Application of dihydroxyacid dehydratase AcDHAD in improving disease resistance of kiwifruit

Abstract

The present invention belongs to the field of genetic engineering technology, and relates to the application of dihydroxy acid dehydratase AcDHAD in improving the disease resistance of kiwifruit. The present invention discloses that the present invention has excavated and functionally verified the dihydroxy acid dehydratase AcDHAD gene and the dihydroxy acid dehydratase AcDHAD protein encoded by the present invention, and confirmed the broad-spectrum disease resistance potential of dihydroxy acid dehydratase AcDHAD in kiwifruit disease resistance breeding. The present invention provides more gene resources for the molecular breeding of disease-resistant kiwifruit varieties, and further provides more insights and ideas for the disease resistance breeding of kiwifruit and the development of molecular markers.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to the application of dihydroxy acid dehydratase AcDHAD in improving the disease resistance of kiwifruit. Background Art

[0002] kiwi( Actinidia spp.) is one of the main fruits consumed because of its rich nutritional value, especially high content of vitamin C, minerals and antioxidants. With the large-scale planting of kiwifruit industry, kiwifruit is facing the threat of many diseases. Pseudomonas syringae pv . actinidiae, Psa ) can harm multiple parts of the tree, such as trunks, branches, tender shoots, leaves, and flowers, and infect a variety of crops such as peaches, soybeans, broad beans, tomatoes, konjac, potatoes, and onions. The disease develops rapidly, kills trees quickly, causes serious damage, and has a high rate of orchard reconstruction, high losses, and is extremely difficult to prevent and control. At present, the prevention and control measures for canker disease mainly rely on agricultural management methods, chemical control, and the cultivation of a few disease-resistant varieties. However, although chemical control is effective in the short term, it is easy to cause environmental pollution and may lead to the emergence of drug-resistant strains; on the other hand, the cultivation of disease-resistant varieties is slow, and the genetic evolution of pathogens is rapid. The number of existing disease-resistant varieties is limited and far from meeting production needs. Therefore, how to mine and utilize disease-resistant gene resources through genomics to cultivate highly disease-resistant kiwifruit varieties has become an urgent need for current industrial development.

[0003] Dihydroxy-acid dehydratase (DHAD) is a key enzyme in the biosynthesis pathway of branched-chain amino acids (such as leucine, isoleucine and valine). It is responsible for catalyzing the dehydration reaction of dihydroxy acids to generate intermediates of branched-chain amino acids. Branched-chain amino acids are not only an important component of protein synthesis in plants, but also play an important role in stress resistance and signal transduction. Studies have shown that DHAD can enhance the stress resistance of plants by regulating branched-chain amino acid metabolism in some plants. In addition, DHAD has also been developed as a target for herbicides. By inhibiting its activity, the normal metabolism of plants can be blocked and the growth of weeds can be inhibited. However, the disease resistance function of DHAD in plants, especially kiwifruit, has not been studied in depth. Summary of the invention

[0004] This study systematically studied the AcDHAD gene in kiwifruit by means of gene cloning, expression vector construction, phylogenetic analysis, subcellular localization, transient overexpression and transient silencing. The purpose of the present invention is to provide the application of dihydroxy acid dehydratase AcDHAD in improving the disease resistance of kiwifruit, aiming to enrich the knowledge of those skilled in the art on the improvement of kiwifruit immune response by dihydroxy acid dehydratase AcDHAD, and provide a theoretical basis and gene selection for the breeding and creation of excellent disease-resistant germplasm materials.

[0005] On the one hand, the present invention relates to the use of dihydroxy acid dehydratase AcDHAD gene in improving the disease resistance of kiwi fruit, which comprises: overexpressing the dihydroxy acid dehydratase AcDHAD gene to improve the resistance of kiwi fruit to kiwi fruit bacterial canker;

[0006] The dihydroxy-acid dehydratase AcDHAD gene comprises a nucleotide sequence encoding a dihydroxy-acid dehydratase AcDHAD protein, and the amino acid sequence of the dihydroxy-acid dehydratase AcDHAD protein is shown in SEQ ID NO:1.

[0007] SEQ ID NO: 1 is specifically as follows,

[0008] .

[0009] Furthermore, in the application provided by the present invention, the nucleotide sequence of the dihydroxyacid dehydratase AcDHAD gene is as shown in SEQ ID NO:2.

[0010] SEQ ID NO: 2 is specifically as follows,

[0011]

[0012] Furthermore, in the application provided by the present invention, the kiwifruit bacterial canker is caused by Pseudomonas syringae pv. kiwifruit.

[0013] Furthermore, in the application provided by the present invention, silencing the dihydroxyacid dehydratase AcDHAD gene reduces the resistance of kiwifruit to kiwifruit bacterial canker.

[0014] Furthermore, in the application provided by the present invention, the nucleotide sequence of the specific sequence for silencing the dihydroxyacid dehydratase AcDHAD gene is shown in SEQ ID NO:3.

[0015] SEQ ID NO: 3 is specifically as follows,

[0016] AGTGACGCCATTTCTATGGGGACTAGAGGTATGTGTTTTAGTTTGCAATCTAGGGATTTGATTGCTGACAGTATTGAGACTGTCATGGCTGCTCAGTGGTATGACGGCAATATCTCTATCCCTGGTTGTGACAAGAATATGCCAGGTACA ATAATGGCCATGGGACGGCTTAATCGGCCAAGTATTATGGTTTATGGTGGAACTATCAAGCCTGGTCATTTTCAAGGCCATATCTACGACATAATTTCTGCTTTTCAGGTTTATGGGGAATACGTGAGTGGTTCCATAAGTGATGAACAT.

[0017] On the other hand, the present invention relates to the use of dihydroxy acid dehydratase AcDHAD gene in comparing the resistance of kiwifruit to kiwifruit bacterial canker, which comprises: obtaining the expression levels of multiple kiwifruits at different stages when infected by Pseudomonas syringae pv. kiwifruit, wherein the kiwifruit varieties of disease-resistant materials are higher than those of disease-susceptible materials;

[0018] The dihydroxy-acid dehydratase AcDHAD gene comprises a nucleotide sequence encoding a dihydroxy-acid dehydratase AcDHAD protein, and the amino acid sequence of the dihydroxy-acid dehydratase AcDHAD protein is shown in SEQ ID NO:1.

[0019] Furthermore, in the application provided by the present invention, the nucleotide sequence of the dihydroxyacid dehydratase AcDHAD gene is as shown in SEQ ID NO:2.

[0020] Those skilled in the art can easily mutate the nucleotide sequence encoding the dihydroxyacid dehydratase AcDHAD protein of the present invention using known methods, such as directed evolution and point mutation. Pst9653 As long as the nucleotide sequences of the present invention have 75% or higher identity, they are derived from the nucleotide sequences of the present invention and are equivalent to the sequences of the present invention as long as they encode dihydroxyacid dehydratase AcDHAD protein and have the same function.

[0021] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID NO: 1. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0022] The above-mentioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0023] A person skilled in the art can easily obtain a product for overexpressing the dihydroxy-acid dehydratase AcDHAD gene by using a known method, such as a dihydroxy-acid dehydratase AcDHAD gene expression cassette. The expression cassette containing a nucleic acid molecule encoding the dihydroxy-acid dehydratase AcDHAD protein (dihydroxy-acid dehydratase AcDHAD gene expression cassette) refers to a DNA capable of expressing the dihydroxy-acid dehydratase AcDHAD protein in a host cell. The DNA may include not only a promoter for initiating transcription of the dihydroxy-acid dehydratase AcDHAD gene, but also a terminator for terminating transcription of the dihydroxy-acid dehydratase AcDHAD gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator.

[0024] Available expression vector construction contains the recombinant vector of the dihydroxy acid dehydratase AcDHAD gene expression cassette. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1305, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company), etc. The plant expression vector can also contain the 3' end non-translated region of the foreign gene, i.e., contain polyadenylic acid signal and any other DNA fragments that participate in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene Nos) and the plant gene (such as the soybean storage protein gene) all have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are wide, and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methotrexate, EPSPS gene that confers resistance to glyphosate), or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0025] The above-mentioned vector or expression vector can be a plasmid, cosmid, phage or virus vector.

[0026] The microorganisms may be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0027] The above transgenic plant cell lines do not include propagation materials.

[0028] The above disease resistance is resistance to kiwi fruit bacterial canker.

[0029] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0030] The present invention provides a technical solution for improving the disease resistance of kiwifruit by using dihydroxy acid dehydratase AcDHAD. First, RNA is extracted from kiwifruit and a cDNA library is constructed to obtain the full-length sequence of the dihydroxy acid dehydratase AcDHAD gene, and sequence analysis and phylogenetic classification are performed. To further clarify its function, the subcellular localization of the gene is observed by GFP tag positioning. Subsequently, an overexpression and silencing plant expression vector containing the dihydroxy acid dehydratase AcDHAD gene is constructed, and the vector is transformed into kiwifruit leaves using an Agrobacterium-mediated transient expression system to achieve transient overexpression and silencing of the gene, and the vector is used to express the gene in the leaves of the kiwifruit. Psa The inoculation experiment compared the lesion size and pathogen biomass of different treatment groups to verify the significant effect of the dihydroxyacid dehydratase AcDHAD gene on the disease resistance of kiwifruit. At the same time, the expression level of the dihydroxyacid dehydratase AcDHAD gene was quantitatively analyzed in kiwifruit varieties with different disease resistance backgrounds, as well as the effect of overexpressing the dihydroxyacid dehydratase AcDHAD gene on immune genes, to further explore its association with disease resistance traits. Ultimately, the technical solution of the present invention provides a new molecular tool for kiwifruit disease-resistant breeding, confirms the application potential of dihydroxyacid dehydratase AcDHAD in disease-resistant breeding, and provides important gene resources for green planting and disease resistance improvement of kiwifruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 This is a diagram of the structural domain analysis of the dihydroxyacid dehydratase AcDHAD protein.

[0033] Figure 2 This is a phylogenetic analysis of homologous genes of dihydroxyacid dehydratase AcDHAD gene in different species.

[0034] Figure 3 This is the subcellular localization map of dihydroxyacid dehydratase AcDHAD protein in tobacco leaves.

[0035] Figure 4 This is the gel electrophoresis detection gel image of dihydroxyacid dehydratase AcDHAD gene cloning.

[0036] Figure 5This is a diagram to verify the disease resistance function of transiently overexpressing the dihydroxy acid dehydratase AcDHAD gene in kiwifruit. Psa The disease phenotype of infected leaf discs; B is the detection of gene expression efficiency; C is the statistics of leaf disc lesion area; D is Psa Biomass statistics; E is conductivity statistics.

[0037] Figure 6 This is a diagram to verify the disease resistance function of transiently silencing the dihydroxyacid dehydratase AcDHAD gene in kiwifruit. Psa The disease phenotype of infected leaf discs; B is the detection of gene expression efficiency; C is the statistics of leaf disc lesion area; D is Psa Biomass statistics; E is conductivity statistics.

[0038] Figure 7 This is the expression analysis diagram of kiwifruit immune-related genes after overexpression of dihydroxyacid dehydratase AcDHAD gene.

[0039] Figure 8 for Psa Dynamic expression pattern of dihydroxyacid dehydratase AcDHAD gene after infection of different kiwifruit varieties. DETAILED DESCRIPTION

[0040] The technical scheme of the present invention is described below in conjunction with the examples, but the present invention is not limited to the following examples. The experimental methods and detection methods described in each example are conventional methods unless otherwise specified; the reagents and materials are available on the market unless otherwise specified, and the % in the following examples are all mass percentages unless otherwise specified.

[0041] The following table shows the primer information involved in the present invention.

[0042]

[0043] Example 1

[0044] This example provides bioinformatics analysis and vector construction of dihydroxyacid dehydratase AcDHAD.

[0045] The gene coding region sequence was obtained from the kiwifruit genome V3.0 database of the kiwifruit genome website (http: / / kiwifruitgenome.org / ), with a total length of 1863 bp, encoding 620 amino acids (as shown in SEQ ID NO: 1). The SMART database and other predictions found that the gene was located on chromosome 1 of kiwifruit, had a typical DHAD_IlvD / Edd domain, was a dihydroxy acid dehydratase, and played an important role in the branched-chain amino acid (BCAA) biosynthesis pathway ( Figure 1 ).

[0046] The Phytozome (https: / / phytozome.jgi.doe.gov / ) database was used to compare the homologous genes of this gene in different species such as kiwifruit, camellia, okra, wolfberry, pepper, tomato, sesame, etc. MEGAX was used to construct an evolutionary tree based on the Neighbor-Joining method ( Figure 2 ), and found that the gene is highly conserved in plants and has the closest evolutionary relationship with Camellia except kiwifruit, indicating that the gene may have potential broad-spectrum application value. The target gene was cloned and constructed into an expression vector (pCAMBIA1302-GFP) fused with a GFP tag, and transiently overexpressed in tobacco leaves for subcellular localization. It was found that the gene was mainly localized in the nucleus ( Figure 3 ).

[0047] (1) Target gene cloning

[0048] RNA was extracted from the leaves of 'Hongyang' kiwifruit using an RNA kit (Beijing Huayueyang Biotechnology Co., Ltd., catalog number: 0416-50); cDNA was obtained using a reverse transcription kit (Thermo Fisher Scientific, catalog number: K1162). Full-length primers for the CDS region (as shown in SEQ ID NO: 2) were designed using Primer plus 3.0 software, and PCR amplification was performed using cDNA as a template. The target fragment PCR amplification reaction system was: 2×Phanta Flash Master Mix (Dye Plus) 25 μL, AcDHAD -F (10 μM) 2 μL, AcDHAD -R (10μM) 2 μL, cNDA 4 μL, ddH2O 17 μL. The PCR reaction program was: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, 35 cycles, 72℃ extension for 5 min. The amplified PCR product was identified by 1% gel electrophoresis. The electrophoresis results are shown in Figure 4 The positive target band was purified by gel recovery (Magen gel recovery kit HiPure Gel Pure DNA Mini Kit), and the sequencing results of the recovered product were consistent with the genome coding region sequence.

[0049] (2) Construction of recombinant vectors for overexpression and silencing

[0050] Upstream and downstream primers were designed for the overexpressed gene fragment and Spe I and Nco I restriction sites were added. The amplification primers were 1302-AcDHAD-F and 1302-AcDHAD-R. The PCR amplification reaction system of the target fragment was the same as the PCR reaction procedure, and gel recovery was performed.

[0051] Upstream and downstream primers were designed for the VIGS silenced gene fragment and BamHI and EcoRI restriction sites were added. The amplification primers were TRV2-AcDHAD-F and TRV2-AcDHAD-R. The target fragment PCR amplification reaction system was the same as the PCR reaction procedure, and gel recovery was performed to obtain the silenced specific sequence (as shown in SEQ ID NO: 3).

[0052] (3) Construction and transformation of fusion expression vector

[0053] The pCAMBIA1302-GFP and pTRV2-GFP empty vectors were digested with TaKaRa restriction endonucleases (QuickCut™ Spe I, QuickCut™ Nco I, QuickCut™ EcoR I, QuickCut™ BamH I), respectively. The digestion reaction system was: 1 ug of vector plasmid, 1 μL of each endonuclease, 2 μL of 10X QuickCut Buffer, and ddH2O supplemented to 20 μL; the PCR reaction program was: incubation at 37°C for 30 min, and termination of the reaction at 85°C for 10 min. Further, the linearized plasmid and the gel-recovered fragment product were ligated under the action of C112 (Nanjing Novogene Biotechnology Co., Ltd., catalog number: C112) ligase (for specific operations, see the instructions). The ligated plasmid was then rapidly transformed into Escherichia coli competent Trelief ®5α by heat shock method. The transformation method was referred to the instructions for use of Trelief ®5α Chemically Competent Cell of Beijing Qingke Biotechnology Co., Ltd. The transformed E. coli was coated with LB solid medium containing 50 μg / mL Kana resistance, inverted and cultured at 37°C for 12 hours, and single clones were picked for colony PCR detection. The primers for silencing detection were TRV2-F and TRV2-R, and the primers for overexpression detection were 1302-F and 1302-R. The colony PCR amplification reaction system and procedure were the same as the gene cloning step. The successfully transformed positive single clones were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing comparison. The correct single clones were picked and inoculated into 5mL LB culture medium with kanamycin (50μg / mL), shaken at 37°C and 200rpm for 14-16 hours, and the plasmids in E. coli were extracted using a plasmid extraction kit (Beijing Zhuangmeng International Biogene Technology Co., Ltd., Miniquick Purification Kit). The recombinant plasmid was transformed into Agrobacterium GV3101 (Shanghai Weidi Biotechnology Co., Ltd., GV3101 (pSoup) Chemically Competent Cell). The cells were placed in a 28°C incubator and cultured in the dark for 48 hours before picking out single clones for colony PCR detection. The detection primers were TRV2-F, TRV2-R, 1302-F, and 1302-R. Successful single colonies were placed in LB culture medium containing kanamycin (50 μg / mL) and rifampicin (50 μg / mL) at 28°C and 220 rpm, cultured to the conditions required for the experiment, and stored for later use.

[0054] Example 2

[0055] The transient overexpression and silencing provided in this example verify the disease resistance function of the dihydroxyacid dehydratase AcDHAD gene.

[0056] 1. Transient overexpression and silencing:

[0057] (1) Preparation of Agrobacterium infection solution: Take 200 μL of frozen Agrobacterium carrying the target gene and add it to 20 mL of LB liquid culture medium containing 100 mg / L rifampicin and 50 mg / L kanamycin. Cultivate at 28°C and 220 r / min until the bacterial solution turns orange-red (14-16 h). Centrifuge at 5000 r / min at room temperature for 5 min to collect the cells. Wash three times with 0.1 mM MgCl2 buffer, collect the cells by centrifugation again, and finally resuspend with Agrobacterium infection solution MMA (0.2 mM, acetosyringone, 10 mM MgCl2, 10 mM MES) to adjust the infection solution concentration to OD 600 =0.5, and place at room temperature away from light for 3-5 h.

[0058] (2) Leaf treatment: Place the disinfected Hongyang (transient overexpression) and Ruanzao (transient silencing) kiwifruit leaves on sterile filter paper, absorb the moisture, and use a sterile hole puncher with a pore size of 11 mm to punch leaf discs. When punching leaf discs, be careful to avoid the main veins and lateral veins of the leaves.

[0059] (3) Vacuum infiltration transient expression: Place the leaf disc in the Agrobacterium infection solution MMA and use a vacuum freeze dryer to perform vacuum infiltration on the leaf disc (25°C, 0.1 MPa, 1 min, repeated 3 times). After wiping off the moisture on the surface of the leaf disc, place it on a 0.7% water agar culture dish and culture it in a 25°C constant temperature incubator. After 2 days, qRT-PCR quantitatively detects the expression of the target gene in the overexpressed leaf disc. Once it is confirmed that the target gene has reached the overexpression condition, proceed to the next step.

[0060] (4) Psa infection: Pick a single colony of M228-GFP prepared in advance and inoculate it into LB liquid culture medium. Cultivate it at 28°C and 220 rpm for 12-16 h. Centrifuge the resulting bacterial solution at 8000 rpm for 10 min to enrich the bacteria. Wash the bacteria with sterile water three times and mix them by pipetting. Use a spectrophotometer to measure the concentration of the bacterial suspension. Adjust the concentration of the bacterial suspension to OD 600 = 0.1, collect the cells and dilute to a final concentration of 1 × 10 5 cfu / ml. The vacuum infiltration method was also used to Psa Infect the kiwifruit leaves. Place in a 16℃ incubator for about 5 days, take photos to observe the infection of the pathogen and count the area of ​​lesions.

[0061] 2. Verification and analysis of disease resistance function:

[0062] (1) Statistics of diseased areas

[0063] ImageJ software was used to calculate the lesion area of ​​leaf disks (https: / / imagej.nih.gov / ij / ), Excel was used for statistical analysis, and GraphPad Prism 8.02 software was used for graphing.

[0064] The results showed that transient overexpression AcDHAD Compared with the control (OE is transient overexpression, EV is empty load control), the leaf disc after expression significantly improved the resistance to pathogens ( Figure 5 The average diseased area of ​​leaf disks was also significantly lower than that of the control group ( Figure 5 C in the figure). At the same time, there is a momentary silence AcDHAD The disease resistance of the leaf disc after VIGS was significantly reduced compared with the control group (VIGS is transient silencing, TRV is the vector used for silencing, and EV is the empty control) Figure 6 The average diseased area of ​​leaf disks was significantly higher than that of the control group ( Figure 6 C in.

[0065] (2) Overexpression and silencing efficiency detection

[0066] Total RNA was extracted from kiwifruit leaves infected with pTRV1:pTRV2-GFP (v / v=1:1), pTRV1:pTRV2- AcDHAD (v / v=1:1), pCAMBIA1302-GFP, and pCAMBIA1302-AcDHAD, respectively. The cDNA obtained by reverse transcription was used as a template. Three biological replicates and three experimental replicates were taken for each treatment. Actin was used as an internal reference gene. RT-PCR was used to quantify the expression of AcDHAD The gene expression level was detected.

[0067] The results showed that transient overexpression AcDHAD The gene was 11.09 times that of the control ( Figure 5 B), the gene expression after transient silencing is 0.18 times that of the control ( Figure 6 B in the figure).

[0068] (3) Biomass statistics

[0069] Weigh 0.2 g for surface disinfection, grind the leaf disc in a mortar, add 1 mL of PBS buffer for homogenization, aspirate the homogenate and centrifuge at high speed (12000 r / min) for 5 min, then take the supernatant, spread it on an LB plate containing 100 mg / L kanamycin after equal gradient dilution, and count and statistically analyze after 2 days.

[0070] The results showed that transient overexpression Psa The biomass of living organisms was significantly reduced ( Figure 5 D in the figure), which increased significantly after transient silencing ( Figure 6 D in.

[0071] (4) Conductivity measurement

[0072] The macaque leaf discs to be tested were washed with deionized water several times, and then the surface moisture was dried. Three leaf discs were collected in each group, for a total of five groups. Samples were taken at 0 h, 6 h, 12 h, and 24 h after the macaque leaf discs were inoculated with Psa. The collected samples were then vacuum treated for 10 min until the leaf discs sank to the bottom of the test tube after being put into the air. The treated leaf discs were left to stand for 20 min, stirred at room temperature and the conductivity K1 was measured, then placed in a boiling water bath at 100 ° C and boiled for 15 min, the samples were taken out and cooled to room temperature, and the conductivity K2 was measured again and calculated.

[0073] The results showed that the conductivity of the leaf discs showing disease resistance after transient overexpression was significantly lower than that of the control ( Figure 5 E in the figure indicates that the leaf disks with severe disease are more damaged and have higher ion leakage, so the conductivity is high. The conductivity of the leaf disks that are more susceptible to disease after instantaneous silence is significantly higher ( Figure 6 E in.

[0074] 3. Related gene verification:

[0075] (1) Overexpression AcDHAD Expression of immune-related genes in Actinidia chinensis

[0076] Designed with Primer 5 AcNPR1 (salicylic acid pathway genes), AcEIN2 (ethylene pathway genes), AcLOX3 (Jasmonic acid pathway genes) and AcMYC2 The specific primers for qRT-PCR of bHLH transcription factor genes were used and their specificity was verified to ensure accurate amplification results. The reaction system was based on the instructions of ChamQ SYBR® qPCR Master Mix of Novozymes, with Actin as the internal reference gene and 2 –ΔΔT The relative expression of each gene was calculated by the PCR method, and the expression of immune-related genes was analyzed. The experiment was repeated three times.

[0077] The results showed that overexpression of AcDHAD Post-disease related AcNPR1 (salicylic acid pathway genes) and AcEIN2 (Ethylene pathway genes) showed a high expression trend during pathogen infection, and the disease-related AcLOX3 (Jasmonic acid pathway genes) and AcMYC2 (bHLH transcription factors) showed a trend of low expression ( Figure 7 ).

[0078] (2) Psa Infection resistance materials AcDHAD Dynamic changes

[0079] The transcriptome data of the published disease-resistant material RH12 and the disease-susceptible material SH14 at different Psa infection stages were analyzed and it was found that the gene expression level in the disease-resistant material (RH12) was generally at a higher level, while that in the disease-susceptible material (SH14) was at a lower level ( Figure 8 ).

[0080] As described above, the basic principle, main features and advantages of the present invention are well described. The above embodiments and descriptions are only descriptions of the preferred implementation modes of the present invention, and the present invention is not limited by the above embodiments. Without departing from the spirit and scope of the present invention, various changes and improvements made by ordinary technicians in this field to the technical solution of the present invention should fall within the protection scope determined by the present invention.

Claims

1. Application of dihydroxyacid dehydratase AcDHAD gene in improving disease resistance of kiwifruit, characterized in that: include: Overexpression of the dihydroxy acid dehydratase AcDHAD gene improves the resistance of kiwifruit to kiwifruit bacterial canker; The dihydroxy acid dehydratase AcDHAD gene encodes a dihydroxy acid dehydratase AcDHAD protein, and the amino acid sequence of the dihydroxy acid dehydratase AcDHAD protein is shown in SEQ ID NO: 1; Pseudomonas syringae pv.actinidia Pseudomonas syringae pv . actinidiae cause.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the dihydroxyacid dehydratase AcDHAD gene is shown in SEQ ID NO:2.

Images