DENV-2 infectious clone recombinant plasmid carrying reporter protein gene as well as construction method and application of DENV-2 infectious clone recombinant plasmid

Abstract

The invention relates to a DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene as well as a construction method and application of the DENV-2 infectious clone recombinant plasmid. By means of the construction method, the labeled virus DENV2-mCherry expressing mCherry can be successfully saved and obtained, and compared with a female parent wild type virus wtDENV2, insertion of the mCherry gene has small influence on replication of the labeled virus, and follow-up foundation and application research of the labeled virus are not affected.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene, and a construction method and application thereof. Background Art

[0002] Dengue virus belongs to a serotype subgroup in the Flaviviridae family. Its morphology and structure are similar to those of Japanese encephalitis virus, and its size is relatively small, about 40 to 60 nm. It is divided into four serotypes, 1, 2, 3, and 4, according to different antigenicity. Different strains of the same type also have antigenic differences. Type 2 is the most widely spread. There is crossover of antigenicity between different types of viruses, and some antigens are also the same as those of Japanese encephalitis virus and West Nile virus. The virus can proliferate in mosquitoes, Aedes albopictus transfer cells, monkey kidneys, and primary and transfer cells of hamster kidneys, and produce obvious cytopathic effects.

[0003] The basic process of reverse genetic manipulation technology is to first obtain the whole genome of the virus, assemble it into a suitable vector, transfect the constructed full-length plasmid into susceptible cells, and then rescue the infectious virus. Reverse genetics technology is an effective platform for conducting virus research. It can manipulate the changes in the genome to affect the corresponding epigenetic changes, so as to determine the impact of these operations on the virus. Constructing a DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene is a basis for conducting research on the virulence and cross-species transmission mechanism of dengue virus type 2. It can also provide a useful platform for the research of related vaccines, but there are no related studies and reports yet. Summary of the invention

[0004] One object of the present invention is to provide a method for constructing an efficient and stable DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene.

[0005] A method for constructing a DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene comprises the following steps:

[0006] Providing a bacterial artificial chromosome vector and a genome of a DENV2 strain, wherein the bacterial artificial chromosome vector contains a CMV promoter sequence, a ribozyme sequence and a bovine growth hormone termination and polyadenylation signal sequence;

[0007] Using the genome and the bacterial artificial chromosome vector as templates, the CMV promoter sequence is introduced into the 5′ end of the DENV genome by overlapping PCR amplification using a first primer pair and a second primer pair to obtain fragment S1; the nucleotide sequences of the first primer pair and the second primer pair are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, respectively;

[0008] Using the genome and the bacterial artificial chromosome vector as templates, a third primer pair and a fourth primer pair are used to introduce a ribozyme sequence and a bovine growth hormone termination and polyadenylation signal sequence into the 3′ end of the DENV genome by overlapping PCR amplification to obtain fragment S4; the nucleotide sequences of the third primer pair and the fourth primer pair are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively;

[0009] Using the genome as a template, a fifth primer pair and a sixth primer pair are used to amplify fragment S2 and fragment S3 by PCR respectively; the nucleotide sequences of the fifth primer pair and the sixth primer pair are shown in SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12 respectively;

[0010] Inserting the fragment S1, fragment S2, fragment S3 and fragment S4 into the bacterial artificial chromosome vector by double enzyme digestion and homologous recombination to obtain a DENV-2 full-length infectious clone;

[0011] The mCherry-P2A-C81mut sequence is inserted between the 81st and 82nd base pairs of the DENV2 C protein gene of the DENV-2 full-length infectious clone, and the mCherry-P2A-C81mut sequence is, from the 5' end to the 3' end, the mCherry fluorescent protein gene, the self-cleavage 2A peptide gene of porcine Teschovirus type 1, and the 1st to 81st base pairs of the DENV2 C protein gene after silent mutation, to obtain a DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene.

[0012] In some embodiments, the enzymes used for the double digestion are NarⅠ and MluⅠ, and NarⅠ and NheⅠ.

[0013] The present invention also provides a DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene, which is constructed according to the construction method described above.

[0014] In some embodiments, the nucleotide sequence is as shown in SEQ ID NO:14.

[0015] The present invention also provides the use of the DENV-2 infectious clone recombinant plasmid carrying the reporter protein gene as described above in the preparation of dengue virus emitting a red fluorescent signal.

[0016] In some embodiments, the preparation method includes the following steps: culturing 293T cells until the cell confluence grows to more than 70%, and transfecting a DENV-2 infectious clone plasmid carrying a reporter protein gene; 5 to 6 hours after transfection, replacing the culture medium with DMEM containing 4% fetal bovine serum and continuing to culture for 70 to 72 hours, freezing and thawing the cell culture at -80°C and 37°C for more than 3 times, and centrifuging to collect the supernatant to obtain the P0 virus liquid.

[0017] The present invention also provides the use of the DENV-2 infectious clone recombinant plasmid carrying the reporter protein gene as described above in the preparation of anti-dengue virus drugs.

[0018] The present invention also provides the use of the DENV-2 infectious clone recombinant plasmid carrying the reporter protein gene as described above in the preparation of a vaccine for preventing dengue virus.

[0019] The present invention also provides a host cell, which contains the DENV-2 infectious clone recombinant plasmid carrying the reporter protein gene as described above.

[0020] The invention provides a method for establishing a dengue virus marked with a red fluorescent protein mCherry. The constructed DENV-2 marker virus (pBAC-DV2-mCherry) contains: (a) a bacterial artificial chromosome vector skeleton; (b) a full-length genome of type 2 dengue virus with an mCherry gene inserted therein; and (c) a human cytomegalovirus (CMV) early promoter sequence and a hepatitis D virus (HDV) ribozyme (RZ) sequence and a bovine growth hormone termination and polyadenylation signal (BGH) sequence located at the non-coding sequences at the 5' end and 3' end of the dengue virus genome, respectively. The invention can successfully rescue and obtain the marker virus DENV2-mCherry expressing mCherry. Compared with the parent wild-type virus wtDENV2, the insertion of the mCherry gene has a smaller effect on the replication increase of the marker virus and does not affect its subsequent basic and applied research. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 A schematic diagram of a strategy for constructing a DENV2 full-length infectious clone carrying a reporter gene in one embodiment of the present invention;

[0023] Figure 2 This is a microscopic photograph of 293T cells transfected with virus DENV2-mCherry in an embodiment of the present invention (at intervals of 3 days);

[0024] Figure 3 This is a diagram showing the IFA identification results of the virus DENV2-mCherry in one embodiment of the present invention;

[0025] Figure 4 This is a growth curve comparison diagram of the virus DENV2-mCherry and the wild-type virus wtDENV2 in one embodiment of the present invention. DETAILED DESCRIPTION

[0026] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0027] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0028] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0029] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy and / or operating accuracy are allowed.

[0030] 1 Materials and methods

[0031] 1.1 Bacteria and plasmids

[0032] The bacterial artificial chromosome plasmid pBAC-CMV-RzBGH containing the early promoter sequence of human cytomegalovirus (CMV), the ribozyme (RZ) sequence of hepatitis D virus (HDV) and the termination and polyadenylation signal (BGH) sequence of bovine growth hormone was provided by Dr. Lin Jihui. The pmCherry-N1 plasmid was preserved by the Poultry Disease / Biotechnology Research Laboratory, Institute of Animal Health, Guangdong Academy of Agricultural Sciences; the chemically transformed Escherichia coli competent cells DH10B were purchased from Beijing Bomed Gene Technology Co., Ltd.

[0033] 1.2 Cells and viruses

[0034] African green monkey kidney (Vero) cells and HEK-293T (Human embryonic kidney-derived cellline) were purchased from the Cell Bank of the Chinese Academy of Sciences; Aedes albopictus C6 / 36 cells were preserved by the Poultry Disease / Biotechnology Laboratory, Institute of Animal Health, Guangdong Academy of Agricultural Sciences, and the full-length genome of a dengue virus type 2 strain was provided by Dr. Du Shouwen.

[0035] 1.3 Construction strategy of DENV2 infectious clones and marker viruses carrying reporter protein genes

[0036] According to the single restriction site NheⅠ in the viral genome and the single restriction sites NarⅠ and MluⅠ on the pBAC-CMV-RzBGH vector, the entire infectious clone sequence was divided into four segments (S1-S4), and all primers required for PCR and overlapping PCR amplification of each segment were designed (Table 1) and synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0037] Furthermore, the construction strategy of DENV2 marker virus is as follows Figure 1As shown. The mCherry-P2A-C81 mut sequence was inserted between the 81st and 82nd base pairs of the viral capsid C protein gene. Among them, mCherry is the gene encoding the mCherry fluorescent protein, P2A represents the self-cleaved 2A peptide of porcine Teschovirus type 1, and C81 mut represents the first 81 base pairs of DENV2 C protein after silent mutation. The 81 base pairs of DENV2 C protein in front of mCherry retain the elements required for the circularization of the viral genome; the P2A sequence can cleave the mCherry protein from the polyprotein; the C81 mut base pairs after silent mutation not only ensure the integrity of the C protein, but also prevent the impact on the circularization of the viral genome. mCherry-P2A-C81 mut was obtained by PCR and overlapping PCR.

[0038] Table 1 Primers used to construct

[0039]

[0041] Remark:

[0042] 1. Underline indicates homologous sequences used for overlapping PCR or homologous recombination;

[0043] 2. The 81 base sequences in bold represent synonymous mutations;

[0044] 3. Bold italics indicate restriction site sequences.

[0045] 1.4 Amplification of the target fragment DENV2 genome cDNA and plasmid pBAC-CMV-RzBGH were used as templates, and the CMV promoter sequence was introduced into the 5′ end of the DENV genome by overlapping PCR amplification with primers S1CMVF, S1CMVR, S1DVF, and S1DVR to obtain fragment S1; Rz and BGH sequences were introduced into the 3′ end of the DENV genome by overlapping PCR amplification with primers S4DVF, S4DVR, S4RzbghF, and S4RzbghR to obtain fragment S4; finally, primers S2DVF, S2DVR and S3DVF, S3DVR were used to amplify S2 and S3, respectively.

[0046] The fragment CMV-C81-mCherry-P2A-C81mut was amplified by overlapping PCR using primers S1CMVF, DV177R, mCherryF, mCherry-P2AR, C81mutF, and DV1405R.

[0047] 1.5 Assembly of a full-length infectious clone of DENV2 containing a reporter gene

[0048] After the plasmid pBAC-CMV-RzBGH was double-digested with NarⅠ and MluⅠ, the BAC vector backbone of about 7000bp was recovered, and the fragments S3 and S4 were cloned into the BAC vector backbone using the pEASY homologous recombination seamless cloning kit of Quanshijin Company to obtain the intermediate vector pBAC-DV-S34. In the same way, the fragments S1 and S2 were cloned into the vector pBAC-DV-S34 double-digested with NarⅠ and NheⅠ to obtain the infectious cloning vector pBAC-DV2 containing the full length of the virus. After sequencing verification, it was used in the next step after confirmation of correctness.

[0049] After double digestion of the vector pBAC-DV2 with NarⅠ and SphⅠ, the infectious clone backbone of the 18,000 bp fragment was recovered, and the fragment CMV-C81-mCherry-P2A-C81mut was cloned into the DENV2 infectious clone backbone using a homologous recombination seamless cloning kit to obtain the DENV2 full-length infectious clone vector containing the mCherry marker gene, which was named pBAC-DV2-mCherry after correct sequencing.

[0050] 1.6 Marker virus rescue

[0051] HEK293T cells were seeded in 6-well plates. When the cell confluence grew to about 70%, 4 μg of plasmid pBAC-DV2-mCherry was transfected per well according to the instructions of the transfection reagent Lipofectamine 3000. After 6 hours of transfection, the medium was replaced with DMEM containing 4% fetal bovine serum. After 48 hours of continuous culture, the cells were subcultured twice, and each time the expression of mCherry in the cells was observed under a fluorescence microscope according to the red fluorescence signal. The cell culture was frozen and thawed 3 times at -80 to 37 ° C, and the supernatant was collected as the P0 virus solution after centrifugation at 4000g for 5 minutes and stored in a -80 ° C refrigerator.

[0052] 1.7 Identification of recombinant viruses by indirect immunofluorescence (IFA)

[0053] Vero cells were inoculated in a 12-well plate. When the cell confluence grew to about 80%, the culture medium was discarded, and the labeled virus DENV-mCherry and wild-type virus wtDENV were respectively infected with 0.001 MOI in each well, and uninfected cells were set as negative controls. After incubation at 37°C in a CO2 incubator for 1 hour, the inoculation solution was discarded and the cells were washed three times with PBS, and then DMEM medium containing 4% FBS was added. After further culture for 48 hours, the cells were taken out for indirect immunofluorescence assay (IFA) identification, the steps are as follows: (1) The culture medium was discarded and the cells were washed three times with PBS.

[0054] (2) Fix with 4% paraformaldehyde at 4°C for 20 min, and wash with PBS three times. (3) Permeabilize with 1% Triton X-100 at room temperature for 15 min.

[0055] Wash 3 times with PBS. (4) Block with 50g / L skim milk powder at 4℃ for 6h or 37℃ for 1h, and wash once with PBS. (5) Mouse anti-flavivirus E-glycoprotein polyclonal antibody was diluted 1000 times with 20g / L skim milk powder and added to each well, incubated overnight at 4℃, and washed 3 times with PBST. (6) FITC-labeled anti-mouse secondary antibody was diluted 200 times with 20g / L skim milk powder and added to each well, blocked for 2h at 37℃, and washed 3 times with PBST. (7) DAPI was used to stain the nucleus at room temperature for 20min, and washed 3 times with PBS. (8) Observe under an inverted fluorescence microscope and collect photos.

[0056] 1.8 Virus titer determination of DENV2-mCherry

[0057] Vero cells were inoculated in 96-well plates. When the cell confluence reached 100%, the virus was diluted from 10-1 to 10-10. One column was inoculated for each dilution, and the last two columns were not inoculated with the virus. The last column was used as a negative control. After 72 hours, the DENV2-mCherry signal of the labeled virus was directly observed based on the red fluorescence of the cells. The number of positive wells for each dilution was recorded, and the virus titer was calculated. The virus titer was expressed as half tissue culture infective dose (TCID50).

[0058] 1.9 Determination of the growth curve of recombinant DENV-2 virus

[0059] Vero cells were inoculated in 24-well plates. When the cell confluence reached 90%, the culture medium was discarded and the rescue virus was infected in each well at 2 MOI. After incubation at 37°C for 1 hour, the infection medium was discarded and washed 3 times with PBS and replaced with maintenance medium containing 4% FBS. Supernatants were collected from different wells at 12h, 24h, 36h, 48h, 60h, 72h, and 96h, and the virus titer was determined by IFA.

[0060] 2 Results

[0061] 2.1 Rescue of labeled viruses

[0062] Since DENV2-mCherry expresses mCherry red fluorescent protein, the virus rescue status can be judged by observing whether the cells have red fluorescent signals. Figure 2As shown, 48 hours after pBAC-DV2-mCherry transfected 293T cells, only a small number of cells had red fluorescence signals. When the cells were passaged to the second generation, more than 90% of the cells showed red fluorescence, indicating that when the cells were passaged to the second generation, 90% of the cells had been infected with the rescued marker virus DENV2-mCherry.

[0063] 2.2 IFA identification of labeled viruses

[0064] Vero cells were inoculated with the rescued labeled virus DENV2-mCherry and wild-type virus wtDENV2, respectively, and cells not inoculated with the virus were set as controls. Figure 3 As shown, DENV2-mCherry infected cells can detect both viral E protein and red fluorescence signal emitted by mCherry, while wtDENV2 infected cells can only detect viral E protein. The plaques formed by DENV2-mCherry infected cells are smaller than those formed by wtDENV2 infected cells, which may be due to the insertion of mCherry gene in DENV2 genome, which weakens the ability of virus proliferation.

[0065] 2.3 Determination of the growth curve of labeled viruses

[0066] After the wild-type virus wtDENV2 and DENV2-mCherry were inoculated into Vero cells in a 24-well cell culture plate at 2 MOI, the cell supernatant was collected at different time points, the wild-type virus wtDENV2 titer was determined by IFA, the DENV2-mCherry virus titer was determined by the red fluorescence signal, and the one-step growth curve of the virus was drawn. Figure 4 As shown, the virus titer of wtDENV2 reached a maximum of 107.11 TCID 50 / mL, while the highest viral titer of DENV2-mCherry was 104.51TCID 50 / mL, indicating that the insertion position of the mCherry gene had little effect on the proliferation of DENV2.

[0067] Attachment:

[0068] The sequence of the above DENV2 full-length infectious clone (SEQ ID NO: 13) is as follows (lowercase letters are pBeloBAC11 vector sequences)

[0069] Gcggccgcaaggggttcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatca GGCGCC

[0070]

[0071]

[0072]

[0073]

[0074]

[0075] gcgcgcctaacctgggtatcggcacgattaatgtcgtatgtgctgctgatgtgctgattgttcccacg cctgctgagttgtttgactacacctccgcactgcagtttttcgatatgcttcgtgatctgctcaagaa cgttgatcttaaagggttcgagcctgatgtacgtattttgcttaccaaatacagcaatagtaatggct

[0101] The infectious clone sequence (SEQ ID NO:14) containing the labeled mCherry gene described above:

[0102] gcggccgcaaggggttcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgCGTAAGGAGAAAATACCGCATCA GGCGCC gTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCC CGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATT AGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGA CTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCA ACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACG GTGGGAGGTCTATATAAGCAGAGCTCgtttagtgaaccgtAGTTGTTAGTCTAC

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109] gtccccgtggatggaggagcaaattcgggatgcctggggaagcatggttctaaaaaatgttgtacgtg aaacggatgaagttggtaaaggtcagatccggatgagaactgtttttgaacaggccattgatcaacgc tcttcaactggtgcctggagaaatgctctttctatttgggaacctgtctgcaatgaaattttcgatcg

[0133] The technical features of the above-described embodiments can be combined arbitrarily. In order to make the description concise, all possible combinations of the technical features in the above-described embodiments are not described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification. The above-described embodiments only express several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present invention, several variations and improvements can be made, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims, and the description and drawings can be used to interpret the content of the claims.

Claims

1. A method for constructing a DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene, characterized in that: The steps include: Providing a bacterial artificial chromosome vector and a genome of a DENV2 strain, wherein the bacterial artificial chromosome vector contains a CMV promoter sequence, a ribozyme sequence and a bovine growth hormone termination and polyadenylation signal sequence; Using the genome and the bacterial artificial chromosome vector as templates, the CMV promoter sequence is introduced into the 5′ end of the DENV genome by overlapping PCR amplification using a first primer pair and a second primer pair to obtain fragment S1; the nucleotide sequences of the first primer pair and the second primer pair are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, respectively; Using the genome and the bacterial artificial chromosome vector as templates, a third primer pair and a fourth primer pair are used to introduce a ribozyme sequence and a bovine growth hormone termination and polyadenylation signal sequence into the 3′ end of the DENV genome by overlapping PCR amplification to obtain fragment S4; the nucleotide sequences of the third primer pair and the fourth primer pair are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively; Using the genome as a template, fragment S2 and fragment S3 are obtained by PCR amplification using the fifth primer pair and the sixth primer pair, respectively; the nucleotide sequences of the fifth primer pair and the sixth primer pair are shown in SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12, respectively; Inserting the fragment S1, fragment S2, fragment S3 and fragment S4 into the bacterial artificial chromosome vector by double enzyme digestion and homologous recombination to obtain a DENV-2 full-length infectious clone; The mCherry-P2A-C81mut sequence is inserted between the 81st and 82nd base pairs of the DENV2 C protein gene of the DENV-2 full-length infectious clone, and the mCherry-P2A-C81mut sequence is, from the 5' end to the 3' end, the mCherry fluorescent protein gene, the self-cleavage 2A peptide gene of porcine Teschovirus type 1, and the 1st to 81st base pairs of the DENV2 C protein gene after silent mutation, to obtain a DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene.

2. A DENV-2 infectious clone recombinant plasmid carrying a reporter protein gene, characterized in that: The method according to claim 1 is used to construct the 3. The DENV-2 infectious clone recombinant plasmid according to claim 2, characterized in that Its genomic nucleotide sequence is shown in SEQ ID NO:

14.

4. Use of the DENV-2 infectious clone recombinant plasmid carrying the reporter protein gene according to claim 2 or 3 in the preparation of dengue virus emitting red fluorescent signal.

5. The use according to claim 4, characterized in that: The preparation method comprises the following steps: culturing 293T cells until the cell confluence grows to more than 70%, transfecting the DENV-2 infectious clone recombinant plasmid carrying the reporter protein gene; after transfection for 5 to 6 hours, replacing the culture medium with a DMEM culture medium containing 4% fetal bovine serum and continuing to culture for 70 to 72 hours, freezing and thawing the cell culture at -80 to 37°C for more than 3 times, and collecting the supernatant by centrifugation to obtain a P0 generation virus liquid.

6. Use of the DENV-2 infectious clone recombinant plasmid carrying the reporter protein gene according to claim 2 or 3 in the preparation of anti-dengue virus drugs.

7. Use of the DENV-2 infectious clone recombinant plasmid carrying the reporter protein gene according to claim 2 or 3 in the preparation of a vaccine for preventing dengue virus.

8. A host cell, characterized in that A DENV-2 infectious clone recombinant plasmid containing the reporter protein gene according to claim 2 or 3.

Images