcinoma patients with Clonorchis sinensis infection, leading to macrophage polarization towards tumor-associated macrophages and inhibiting the tumor-killing function of CD8+ T cells, resulting in the formation of an immunosuppressive microenvironment and malignant progression of the tumor. Furthermore, the combined use of FASN inhibitors can enhance the efficacy of PD-1 antibodies, making the treatment of cholangiocarcinoma complicated by Clonorchis sinensis infection more effective. The above research background indicates that Clonorchis sinensis infection can not only induce cholangiocarcinoma, but also affect the prognosis and clinical treatment choices of cholangiocarcinoma patients. Therefore, the study of the pathogenic mechanism of Clonorchis sinensis has important scientific significance and clinical value.

[0005] In recent years, the role of extracellular vesicles—subcellular components secreted by paracellular fluids—in the pathogenesis of parasites has received widespread attention. Extracellular vesicles protect their internal bioactive substances from degradation and dilution in the extracellular environment and can be transported long distances via blood or tissue fluid, mediating intercellular communication and serving as an important pathway for pathogen-host interactions. Currently, various parasitic protozoa and worms, including Plasmodium, Toxoplasma gondii, Leishmania, Schistosoma, Clonorchis sinensis, and Clonorchis sinensis, have been found to secrete extracellular vesicles, which regulate the host's immune microenvironment by delivering parasitic virulence factors, leading to infection and pathogenesis. Among these, microRNAs are a group of highly conserved small RNA molecules that play a crucial role in post-transcriptional gene regulation. In 2021, Professor Yan Chao's team at Xuzhou Medical University first confirmed the presence of CsEVs in the supernatant of Clonorchis sinensis adult worm cultures. These vesicles can promote bile duct injury and macrophage M1 polarization in vitro and in vivo by delivering Csi-let-7a-5p, inducing a pro-inflammatory microenvironment. This revealed a new mechanism for Clonorchis sinensis infection-induced bile duct injury (Yan C, Zhou QY, Wu J, et al. Csi-let-7a-5p delivered by extracellular vesicles from a liver fluke activates M1-like macrophages and exacerbates biliary injuries[J]. Proceedings of the National Academy of Sciences, 2021, 118(46):e2102206118.). However, the role of CsEVs in the malignant progression of Clonorchis sinensis-induced cholangiocarcinoma has not been fully elucidated. Therefore, further research is needed to determine whether Clonorchis sinensis extracellular vesicles can contribute to the treatment of Clonorchis sinensis-induced cholangiocarcinoma. Summary of the Invention

[0006] To overcome the shortcomings of the prior art, this invention successfully extracted CsEVs from the supernatant of adult Clonorchis sinensis and screened a microRNA, namely Csi-miR-190-3p, which can inhibit the migration and invasion of cholangiocarcinoma cells in vitro, and is expected to provide a new direction for the preparation of drugs for the treatment of Clonorchis sinensis-induced cholangiocarcinoma.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides the use of a reagent for overexpressing microRNA derived from extracellular vesicles of Clonorchis sinensis in RBE cells in the preparation of a drug for treating cholangiocarcinoma caused by Clonorchis sinensis, wherein the consensus mature sequence of the microRNA is shown in SEQ ID NO.1, and the mimic sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0009] Preferably, the drug for treating cholangiocarcinoma caused by Clonorchis sinensis is a drug that inhibits the migration of RBE cells.

[0010] More preferably, the drug for treating cholangiocarcinoma caused by Clonorchis sinensis is a drug that inhibits the longitudinal and / or transverse migration of RBE cells.

[0011] Preferably, the reagents for overexpressing MicroRNA derived from Clonorchis sinensis extracellular vesicles in RBE cells include the MicroRNA and liposome transfection reagents shown in SEQ ID NO.2 and SEQ ID NO.3.

[0012] The second aspect of the present invention provides a drug for treating cholangiocarcinoma caused by Clonorchis sinensis, characterized in that the drug has a reagent for overexpressing the MicroRNA shown in SEQ ID NO.2 and SEQ ID NO.3 in RBE cells as the main active ingredient.

[0013] Preferably, the drug further includes a pharmaceutically acceptable carrier.

[0014] Furthermore, the carrier is a functional pharmaceutical excipient acceptable in the pharmaceutical field, including surfactants, suspending agents, emulsifiers, and some novel pharmaceutical polymers, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid, etc. It may also include diluents, binders, lubricants, disintegrants, solubilizers, stabilizers, and other excipients.

[0015] Preferably, the dosage form of the drug includes tablets, capsules, powders, granules, and liquids. The drug formulation can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or locally). If certain drugs are unstable under gastric conditions, they can be formulated as enteric-coated tablets.

[0016] Compared with the prior art, the beneficial effects of the present invention are:

[0017] This invention extracts CsEVs from the supernatant of adult Clonorchis sinensis and sequences them, ultimately selecting Csi-miR-190-3p as the research object. Cell migration, invasion, and scratch assays confirm that Csi-miR-190-3p can inhibit the migration and invasion of RBE cells in vitro. Furthermore, luciferase reporter gene assays confirm that the target gene for Csi-miR-190-3p's inhibition of RBE cell migration and invasion is CXCL5. Co-transfection with the CXCL5 plasmid alleviates this inhibitory effect, indicating that Csi-miR-190-3p derived from Clonorchis sinensis extracellular vesicles holds promise for providing a new direction for the preparation of drugs to treat Clonorchis sinensis-induced cholangiocarcinoma. Attached Figure Description

[0018] Figure 1 To isolate, purify and identify extracellular vesicles of Clonorchis sinensis;

[0019] Figure 1 In the image, (A) adult Clonorchis sinensis worms collected from infected cat livers; (B) morphological identification of CsEVs by negative staining transmission electron microscopy, showing typical vesicle structures, scale bar: 200 nm; (C) identification of the diameter and particle size distribution of CsEVs by Nanosight NS300 analyzer.

[0020] Figure 2 Sequencing results of miRNAs in extracellular vesicles of Clonorchis sinensis;

[0021] Figure 2 In the table, (A) the main miRNA species in CsEV; (B) the ranking of the main miRNA content in CsEV.

[0022] Figure 3 Functional and signaling pathway analysis of the top 10 miRNA target genes in CsEV.

[0023] Figure 3In the first part, GO analysis of the top 10 miRNA target genes in AC.CsEV is presented. The three figures represent the three parts: biological process (BP), cellular component (CC), and molecular function (MF). The vertical axis represents the enriched GO term, and the horizontal axis represents -log10 (P-value), indicating the significance of enrichment. The colors from blue to red indicate the number of target genes in that term from low to high. In the second part, KEGG analysis of the top 10 miRNA target genes in D.CsEV is presented. The vertical axis represents the enriched signaling pathway, and the horizontal axis represents the Rich Factor. The larger the Rich Factor, the higher the degree of enrichment. The size of the dot represents the number of target genes in this signaling pathway. The color of the dot corresponds to different P-value ranges. The P-value from low to high indicates the significance of enrichment from high to low.

[0024] Figure 4 The sequence is Csi-miR-190-3p (marked in red as Consensus mature sequence).

[0025] Figure 5 Figure showing the biological function of Csi-miR-190-3p in cholangiocarcinoma cells.

[0026] Figure 6 To ensure the overexpression of Csi-miR-190-3p in RBE cells after transfection, RT-qPCR was used to detect the baseline expression level of Csi-miR-190-3p in RBE cells and the overexpression after transfection with mimics. The Scramble mimic (miR-NC) group served as a negative control. ****P<0.0001.

[0027] Figure 7 To investigate the effect of Csi-miR-190-3p on the longitudinal migration of RBE cells by overexpression, migration and invasion assays were performed to detect the effect of Csi-miR-190-3p on the longitudinal migration of cholangiocarcinoma cells. The miR-NC group served as a negative control. ****P<0.0001.

[0028] Figure 8 To investigate the effect of Csi-miR-190-3p overexpression on the lateral migration ability of RBE cells, a scratch assay was performed to detect the effect of Csi-miR-190-3p on the lateral migration of cholangiocarcinoma cells. The miR-NC group served as a negative control. ***P<0.001.

[0029] Figure 9 Target genes are the intersection of the TargetScan 7.0, miRDB, and miRTarBase databases.

[0030] Figure 10 To validate the target gene of Csi-miR-190-3p, we performed the following experiments: (A) luciferase reporter gene assay; (B) Western blotting assay; (C) q-PCR assay; and (D) schematic diagram of the binding site.

[0031] Figure 11 Csi-miR-190-3p inhibits the longitudinal migration of RBE cells by regulating CXCL5.

[0032] Figure 12 Csi-miR-190-3p inhibits the transverse migration of RBE cells by regulating CXCL5. Detailed Implementation

[0033] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0034] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0035] Example 1: Isolation, purification, identification, and miRNA analysis of extracellular vesicles from Clonorchis sinensis

[0036] 1. Experimental methods:

[0037] 1.1 Collection and culture of adult Clonorchis sinensis

[0038] (1) Domestic cats infected with Clonorchis sinensis were purchased from Guangzhou Experimental Animal Farm. The domestic cats mainly came from the suburbs of Guangzhou and Foshan, including abandoned domestic cats from villagers and stray domestic cats. The domestic cats were anesthetized and their livers were dissected.

[0039] (2) Using the manual finger pressure method, squeeze from the edge of the positive cat liver towards the common bile duct to pick up clusters or single adult worms and place them in a PBS culture dish containing 10% penicillin and antibiotics. Observe the morphological characteristics of adult worms and eggs under a light microscope to confirm that the obtained worms are Clonorchis sinensis. Then collect morphologically intact and viable adult worms.

[0040] (3) Rinse the insects five times with sterile PBS containing 5% double antibiotics.

[0041] (4) Add 2 mL of DMEM medium containing 1% double antibiotics to each well of a 6-well cell culture plate, and transfer 20 to 30 adult Clonorchis sinensis into each well.

[0042] (5) Place the cells in a cell culture incubator at 37°C and 5% CO2, change the medium daily and remove dead worms promptly.

[0043] (6) Collect the supernatant of adult insect culture and store it in a refrigerator at 4°C for later use.

[0044] 1.2 Isolation and purification of extracellular vesicles from Clonorchis sinensis

[0045] Extracellular vesicles of Clonorchis sinensis were isolated and purified using ultracentrifugation. The specific steps are as follows:

[0046] (1) Centrifuge the culture supernatant of the above-obtained Clonorchis sinensis adult at 4℃, 1,500g for 30min, remove the precipitate, and collect the supernatant.

[0047] (2) Centrifuge the supernatant obtained in the previous step at 4℃, 3,500g for 30min to remove the precipitate and collect the supernatant.

[0048] (3) Centrifuge the supernatant obtained in the previous step at 4℃ and 12,000g for 30 min to remove the precipitate and collect the supernatant.

[0049] (4) Centrifuge the supernatant obtained in the previous step at 4℃ and 20,000g for 1h to remove the precipitate, collect the supernatant, and filter the supernatant through a 0.22μm PES filter membrane.

[0050] (5) The supernatant obtained in the previous step is transferred into a thick-walled centrifuge tube for ultracentrifuge. Centrifuge at 4°C and 120,000g for 70 min, remove the supernatant, collect the precipitate, and obtain CsEVs.

[0051] (6) The precipitate obtained in the previous step was resuspended in sterile PBS, centrifuged at 120,000g for 70 min at 4°C to further purify CsEVs. Finally, the supernatant was removed, and the precipitate was resuspended in sterile PBS to obtain the CsEVs suspension. The protein concentration was determined using the BCA method. After aliquoting, the suspension was stored at 4°C for short-term storage and at -80°C for long-term storage.

[0052] 1.3 Identification of extracellular vesicles of Clonorchis sinensis

[0053] (1) Observation of the size and morphology of CsEVs using transmission electron microscopy (TEM): Take 20 μL of fresh CsEVs suspension and drop it onto a copper mesh carbon support film with a pore size of 120 μm. Let it stand at room temperature for 3 min, and then absorb the excess liquid with filter paper. Add 10 μL of 3% phosphotungstic acid staining solution for negative staining for 1-2 min, absorb the excess liquid with filter paper, and after drying at room temperature, place the copper mesh on the sample holder of the TEM and observe and acquire images under the TEM.

[0054] (2) Nanoparticle tracking analysis (NTA) was used to analyze the particle size distribution and concentration of CsEVs: ddH2O was slowly injected into the sample chamber using a 1 mL syringe, and the chamber was zeroed on the nanoparticle tracking analyzer. Then, 10 μL of the CsEV suspension was drawn up and diluted to 1,000 μL with ddH2O at a ratio of 1:100. The diluted sample was uniformly injected into a clean sample chamber and analyzed on the nanoparticle tracking analyzer. This was repeated three times. The vesicle particle size distribution and concentration were analyzed using NTA 3.3 software.

[0055] 1.4 Analysis of extracellular vesicle miRNAs in Chinese bronchioloalveolar blast cells

[0056] (1) miRNA analysis was performed by Guangzhou Chengqi Biotechnology Co., Ltd. After sequencing, the adapters at both ends of the reads were removed using the cutadapt software, and reads with a trimmed length between 18-35 nt were retained. At the same time, reads with an N base ratio exceeding 10% were removed to obtain clean reads for subsequent analysis. Based on the typical hairpin structure of miRNA precursors, miRDeep2 software was used for miRNA prediction. First, the clean reads obtained above were compared with known transcripts of the species to filter out fragments of known RNAs; they were also compared with the Rfam database to filter out other types of RNAs; then the filtered data were compared with mature and raw sequences in the miRBase database to obtain possible homologous miRNAs to assist the prediction work of the miRDeep2 software.

[0057] (2) Quantitative analysis of miRNAs: Bowtie (v1.3.0 parameter: -v0) was used to compare clean data with predicted miRNAs to obtain the expression level of each miRNA. The expression level normalization method adopted was RPM (RPM = readCount * 1,000,000 / libsize, libsize: sum of mapped readCount), which is the number of reads from a certain gene per million reads.

[0058] (3) miRNA target gene analysis: miRanda (v3.3a, parameter -en-10) was used to analyze the target genes of the predicted miRNAs to obtain the possible target genes of the miRNAs.

[0059] (4) GO enrichment analysis of target genes: GOs were divided into three parts: molecular function, biological process, and cellular composition. GO numbers associated with genes or proteins were found through corresponding IDs or sequence annotations. These GO numbers can be mapped to corresponding terms, i.e., functional categories or cellular locations. In this study, this analysis was performed on the target genes of the top 10 miRNAs with the highest detected expression levels. The analysis software was topGO, and the statistical test method was Fisher's Exact Test.

[0060] (5) KEGG Pathway Enrichment Analysis of Target Genes: KEGG Pathway enrichment analysis can be used to identify the main biochemical metabolic pathways and signal transduction pathways involved by target genes. In this study, KEGG Pathway enrichment analysis was performed on the target genes of the predicted top 10 miRNAs. The analysis software was clusterProfiler, and the statistical test method was Hypergeometric Test.

[0061] 2. Experimental Results

[0062] 2.1 Acquisition and sequencing analysis of extracellular vesicles from Clonorchis sinensis

[0063] (1) Collection of extracellular vesicles of Clonorchis sinensis

[0064] To obtain extracellular vesicles of Clonorchis sinensis, adult Clonorchis sinensis worms were first collected from the bile ducts of infected domestic cats. After washing, the worms were cultured in DMEM medium. The culture supernatant was collected, and CsEVs were isolated and purified from the supernatant by ultracentrifugation. Figure 1 A) Morphological identification of CsEVs was performed using negative staining transmission electron microscopy to determine their size and structure. For example... Figure 1As shown in Figure B, the isolated CsEVs exhibit typical saucer-like or round vesicle-like structures, and their morphology, structure, and size are similar to previously reported extracellular vesicles. To further determine the diameter and particle size distribution of the obtained CsEVs, they were identified using a visual nanoparticle analyzer. Figure 1 As shown in Figure C, the peak size of CsEVs is 79 nm, and the diameter range is mainly between 30 and 150 nm. These results confirm that this study successfully extracted extracellular vesicles of *Clonorchis sinensis* from the culture supernatant of adult *Clonorchis sinensis*.

[0065] (2) Sequencing analysis of extracellular vesicles of Clonorchis sinensis

[0066] Total RNA was extracted from the exosomes of Clonorchis sinensis using Trizol. Sequencing data were processed to obtain cleanreads for subsequent analysis. miRNA sequencing analysis was performed using miRDeep2 software. Sequencing results are shown below. Figure 2 As shown in the figure, the ranking of the content of various miRNAs in CsEVs is displayed.

[0067] Simultaneously, GO enrichment analysis was performed on the target genes of the top 10 miRNAs with the highest expression levels detected by sequencing. The analysis software was topGO, and the statistical test method was Fisher's Exact Test. The GO enrichment bar chart effectively demonstrated the distribution of the number of target genes enriched in terms of biological processes, cellular components, and molecular functions. Figure 3 The results show the top 20 GO terms enriched (e.g.) Figure 3 Then, KEGG Pathway enrichment analysis was performed on the target genes of the top 10 miRNAs with the highest expression levels. The analysis software was clusterProfiler, and the statistical test method was Hypergeometric Test. The KEGG enrichment analysis results are presented as a scatter plot. Figure 3 The 20 signaling pathways with the smallest P-values, i.e., the highest enrichment levels, were shown (e.g. Figure 3 D).

[0068] GO analysis showed that the target genes of the top 10 miRNAs in CsEVs were mainly concentrated in cellular components such as the cell membrane and nucleus, participating in molecular functions such as cation binding, metal ion binding, and anion binding, and involved in biological processes such as developmental regulation, cellular component regulation, and cell surface receptor signaling pathways. KEGG signaling pathway analysis showed that the target gene signaling pathways of the top 10 miRNAs in CsEVs were enriched in pathways related to vitamin digestion and absorption, cell adhesion molecules, fatty acid biosynthesis, Wnt signaling, NF-kappa B signaling, TGF-beta signaling, and Notch signaling. Among them, Csi-miR-190-3p plays a dual role of tumor suppression or tumor promotion in different tumors and different stages of tumor development, but its related research in cholangiocarcinoma has not been reported. Therefore, further research will be conducted on it.

[0069] 2.2 Csi-miR-190-3p sequence

[0070] Consensus mature sequence (its structure is as follows) Figure 4 shown):

[0071] 5-agauauguuuggguuacuuggug-3 (SEQ ID NO. 1);

[0072] Mimic (mature sequence used in experiments):

[0073] 5-agauauguuuggguuacuuggug-3 (SEQ ID NO. 2);

[0074] 5-caccaaguaacccaaacauaucu-3 (SEQ ID NO. 3).

[0075] Example 2: Study on the effects of Csi-miR-190-3p on the biological function of cholangiocarcinoma cells

[0076] Research content such as Figure 5 As shown, the details are as follows:

[0077] 1. Experimental Methods

[0078] 1.1 Cell Culture

[0079] (1) Cell resuscitation: The cryovials containing RBE cells (purchased from Shanghai Pito Biotechnology Co., Ltd., catalog number: S002) were removed from the liquid nitrogen container and quickly placed in a 37°C constant temperature water bath. The cells were gently shaken from side to side to thaw rapidly. After sterilizing the outer wall with 75% alcohol, the cells were transferred to a biosafety cabinet. The cell suspension was transferred using a pipette to a 15mL centrifuge tube containing an equal volume of RPMI 1640 complete medium (containing 10% fetal bovine serum and 1% penicillin-dextrose antibiotics). The tubes were gently pipetted to mix and centrifuged at 1000rpm for 5min. The supernatant was discarded, and the cell pellet was resuspended in an appropriate amount of complete medium and seeded into cell culture flasks. The flasks were then incubated at 37°C with 5% CO2. After 24h, the cell adhesion was observed under a microscope, and the medium was replaced with fresh medium.

[0080] The same method was used to culture 293T cells (used only in the luciferase reporter gene experiment), except that the culture medium was replaced with DMEM medium.

[0081] (2) Cell culture medium change: Discard the old culture medium, add an appropriate amount of sterile PBS, gently shake the culture flask, and rinse the cells 2-3 times. After discarding the PBS, add an appropriate amount of fresh RPMI 1640 complete culture medium and place it in an incubator at 37°C and 5% CO2 for continued culture. Generally, change the culture medium every 2-3 days.

[0082] (3) Cell passage: Passage is performed when cells enter the logarithmic growth phase (cell confluence reaches 80%). Discard the old culture medium and wash the cells 2-3 times with PBS. After discarding the old culture medium, add 0.5-1 mL of preheated 0.25% trypsin and incubate in a cell culture incubator for 2 min. When the cells begin to shrink and become rounded under a microscope, and the intercellular spaces widen, immediately add 2 mL of complete culture medium and gently pipette along the flask wall to detach the cells. Collect the cell suspension and centrifuge at 1000 rpm for 5 min. Discard the supernatant, resuspend the cell pellet in complete culture medium, and seed it into new culture flasks at a ratio of 1:2 to 1:5. After adding culture medium, place the flasks in an incubator for culture.

[0083] (4) Cell cryopreservation: Prepare cell cryopreservation solution by mixing DMSO and fetal bovine serum at a ratio of 1:9. Resuspend the cell pellet obtained from the above passage operation in 1 mL of cryopreservation solution, adjust the cell density to 5-7 × 10⁶ cells / mL, transfer the cell suspension to cryovials, seal with sealing film and record the results. Place the cryovials at 4°C for 30 min, then freeze at -20°C for 2 h, and then place them at -80°C overnight. The next day, transfer the cryovials to a liquid nitrogen tank for long-term storage for subsequent experiments.

[0084] 1.2 miRNA transfection

[0085] The Csi-miR-190-3p miRNA mimic was synthesized by Ribobio, and its sequence is as follows:

[0086] 5-agauauguuuggguuacuuggug-3 (SEQ ID NO. 2);

[0087] 5-caccaaguaacccaaacauaucu-3 (SEQ ID NO. 3).

[0088] Once the cells (RBE cells) had proliferated to a certain number and were in the logarithmic growth phase, the cells were divided into a mimics (Csi-miR-190-3p) transfection group and a miR-NC (Scramble-miRNA mimics, synthesized by Ribo Biotech) transfection group. Each group was seeded into a six-well plate with 100,000 cells per well. After 12 hours, the cell confluence in the wells reached 60%–70%. Prepare 2.5 μL of a 20 nmol / L mimics or Scramble-miRNA mimics solution in each well and premix it in 100 μL of Opti-MEM medium. Separately, premix 2 μL of lipofectamine 3000 transfection reagent in 100 μL of Opti-MEM medium. After premixing for 5 minutes, mix the two solutions together to prepare a 200 μL mimics + lipofectamine 3000 mixture in Opti-MEM medium. Gently pipette and mix 5 times. After waiting 20 minutes, add the mixture to the well. Change the medium 6 hours after transfection (if the cells are highly tolerant to lipofectamine 3000, such as RBE cells with a low number of dead cells, then changing the medium is not necessary). Perform the next experiment 24–48 hours after transfection.

[0089] 1.3 Co-transfection of miRNA and plasmid

[0090] (1) The pcDNA3.1-CXCL5 plasmid was constructed by Guangzhou Dahong Biotechnology Co., Ltd. Once the cells had proliferated to a certain number and were in the logarithmic growth phase, they were divided into three groups: a mimics (Csi-miR-190-3p) transfection group, a pcDNA3.1-CXCL5+mimics transfection group, and a miR-NC+pcDNA3.1-NC transfection group. Each group was seeded at 100,000 cells per well in a six-well plate. After 12 hours, the cell confluence in the wells reached 60%–70%.

[0091] (2) The next morning, the miRNA was transfected, and the transfection steps were the same as in 1.2;

[0092] Mix 2.5 μL of mimics or miR-NC (20 nmol / L) with 100 μL of Opti-MEM and let stand for 5 minutes; mix 3 μL of Lipofectamine 3000 with 100 μL of Opti-MEM and let stand for 5 minutes; after 5 minutes, mix the two to form a 200 μL system, gently pipette 5 times to ensure thorough mixing, and then let stand for 20 minutes; add to each well, then add 1800 μL of antibiotic-free 10% FBS medium, and transfect for 6 hours.

[0093] (3) After 6 hours, discard the supernatant in each well and continue to set up the groups in (1). The system for transfecting plasmids in each single well is as follows: 20 ng of plasmid + 100 μL of Opti-MEM are mixed and left to stand for 5 minutes; 2 μL of Lipofectamine 3000 + 100 μL of Opti-MEM are mixed and left to stand for 5 minutes; after 5 minutes, the two are mixed into a system of 200 μL, gently blown 5 times to ensure thorough mixing, and then left to stand for 20 minutes. The mixture is then added to the single wells and replicates of each group, and 1800 μL of 10% FBS medium without antibiotics is added. Transfect until the next day, so that the transfection time reaches at least 24 hours.

[0094] 1.4 Cell migration experiment

[0095] Transfection was performed in groups according to experimental requirements. 24 hours after transfection, 20,000 RBE cells were resuspended in serum-free medium and seeded into the upper chamber of a Transwell chamber. 20 hours later, the chamber was removed from the incubator, the upper chamber was fixed in paraformaldehyde for 20 minutes, then stained with crystal violet for 20 minutes. The chamber was then removed, and the upper chamber surface was wiped clean with a cotton swab to remove any untransmitted cells. The chamber was then air-dried. After drying, images were taken using a fluorescence inverted microscope. Five fields of view were randomly selected (the length scale bars in the lower right corner of the image were all 100 μm), and the cells were photographed, counted, and statistically analyzed.

[0096] 1.5 Cell invasion assay

[0097] Transfection was performed in groups according to experimental requirements. 24 hours after transfection, 50,000 RBE cells were resuspended in serum-free medium and seeded into the upper chamber of a Matrigel invasion chamber. The lower chamber contained 500 μL of medium containing 20% ​​fetal bovine serum. The chambers were then incubated in a CO2 incubator for 24 hours. Cell status was monitored during this period via the Matrigel invasion chamber, and the cell penetration time was extended as needed. In actual experiments, cell penetration was achieved within 24–48 hours, closely related to cell status. After 48 hours, the chambers were removed from the incubator. The upper chamber was fixed in paraformaldehyde for 20 minutes, then stained with crystal violet for 20 minutes. The chambers were then removed, and the upper chamber surface was wiped clean with a cotton swab to remove any unpenetrated cells. The cells were then air-dried and photographed using a fluorescence inverted microscope. Five fields of view were randomly selected (the length scale bars in the lower right corner of the photographs are all 100 μm) for photographing. Cells were counted and statistically analyzed after photographing.

[0098] 1.6 Cell Scratch Test

[0099] Once the cells have grown to the logarithmic growth phase, count them and take 150,000 cells as the number of cells per well for seeding. Seed the cells into the wells of a six-well plate. Then, place the six-well plate in a constant temperature CO2 cell culture incubator and culture for 48 hours. When the confluence reaches about 80% to 90%, transfect the cells according to the experimental requirements. After transfection and culture for 24 hours, the confluence of cells in each well reaches 100%. Using a 200μL pipette tip, 4-5 straight scratches were made in each well of cells that had grown to a certain size. Immediately afterward, 4-5 random areas were photographed on each scratch, and the locations were marked. After the cells migrated for 24 hours, the same locations were photographed again. The scratch shrinkage area was calculated using ImageJ software. The algorithm was to first measure the total area of ​​the scratches at 0 hours, and then recalculate the total area of ​​the scratches after 24 hours. Due to cell migration, the total area of ​​the scratches at 24 hours would be less than the total area of ​​the scratches at 0 hours. The total area at 24 hours was then divided by the total area at 0 hours to obtain a percentage. This ratio was then statistically analyzed to determine whether there was a statistically significant difference between the different groups.

[0100] 1.7 Real-time quantitative PCR (RT-qPCR)

[0101] (1) Total RNA was extracted using the EZ-press RNA Rapid Extraction Kit.

[0102] ① Cell lysis: After transfection, discard the culture medium in the 6-well plate, wash the cells with PBS, add 500 μL of lysis buffer, and pipette the cells about 30 times to fully lyse the cells.

[0103] ②RNA binding: Add an equal volume of anhydrous ethanol to the lysis product, mix thoroughly, and then transfer the liquid from each well to the corresponding spin column. Centrifuge at 4000g for 1 min and discard the liquid from the collection tube (if there is any liquid residue, centrifuge again at 12,000g for 1 min).

[0104] ③DNase treatment: Prepare enzyme solution by adding 10 μL of sterile ddH2O to 2 μL of DNase (gDNA Remover) per sample. Then, take 12 μL of the enzyme solution from each centrifuge column and add it to the membrane in the center of the column. Let it stand at room temperature for 5 min.

[0105] ④RNA washing: Add 500 μL of washing buffer directly to the column from the previous step, centrifuge at 12,000g for 1 min, discard the liquid in the collection tube, and centrifuge the empty column again at 12,000g for 1 min; transfer the column to a 1.5 mL EP tube without RNase, open the cap and let it air dry for 2 min.

[0106] ⑤ RNA elution: Add 20-30 μL of elution buffer to the membrane in the center of the centrifuge column, let stand at room temperature for 2 min, and centrifuge at 12,000g for 1 min; add the liquid obtained from centrifugation back to the centrifuge column, place in a refrigerator at 4℃ for 5 min (to allow the RNA to dissolve fully and increase the yield), centrifuge again at 4℃ at 12,000g for 1 min, discard the centrifuge column, and obtain the RNA solution.

[0107] ⑥ RNA concentration determination: Take 2 μL of RNA and determine the total RNA concentration (OD) using a Nanodrop 2000 micro spectrophotometer. 260 / 280 It should be between 1.90 and 2.30.

[0108] (2) Reverse transcription of mRNA

[0109] Add 1 μg total RNA and 4 μL 5×Evo M-MLV RT Master Mix to a 0.2 mL EP tube on ice, then add RNase-free sterile water to a total volume of 20 μL. Vortex to mix, then briefly centrifuge. Perform reverse transcription on a PCR instrument under the following conditions: 37℃ for 15 min, 85℃ for 5 s, and store at 4℃. After obtaining cDNA, add 80 μL of RNase-free sterile water to prepare the working concentration and store at -20℃.

[0110] (3) Reverse transcription of miRNA

[0111] The experimental procedure was performed according to the instructions of the riboSCRIPT™ Reverse Transcription Kit (catalog number: C11027-2) provided by RiboBio. 1 μg of total RNA and 1 μL Lulge-Loop were added to a 0.2 mL EP tube on ice. TM Mix miRNA RT Primer, 2 μL 5×Reverse Transcription, and 2 μL RTase Mix, then add RNase-free sterile water to a total volume of 10 μL. Vortex to mix, briefly centrifuge, and perform reverse transcription on a PCR instrument under the following conditions: 42℃ for 60 min, 70℃ for 10 min, and store at 4℃. After obtaining cDNA, add 80 μL of RNase-free sterile water to prepare the working concentration and store at -20℃.

[0112] (4) qPCR amplification of mRNA

[0113] ① Prepare a 96-well plate. Using the obtained cDNA as a template, perform qPCR amplification with SYBR Green-I. The detection primers used were synthesized by Shanghai Sangon Biotech. The reaction system is shown in Table 1.

[0114] Table 1 RT-qPCR reaction system

[0115]

[0116] The detection primers are as follows:

[0117] CXCL5:

[0118] F: GCTACCACTTCCACCTTG (SEQ ID NO.4);

[0119] R: CCACTATGAGCCTVVTGT(SEQ ID NO.5);

[0120] GAPDH:

[0121] F: GTCGCCAGCCGAGCCACATC (SEQ ID NO. 6);

[0122] R: CCAGGCGCCCAATACGACCA (SEQ ID NO. 7).

[0123] ② After adding the sample, cover it with a transparent film and centrifuge at 2200 rpm for 1 min.

[0124] ③ For instrumental testing, the qPCR reaction program was set as follows: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 5 s, 60℃ extension for 30 s, for a total of 40 cycles. Melting curves were detected at 95℃ for 15 s and 65℃ for 15 s. Amplification ended after cooling the system at 55℃ for 1 min. GAPDH was used as an internal control. -ΔΔCt Calculations were performed using relative quantitative analysis. The experiment was conducted in triplicate, with three replicates.

[0125] (5) qPCR amplification of miRNA

[0126] ① Prepare a 96-well plate. Using the obtained cDNA as a template, perform qPCR amplification with SYBR Green-I. The detection primers used were synthesized by Ribo Biotech (the primer sequences are the same as those for mRNA qPCR amplification). The reaction system is shown in Table 2.

[0127] Table 2 RT-qPCR reaction system

[0128]

[0129]

[0130] ② After adding the sample, cover it with a transparent film and centrifuge at 2200 rpm for 1 min.

[0131] ③ For instrumental testing, the qPCR reaction program was set as follows: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 2 s, 60℃ extension for 20 s, and 70℃ extension for 10 s; a total of 40 cycles were performed. Melting curves were detected at 95℃ for 15 s and 65℃ for 15 s. Amplification ended after cooling the system at 55℃ for 1 min. U6 was used as an internal control, and 2... -ΔΔCt Calculations were performed using relative quantitative analysis. The experiment was conducted in triplicate, with three replicates.

[0132] 1.8 Western blot

[0133] (1) Total protein extraction

[0134] Prepare protein lysis buffer (RIPA to protease inhibitor volume ratio of 100:1); after transfection, discard the culture medium in the 6-well plate, wash the cells with PBS, add 100 μL of lysis buffer to each well, lyse on ice for 20 min, then scrape off the cells with a cell scraper, transfer the lysis products to a 1.5 mL EP tube, centrifuge at 12,000 g for 15 min at 4 °C, collect the supernatant to obtain the total protein solution.

[0135] (2) Determination of total protein concentration by BCA method

[0136] ① Preparation of BCA working solution: Based on the quantity of standard and sample, prepare the working solution according to the ratio of BCA reagent to CuSO4 reagent = 50:1, and then add 200 μL of BCA working solution to each well of the 96-well plate.

[0137] ② Add 0.5 mg / mL protein standard to the standard wells of a 96-well plate at concentrations of 0, 1, 2, 4, 8, 12, 16, and 20 μL, and then add ddH2O to bring the total volume to 20 μL. This corresponds to standard concentrations of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL, respectively.

[0138] ③ Take 2 μL of the protein sample to be tested and add it to the sample well of the 96-well plate. Make up the volume to 20 μL with ddH2O (10-fold dilution). Set up 3 replicates for each sample.

[0139] ④ Add 200 μL of BCA working solution to each well and incubate at 37°C in the dark for 30 min.

[0140] ⑤ Detect the absorbance value of each well at a wavelength of 562nm using an ELISA reader. Plot a standard curve with the concentration of the protein standard on the x-axis and the absorbance value on the y-axis. Calculate the concentration of the protein sample based on the standard curve and the absorbance value of the sample.

[0141] (3) SDS-PAGE electrophoresis

[0142] ① Prepare 12.5% / 10% / 7.5% PAGE gels according to the instructions of the PAGE gel rapid preparation kit (Yamei). Select the appropriate gel concentration based on the molecular weight of the protein.

[0143] ② Calculate the loading volume of the protein to be tested based on a protein amount of 20-30 μg. Add 4 μL of 5× loading buffer. If the volume is less than 20 μL, make up the difference with RIPA lysis buffer to a loading volume of 20 μL. After mixing, heat in a 100℃ water bath for 5 min to allow the protein to denature fully.

[0144] ③ Assemble the prepared PAGE gel onto the electrophoresis tank, fill it with electrophoresis buffer, and add 4 μL of pre-stained marker and the prepared protein sample to the sample well of the gel in sequence; turn on the power of the electrophoresis apparatus, and set the electrophoresis program to constant voltage 80V, 30 min (the protein sample runs through the upper stacking gel with electrophoresis); 120V, about 60 min (the protein sample runs through the lower separating gel with electrophoresis to the lower edge of the gel).

[0145] (4) Transfer membrane

[0146] ① Soak the electrophoresis gel in transfer buffer, cut the PVDF membrane according to the size of the protein on the gel, soak it in methanol for a few seconds to activate it, and soak it together with filter paper in transfer solution for later use.

[0147] ② Assemble the filter paper, gel, PVDF membrane, and filter paper into a "sandwich" structure in the order from negative electrode to positive electrode. Keep the filter paper moist during the process and avoid air bubbles between the gel and PVDF membrane.

[0148] ③ Place the assembled “sandwich” structure into the electrophoresis tank, add freshly prepared transfer buffer, place on ice to start the transfer, and set the transfer program to constant current 250mA for 150min.

[0149] (5) Closed

[0150] After the transfer was completed, the PVDF membrane was carefully separated from the gel and rinsed three times with 1×TBST for 3-5 minutes each time. 50 mL of 5% skim milk powder was prepared with 1×TBST solution as the blocking solution. The PVDF membrane was immersed in the 5% skim milk powder and placed on a shaker at room temperature for 1-2 hours.

[0151] (6) Primary antibody hybridization

[0152] After blocking, the PVDF membrane was rinsed three times with 1×TBST for 3-5 minutes each time. According to the molecular weight of the protein marked by the marker, the region containing the protein to be tested was cut into an appropriate size, the corresponding primary antibody was added (Table 3), and the membrane was incubated overnight at 4°C on a shaker.

[0153] Table 3 Western blot of primary antibody

[0154]

[0155] (7) Secondary antibody hybridization

[0156] The primary antibody was recovered the following day and stored at -20°C. The PVDF membrane was rapidly washed three times with 1×TBST for 10 min each time on a shaker at room temperature. After removing the TBST, the corresponding secondary antibody (rabbit secondary antibody, diluted to the appropriate working concentration according to the antibody instructions) was added and incubated on a shaker at room temperature for 1–2 h.

[0157] (8) Chemiluminescence

[0158] The secondary antibody was recovered and stored at -20°C. The PVDF membrane was rapidly washed three times with 1×TBST for 10 min each time on a shaker at room temperature. Excess liquid on the membrane was blotted off with filter paper, and an appropriate amount of ECL luminescence solution was added (to evenly cover the entire membrane). The membrane was then developed and images were acquired in a chemiluminescence analyzer. The grayscale values ​​of the protein bands were analyzed using ImageJ, with GAPDH as an internal control, to calculate the relative expression level of the target protein.

[0159] 1.9 Luciferase Reporter Gene Assay

[0160] (1) Construction of dual-luciferin reporter vector

[0161] Target gene analysis of Csi-miR-190-3p was performed using TargetScan 7.0, miRDB, and miRTarBase software to identify potential target genes. Based on the TargetScan analysis results, the target gene and its random mutation were searched near the target site in the CXCL5-3′UTR gene sequence. The following sequence was synthesized by Qingke Biotechnology using pmirGLO as the vector, with Amp+ resistance and NheI-XhoI restriction enzyme sites.

[0162] pmirGLO CXCL5 3'UTR-WT:

[0163] GCTAGCaacctaggtaattaatggttgtgaatttctatttttgctttgtttttaatgaacatttgtctttcagaataggattctgtgataatatttaaatggca aaaacaaaacataattttgtgcaattaacaaagctactgcaagaaaaataaaacatttcttggtaaaaacgtatgtatttatatattatatttatatataat atatattatatatttagcattgctgagctttttagatgcctattgtgtatcttttaaaggttttgaccattttgttatgagtaattacatatatattacattca ctatattaaaattgtacttttttactatgtgtctcattggttcatagtctttattttgtcctttgaataaacattaaaagatttctaaacttcaCTCGAG(SEQ ID NO.8, the first and last capital letters are the restriction sites).

[0164] pmirGLO CXCL5 3'UTR-MUT:

[0165] GCTAGCaacctaggtaattaatggttgtgaatttctatttttgctttgtttttaatgaacatttgtctttcagaataggattctgtgataatatttaaatggca aaaacaaaacataattttgtgcaattaacaaagctactgcaagaaaaataaaacatttcttggtaaaaacgtatgtatttatatattatatttatatataat atatattatatatttagcattgctgagctttttagatgcctattgtgtatcttttaaaggttttgaccattttgTTATCTAGAATTACAGATACATTAcattca ctatattaaaattgtacttttttactatgtgtctcattggttcatagtctttattttgtcctttgaataaacattaaaagatttctaaacttcaCTCGAG(SEQ ID NO.9, the first and last capital letters are the restriction enzyme sites, and the middle capital letters are the mutation sequences.

[0166] (2) Cell transfection

[0167] The experiment used 293T cells. Before the experiment, the cell growth status needed to be observed (log phase is most suitable). The cells required for the experiment were removed from the incubator and then transfected with plasmids. The specific transfection method was the same as in step 1.3. The transfection groups were: pmirGLO-CXCL5 3'UTR-WT (wild type) and pmirGLO-CXCL5 3'UTR-MT (mutant).

[0168] (3) Dual-luciferase activity detection

[0169] 48 hours after transfection, 293T cells were harvested, gently washed with PBS, and then 100 μL of cell lysis buffer (used in the luciferase reporter system) was added. After complete lysis on ice for 30 min, the cell lysis buffer was added to centrifuge tubes at room temperature and centrifuged at 12,000 rpm for 5 min to remove excess cells for further detection. Then, 20 μL of each sample was added to 96-well white plates, with three replicates per sample. The fluorescence detection was turned on according to the instrument instructions. 100 μL of thawed firefly luciferase assay reagent was added to the 96-well plate and slowly mixed using a pipette. This step must be done in the dark. After incubation at room temperature for 5 min, the ELISA reader was turned on for luminescence detection, and the fluorescence value (FLU) was recorded. Simultaneously, 100 μL of René luciferase assay solution was added to the 96-well plate, slowly pipetted, and thoroughly mixed. The plate was incubated at room temperature for 5 min. When the emission signal stabilized, the ELISA reader was used for luminescence detection, and the fluorescence value (RLU) was recorded.

[0170] (4) Data Analysis

[0171] Calculate the luminescence ratio of firefly luciferase and renal luciferase. Using renal luciferase as an internal control, divide the FLU value measured by firefly luciferase by the RLU value measured by renal luciferase. Detection ratio = firefly luciferase detection value / renal luciferase detection value.

[0172] 1.10 Statistical Analysis

[0173] All data were statistically analyzed using GraphPad Prism 8.0. All results were based on three independent experiments, and quantitative results are expressed as mean ± standard deviation (Mean ± SD). Unpaired t-tests were used to compare differences between two groups, and one-way ANOVA was used to compare differences among multiple groups. P < 0.05 was considered statistically significant.

[0174] 2. Experimental results

[0175] 2.1. Csi-miR-190-3p inhibits RBE cell migration and invasion in vitro.

[0176] (1) RT-qPCR detection of Csi-miR-190-3p expression in RBE cells transfected with mimic

[0177] First, the baseline expression level of Csi-miR-190-3p in RBE cells and the overexpression level after transfection with mimics were detected by RT-qPCR. Figure 6 The expression level in the overexpression group was significantly increased, indicating successful transfection.

[0178] (2) Migration and invasion experiments

[0179] To investigate whether Csi-miR-190-3p affects the invasive ability of RBE cells, this study used a Matrigel invasion chamber assay for detection and quantitative analysis of the results. First, RBE cells were transfected and overexpressed with Csi-miR-190-3p and Scramble-miRNA mimics. Twenty-four hours after transfection, cells were seeded into Transwell and Matrigel Transwell chambers. Different concentrations of fetal bovine serum (FBS) were injected into the upper and lower chambers (the upper chamber contained FBS-free cell culture medium, and the lower chamber contained 20% FBS cell culture medium). Then, migration and invasion chamber assays were performed. The results showed that… Figure 7 The number of cells that crossed the chamber within 24 hours in the overexpression group was significantly lower than that in the NC group, suggesting that Csi-miR-190-3p inhibits the longitudinal migration of RBE cells in vitro.

[0180] (3) Scratch test

[0181] Cell scratch assay results showed that the migration rate of cells in the overexpression group decreased after 24 hours, suggesting that Csi-miR-190-3p inhibited the lateral migration of RBE cells in vitro. After overexpressing Csi-miR-190-3p mimics and Scramble-miRNA mimics in confluent six-well plates of RBE cells, several uniformly sized scratches were made in each well of the plate using a 200 μL pipette tip. Images were taken at fixed locations, and then again after 24 hours to measure the distance of cell migration. The results showed ( Figure 8 The 24-hour migration rate of cells in the overexpression group decreased, and the difference between the two groups was statistically significant (P<0.001), indicating that overexpression of miR-490-5p inhibited the lateral migration ability of RBE cells.

[0182] 2.2 Prediction and Validation of Csi-miR-190-3p Target Genes

[0183] (1) Csi-miR-190-3p target gene prediction

[0184] Target gene analysis of Csi-miR-190-3p was performed using three software programs: TargetScan 7.0, miRDB, and miRTarBase. This identified 420 potential target genes for Csi-miR-190-3p, including HIATL2, MLLT10, CXCL5, RP11-322L20.1, and CREBZF. Figure 9Among them, CXCL5 ranked among the top three in predictive scores and has been shown to play a role in various tumors. Furthermore, the expression of this gene decreased after transfection with mimic in the qPCR preliminary experiment; therefore, CXCL5 was chosen for this study.

[0185] (2) Validation of Csi-miR-190-3p target genes

[0186] The results of the luciferase reporter gene experiment showed that ( Figure 10 The luciferase activity of cells transfected with the mutant plasmid showed no statistically significant difference between the Csi-miR-190-3p and NC groups, while in the wild-type group, the luciferase activity in the Csi-miR-190-3p group was lower than that in the NC group (P < 0.005). Western blotting analysis of CXCL5 protein expression after transfection showed a decrease in protein expression in the Csi-miR-190-3p overexpression group. q-PCR experiments also showed a decrease in CXCL5 expression in the overexpression group (****P < 0.0001). These results indicate that CXCL5 is a target gene of Csi-miR-190-3p.

[0187] 2.3. Csi-miR-190-3p inhibits the migration of RBE cells by regulating CXCL5.

[0188] (1) Migration and invasion experiment

[0189] Migration and invasion experiments show that ( Figure 11 Overexpression of CXCL5 alleviated the inhibitory effect of Csi-miR-190-3p on the longitudinal migration ability of RBE cells.

[0190] (2) Scratch test

[0191] Scratch test shows that ( Figure 12 Overexpression of CXCL5 alleviated the inhibitory effect of Csi-miR-190-3p on the lateral migration ability of RBE cells.

[0192] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. The application of a reagent for overexpressing microRNA derived from extracellular vesicles of Clonorchis sinensis in RBE cells in the preparation of drugs against Clonorchis sinensis-induced cholangiocarcinoma, characterized in that, The Consensus mature sequence of the microRNA is shown in SEQ ID NO.1, and the Mimic sequence is shown in SEQ ID NO.2 and SEQ ID NO.3; the reagent for overexpressing the microRNA derived from the extracellular vesicles of Clonorchis sinensis in RBE cells includes the Mimic sequence.

2. The application according to claim 1, characterized in that, The drug mentioned for treating cholangiocarcinoma caused by Clonorchis sinensis is a drug that inhibits the migration of RBE cells.

3. The application according to claim 2, characterized in that, The drug for treating cholangiocarcinoma caused by Clonorchis sinensis is a drug that inhibits the longitudinal and / or transverse migration of RBE cells.

4. The application according to claim 1, characterized in that, The reagents used to overexpress microRNA derived from extracellular vesicles of Clonorchis sinensis in RBE cells include the Mimic sequences shown in SEQ ID NO.2 and SEQ ID NO.3 and liposome transfection reagents.

5. The application according to claim 1, characterized in that, The drug also includes a pharmaceutically acceptable carrier.

6. The application according to claim 1, characterized in that, The dosage forms of the drug include tablets, capsules, powders, granules, and liquids.

Citation Information

Patent Citations

  • Paragonimus westermani adult miRNA (micro ribonucleic acid) and application thereof

    CN102888405A

  • Diagnosis and treatment of cancers with microRNA located in or near cancer associated chromosomal features

    US20060105360A1