Methods, compositions and kits for inhibiting linker dimer formation

Abstract

In accordance with an aspect of the present disclosure, there is provided a method of reducing linker-dimers in a sequencing library, comprising: hybridizing an excess of 3 '-linkers to blocker oligonucleotides to form a hybrid complex such that the excess of 3'-linkers cannot form linker-dimers, the hybrid complex comprising: a first blocker oligonucleotide 3 '-terminal, a second blocker oligonucleotide 3'-terminal, a third blocker oligonucleotide 3 '-terminal, and a fourth blocker oligonucleotide 3'-terminal; the first blocker oligonucleotide 3'end is adjacent to the adenylated nucleotide at the 5'end of the first unlinked 3 'linker, and the second blocker oligonucleotide 3' end is adjacent to the adenylated nucleotide at the 5 'end of the second unlinked 3' linker, where the first blocker oligonucleotide has a 5 'moiety complementary and hybridized to the first unlinked 3' linker, and the second blocker oligonucleotide 3 'end is adjacent to the adenylated nucleotide at the 5' end of the second unlinked 3 'linker. The second blocker oligonucleotide has a 5'portion complementary and hybridized to the second unlinked 3 'linker, and the first blocker oligonucleotide has a 3' portion complementary and hybridized to the 3 'portion of the second blocker oligonucleotide. The first and second blocker oligonucleotides may be the same oligonucleotide comprising a palindromic sequence that allows self-hybridization.

Description

[0001] Cross-references to related patent applications

[0002] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 323,778 filed on March 25, 2022, the entire contents of which are incorporated herein by reference.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted electronically as an XML-formatted file, and its entire contents are incorporated herein by reference. The XML-formatted file was created on March 24, 2023, has a file name of 16NEN27152WO.xml, and is 12,732 bytes in size. Technical Field

[0005] The present disclosure relates to methods, compositions, and kits for reducing adapter-dimers in sequencing libraries. Background Art

[0006] Genetic analysis has become increasingly common and can be used in a variety of molecular biology applications. For example, genetic testing of an individual is particularly useful for early detection of genetic diseases and can play a role in the selection of treatments for specific diseases or conditions.

[0007] Massively parallel nucleic acid sequencing technology plays a key role in the genetic analysis of target nucleic acids, but undesirable results can be produced when non-target nucleic acids are sequenced together with target nucleic acids.

[0008] In massively parallel nucleic acid sequencing technologies, targeted enrichment methods are often used to reduce the contamination of sequencing results by non-target sequences. One such enrichment method relies on hybridization capture of target nucleic acid sequencing library molecules.

[0009] The method for producing the sequencing library of large-scale parallel nucleic acid sequencing is as follows: the first step of the present invention is to use a plurality of couplings to produce the sequence of the insertion sequence of the target sequence.The first step of the present invention is to use a plurality of couplings to produce the sequence of the insertion sequence of the target sequence.The first step of the present invention is to use a plurality of couplings to produce the sequence of the insertion sequence of the target sequence.The second ...

[0010] Further, the adapter-dimers may be retained by hybridization capture during the enrichment step, thereby capturing the adapter-dimers and wasting reagents and time to sequence the adapter-dimers.

[0011] The ever-expanding application of massively parallel sequencing technologies and the increasing need to multiplex large numbers of individual libraries in a single run has led to a need to effectively inhibit the formation of adapter-dimers, and to remove those that have already formed.

[0012] There is a continuing need for compositions and methods for reducing adapter-dimers in sequencing libraries for massively parallel sequencing. Summary of the invention

[0013] According to aspects of the present disclosure, a method for reducing adapter-dimers in a sequencing library is provided, comprising: combining sample nucleic acids each having a 5' end and a 3' end with a 3' adapter and a ligase in a mixture under ligation reaction conditions, wherein each of the 3' adapters has a 5' end portion of at least 8 nucleotides in length and a 5' end that is an adenylated nucleotide, to produce 1) first ligation products, each of which includes the 3' end of the sample nucleic acid ligated to the 5' end of the 3' adapter, and 2) excess unligated 3' adapters in the mixture; adding a blocker oligonucleotide ( blocker oligonucleotide), the blocker oligonucleotide comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion having a length of at least 8 nucleotides, and ii) a first blocker oligonucleotide 3' portion having a length of at least 1 to 20 nucleotides and including the 3' end of the first oligonucleotide, wherein at least one of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; and b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5' portion having a length of at least 8 nucleotides, and iv) a second blocker oligonucleotide 3' portion having a length of at least 1 to 20 nucleotides and including the 3' end of the second blocker oligonucleotide, wherein at least one of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; and wherein the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to the 5' end portion of the 3' adapter; and incubating the mixture under hybridization conditions so that the first blocker oligonucleotide The 3' end of the first blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the first unligated 3' adapter, and the 3' end of the second blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the second unligated 3' adapter, thereby reducing excess unligated 3' adapters in the mixture and producing a purified mixture.

[0014] According to aspects of the present disclosure, both the 3' end of the first blocker oligonucleotide and the 3' end of the second blocker oligonucleotide are capable of connecting to the adenylated nucleotide at the 5' end of the excess unconnected 3' linker; and the method of the present disclosure further includes connecting the 3' end of the first blocker oligonucleotide of the hybridization complex to the adjacent adenylated nucleotide at the 5' end of the first unconnected 3' linker, and connecting the 3' end of the second blocker oligonucleotide of the hybridization complex to the adjacent adenylated nucleotide at the 5' end of the second unconnected 3' linker, to produce a connection complex, thereby reducing the excess unconnected 3' linker in the mixture and producing a purified mixture.

[0015] According to aspects of the present disclosure, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1 to 20 nucleotides of the 3' portion of the first blocker oligonucleotide are non-naturally occurring nucleotides and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1 to 20 nucleotides of the 3' portion of the second blocker oligonucleotide are non-naturally occurring nucleotides.

[0016] According to aspects of the present disclosure, the length of the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides, and the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each include a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is the same as the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion.

[0017] According to aspects of the present disclosure, the first blocker oligonucleotide and the second blocker oligonucleotide each have a length in the range of 11 to 50 nucleotides.

[0018] According to aspects of the present disclosure, the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

[0019] According to aspects of the present disclosure, the method for reducing adapter-dimers in a sequencing library further comprises adding a 5' adapter to the mixture, the 5' adapter having a 3' end, wherein the first ligation products each comprise the 3' end of the sample nucleic acid connected to the 5' end of the 3' adapter, and the 5' end of the sample nucleic acid connected to the 3' end of the 5' adapter, thereby generating a sequencing library molecule comprising a sample nucleic acid insert located between and bound to the 5' adapter and the 3' adapter.

[0020] According to aspects of the present disclosure, the method for reducing adapter-dimers in a sequencing library also includes adding a 5' adapter to the purified mixture; and incubating the purified mixture under ligation reaction conditions, thereby 1) ligating the 5' adapter to the first ligation product to produce a sequencing library molecule, wherein the sequencing library molecule includes a sample nucleic acid insert fragment located between and bound to the 5' adapter and the 3' adapter.

[0021] According to aspects of the present disclosure, a method for reducing adapter-dimers in a sequencing library is provided, wherein the excess unconnected 3' adapters are reduced but not removed, so that the connection includes connecting a 5' adapter to at least a portion of the excess unconnected 3' adapters, producing an adapter-dimer, which includes a 5' adapter that is bound to the 3' adapter at the 5' adapter-3' adapter interface. Therefore, according to aspects of the present disclosure, a method for reducing adapter-dimers in a sequencing library is provided, which further includes suppressing the amplification of adapter-dimers in an amplification reaction, so that the sequencing library molecules are selectively enriched by the amplification reaction compared to the adapter-dimers. Inhibiting the amplification of linker-dimers may include one or more of the following: removing at least some linker-dimers prior to amplification; specific enzymatic cleavage of linker-dimers; CRISPR / Cas9-based cleavage of linker-dimers; gel purification to remove linker-dimers; SPRI bead-based size selection to remove linker-dimers; and adding a linker-dimer blocker oligonucleotide to the mixture that effectively inhibits the amplification of linker-dimers.

[0022] According to aspects of the present disclosure, a method for reducing adapter-dimers in a sequencing library is provided, comprising adding an adapter-dimer blocker oligonucleotide to a mixture, the adapter-dimer blocker oligonucleotide effectively inhibiting amplification of the adapter-dimer, wherein the adapter-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the adapter-dimer, the one or more adjacent portions including at least one nucleotide of the 5' adapter at the 5' adapter-3' adapter interface, and an adjacent portion of the 3' adapter including an amplification primer binding site.

[0023] According to aspects of the present disclosure, methods of reducing adapter-dimers in a sequencing library are provided, wherein the sample nucleic acid is or includes RNA.

[0024] According to aspects of the present disclosure, there is provided a method of reducing adapter-dimers in a sequencing library, wherein the sample nucleic acid is or includes RNA, and the method includes reverse transcribing the RNA to produce reverse transcribed sequencing library molecules.

[0025] According to aspects of the present disclosure, there is provided a method of reducing adapter-dimers in a sequencing library, further comprising amplifying the sequencing library molecules or reverse transcribing the sequencing library molecules.

[0026] According to aspects of the present disclosure, there is provided an oligonucleotide pair for reducing adapter-dimers in a sequencing library, comprising a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion having a length of at least 8 nucleotides and ii) a first blocker oligonucleotide 3' portion having a length of at least 1 to 20 nucleotides and including the 3' end of the first oligonucleotide, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; and b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5' portion having a length of at least 8 nucleotides and iv) a second blocker oligonucleotide 3' portion having a length of at least 1 to 20 nucleotides and including the 3' end of the second blocker oligonucleotide, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; wherein the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to the 5' end portion of the 3' adapter.

[0027] According to aspects of the present disclosure, both the first blocker oligonucleotide 3' end and the second blocker oligonucleotide 3' end are capable of ligating to the adenylated nucleotide at the 5' end of the excess unligated 3' adaptor.

[0028] According to aspects of the present disclosure, there is provided a blocker oligonucleotide pair for reducing adaptor-dimers in a sequencing library, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the first blocker oligonucleotide are non-naturally occurring nucleotides and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the second blocker oligonucleotide are non-naturally occurring nucleotides.

[0029] According to aspects of the present disclosure, a blocker oligonucleotide pair for reducing adaptor-dimers in a sequencing library is provided, wherein when the length of the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides, the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each include a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is the same as the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion.

[0030] According to aspects of the present disclosure, there is provided a blocker oligonucleotide pair for reducing adaptor-dimers in a sequencing library, wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length in the range of about 11 to about 50 nucleotides.

[0031] According to aspects of the present disclosure, there is provided a blocker oligonucleotide pair for reducing adaptor-dimers in a sequencing library, wherein a first blocker oligonucleotide and a second blocker oligonucleotide have the same nucleotide sequence.

[0032] According to aspects of the present disclosure, a kit for reducing adapter-dimers in a sequencing library is provided, comprising one or more blocker oligonucleotide pairs for reducing adapter-dimers in a sequencing library.

[0033] According to aspects of the present disclosure, a kit for reducing adapter-dimers in a sequencing library further comprises an adapter-dimer blocker oligonucleotide effective to block amplification of adapter-dimers.

[0034] According to aspects of the present disclosure, a kit for reducing adapter-dimers in a sequencing library is provided, wherein an adapter-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the adapter-dimer, the one or more adjacent portions including at least one nucleotide of the 5' adapter at the 5' adapter-3' adapter interface, and an adjacent portion of the 3' adapter including an amplification primer binding site. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 is a diagrammatic illustration of a hybridization complex including a blocker oligonucleotide and a 3' adapter according to aspects of the present disclosure; Figure 1Includes numbers showing features of a hybridization complex, the hybridization complex comprising: a first blocker oligonucleotide 20; a first blocker oligonucleotide 3' end 28; a first blocker oligonucleotide 5' portion 30; a first blocker oligonucleotide 3' portion 35; a second blocker oligonucleotide 5' portion 55; a second blocker oligonucleotide 40; a second blocker oligonucleotide 3' end 48; a second blocker oligonucleotide 3' portion 50; a 3' linker 60; and a 5' adenylated end 62 of the 3' linker.

[0036] Figure 2A A schematic diagram illustrating a "single adapter system" wherein the blocking oligonucleotides have identical sequences including a blocker oligonucleotide 5' portion (dark grey) and including a palindromic blocker oligonucleotide 3' portion (light grey), such that the palindromic blocker oligonucleotide 3' portions are complementary and anneal as shown; for example, the "single adapter system" is used in a method for sequencing library generation in which a single type of adapter is included.

[0037] Figure 2B A schematic diagram showing a "polylinker system" comprising at least two types of blocking oligonucleotides, wherein the different types of blocking oligonucleotides have different sequences, include different blocker oligonucleotide 5' portions (dark gray, upper left; and medium gray, lower left), and include the same palindromic blocker oligonucleotide 3' portion (light gray), such that the palindromic blocker oligonucleotide 3' portions are complementary and annealed as shown; for example, the "polylinker system" is used in a method for sequencing library generation, wherein multiple types of linkers are included, such as each linker includes a different index sequence.

[0038] Figure 2C Schematic diagram showing a "single adapter system" comprising at least two types of blocking oligonucleotides, wherein the different types of blocking oligonucleotides have different sequences, comprising the same blocker oligonucleotide 5' portion (dark gray) and comprising different non-palindromic blocker oligonucleotide 3' portions (light gray, top; dotted gray, bottom), such that the non-palindromic blocker oligonucleotide 3' portions are complementary and annealed as shown; for example, the "single adapter system" is used in a method for sequencing library generation in which a single type of adapter is included.

[0039] Figure 3 Graphs illustrating inhibition of linker-dimer formation according to aspects of the present disclosure. Figure 3Shown are a) the proportion of desired RNA that is successfully incorporated into sequencing library molecules (dark grey); b) the proportion of adapter-dimers (canonical dimers) that are formed and incorporated into sequencing library molecules (medium grey); and c) the proportion of other molecules that are incorporated into sequencing library molecules (light grey) in methods for reducing adapter-dimers in sequencing libraries using: #1) a method without blocking adapter dimer formation; #2) a method comprising use of one or more blocker oligonucleotides according to aspects of the present disclosure; #3) a method comprising removal of at least some adapter-dimers prior to amplification; or #4) a method comprising use of one or more blocker oligonucleotides according to aspects of the present disclosure and further comprising removal of at least some adapter-dimers prior to amplification.

[0040] Figure 4 The results are shown in a graph, which shows that, compared with conventional methods, due to the use of a method including the use of one or more blocker oligonucleotides according to aspects of the present disclosure, the percentage of adapter-dimers included in the sequencing library is significantly reduced, and the percentage of dimers sequenced is significantly reduced. It is further shown that, compared with conventional methods, due to the use of a method including the use of one or more blocker oligonucleotides according to aspects of the present disclosure, the percentage of adapter-dimers included in the sequencing library is significantly reduced, and the percentage of mature miRNA sequenced is increased. Figure 4 In the figure, light grey bar 1 represents data obtained using a method comprising use of one or more blocker oligonucleotides according to aspects of the present disclosure, and dark grey bar 2 represents data obtained using a conventional method.

[0041] Figure 5A graph showing results obtained using a method comprising using one or more blocker oligonucleotides according to aspects of the present disclosure, and the dark grey bar 2 represents data obtained using conventional methods. The results show a comparison of the number of unique miRNAs represented in the sequencing data, i.e., 600 unique single sequences found at least once using a method comprising one or more blocker oligonucleotides according to aspects of the present disclosure, compared to only 509 unique single sequences found at least once using conventional methods; 471 unique sequences found at least 3 times using a method comprising one or more blocker oligonucleotides according to aspects of the present disclosure, compared to only 424 unique single sequences found at least 3 times using conventional methods; 407 unique single sequences found at least 5 times using a method comprising one or more blocker oligonucleotides according to aspects of the present disclosure, compared to only 370 unique single sequences found at least 5 times using conventional methods; and 339 unique single sequences found at least 10 times using a method comprising one or more blocker oligonucleotides according to aspects of the present disclosure, compared to only 295 unique single sequences found at least 10 times using conventional methods.

[0042] Figure 6 is a Venn diagram showing a comparison of the number of unique miRNAs discovered between 3 replicates using a method comprising use of one or more blocker oligonucleotides according to aspects of the present disclosure (large grey circles) and 3 replicates obtained using a conventional method (medium sized medium grey circles) at the same threshold of 5. The smallest black circle represents the number of unique miRNAs common to both methods. DETAILED DESCRIPTION

[0043] Scientific and technical terms used herein are intended to have the meanings that are commonly understood by one of ordinary skill in the art. These terms are defined and used in the context of a variety of standard reference texts, which illustratively include J. Sambrook and D. W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; FM Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002; B. Alberts et al., Molecular Biology of the Cell, 4th Ed., Garland, 2002; DL Nelson and MM Cox, Lehninger Principles of Biochemistry, 4th Ed., WH Freeman & Company, 2004; Herdewijn, P. (Ed.), Oligonucleotide Synthesis: Methods and Applications, Methods in Molecular Biology, Humana Press, 2004; Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, 21st Ed., 2005; LV Allen, Jr. et al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, 8th Ed., Philadelphia, PA: Lippincott, Williams & Wilkins, 2004; and L. Brunton et al., Goodman & Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill Professional, 12th Ed., 2011.

[0044] The singular terms "a," "an," and "the" are not intended to be limiting and include plural referents unless expressly stated otherwise or the context clearly dictates otherwise.

[0045] The term "about" and its grammatical equivalents as used herein with respect to a reference value refer to the reference value and values ​​within 10% of the reference value, including values ​​plus or minus (+ / -) 1%, + / -2%, + / -3%, + / -4%, + / -5%, + / -6%, + / -7%, + / -8%, + / -9% or + / -10% of the reference value. In the context of the reference numerical range, the term "about" and its grammatical equivalents used herein refer to a range of + / -1%, + / -2%, + / -3%, + / -4%, + / -5%, + / -6%, + / -7%, + / -8%, + / -9% or + / -10% of the reference lower limit of the numerical range, and a range of + / -1%, + / -2%, + / -3%, + / -4%, + / -5%, + / -7%, + / -8%, + / -9% or + / -10% of the reference upper limit of the numerical range. Further, unless otherwise specified, it should be understood that the numerical list herein includes all intermediate values ​​and fractional values ​​of the listed numerical values, such as 50%, 60%, 75% is understood to include 55%, 64.5% and 74%.

[0046] The terms “first”, “second” and the like may be used herein to refer to an element or a combination of elements, and these terms are used to refer to such elements or combinations of elements without limiting whether the first element and the second element are the same as or different from each other.

[0047] Specific combinations of features are recorded in the claims and / or disclosed in the specification, and the combination of these features is not intended to limit the disclosure of each aspect. All possible combinations of these features are not specifically recorded in the claims and / or disclosed in the specification. Although each of the following dependent claims may be directly subordinate to only one claim, the disclosure of each aspect includes the combination of each dependent claim with each other claim in the claims. As used herein, the phrase "at least one" in a list of items refers to any combination of those items, including single members. For example, "at least one of a, b, or c" is intended to cover a alone; b alone; c alone; a and b; a, b, and c; b and c; a and c, and any combination with multiple identical elements, such as a and a; a, a, and a; a, a, and b; a, a, and c; a, b, and b; a, c, and c; and any other combination or ordering of a, b, and c.

[0048] According to aspects of the present disclosure, a method for reducing adapter-dimers in a sequencing library is provided, comprising: hybridizing excess 3' adapters with a blocker oligonucleotide to form a hybridization complex, so that the excess 3' adapters cannot form adapter-dimers, wherein the hybridization complex comprises a first blocker oligonucleotide having a 5' portion that is complementary to and hybridizes with a first unattached 3' adapter, a second blocker oligonucleotide having a 5' portion that is complementary to and hybridizes with a second unattached 3' adapter, and wherein the first blocker oligonucleotide has a 3' portion that is complementary to and hybridizes with the 3' portion of the second blocker oligonucleotide.

[0049] Optionally, the 3' linker is covalently bound to the blocker oligonucleotide in the hybridization complex by ligation, thereby forming a ligation complex, wherein the 3' end of the first blocker oligonucleotide is linked to the adjacent adenylated nucleotide at the 5' end of the first unligated 3' linker, and the 3' end of the second blocker oligonucleotide is linked to the adjacent adenylated nucleotide at the 5' end of the second unligated 3' linker, wherein the first blocker oligonucleotide has a 5' portion that is complementary to and hybridized with the first unligated 3' linker, the second blocker oligonucleotide has a 5' portion that is complementary to and hybridized with the second unligated 3' linker, and wherein the first blocker oligonucleotide has a 3' portion that is complementary to and hybridized with the 3' portion of the second blocker oligonucleotide.

[0050] The terms "blocker oligonucleotide" and "oligonucleotide blocker" used interchangeably herein refer to a synthetic oligonucleotide comprising i) a blocker oligonucleotide 5' portion of at least 8 nucleotides in length adjacent to the 5' end, and ii) a blocker oligonucleotide 3' portion of at least 1 to 20 nucleotides in length adjacent to the 3' end. According to aspects of the present disclosure, the blocker oligonucleotide has a total length in the range of about 9 nucleotides to about 50 nucleotides. According to aspects of the present disclosure, the blocker oligonucleotide has a total length of about 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, or about 50 nucleotides, and can be shorter or longer.

[0051] According to aspects of the disclosure, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1 to 20 nucleotides of the 3' portion of the blocker oligonucleotide are non-naturally occurring nucleotides.

[0052] According to aspects of the present disclosure, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the blocker oligonucleotide are Tm-increasing nucleotides and / or nucleotide analogs. According to aspects of the present disclosure, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the blocker oligonucleotide are LNA monomers, PNA monomers, BNA monomers, other Tm-increasing nucleotides and / or nucleotide analogs. mAccording to aspects of the present disclosure, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the blocker oligonucleotide are LNA monomers.

[0053] According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the 5' portion of the blocker oligonucleotide are non-naturally occurring nucleotides. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the 5' portion of the blocker oligonucleotide are Tm-increasing nucleotides and / or nucleotide analogs. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the 5' portion of the blocker oligonucleotide are LNA monomers, PNA monomers, BNA monomers, other Tm-increasing nucleotides. m Increased nucleotide analogs, or any two or more thereof. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the 5' portion of the blocker oligonucleotide are LNA monomers.

[0054] According to aspects of the present disclosure, the 3' portion of the blocker oligonucleotide is or includes a palindromic nucleotide sequence.

[0055] Oligonucleotides according to aspects of the present disclosure are produced synthetically using chemical synthesis and / or recombinant molecular biology techniques, for example as described in detail in Herdewijn, P. (Ed.), Oligonucleotide Synthesis: Methods and Applications, Methods in Molecular Biology, Humana Press, 2004.

[0056] An exemplary blocker oligonucleotide is 5'-CACCCGAGAATTCCA--C / iisodG / / iMe-isodC / / iisodG / / iMe-isodC / G-3' (SEQ ID NO: 1).

[0057] Figure 1The diagram illustrates a first blocker oligonucleotide 20 and a second blocker oligonucleotide 40. The first blocker oligonucleotide 20 has a 5' portion 30 and a 3' portion 35. The 3' end of the first blocker oligonucleotide is shown at 28. The second blocker oligonucleotide has a 5' portion 55 and a 5' portion 50. The 3' end of the second blocker oligonucleotide is shown at 48. Although the first and second blocker oligonucleotides are shown as being equal in length to the 3' adapter 60 and its end 62, the length of the first and second blocker oligonucleotides can be shorter or longer than the 3' adapter 60 and its end 62.

[0058] Figure 1 A hybridization complex is shown in which the first blocker oligonucleotide 3' portion 35 is hybridized to the second blocker oligonucleotide 3' portion 50. Further shown is a 3' adapter 60, each having a 5' adenylated end 62. The 3' adapter 60 is shown hybridized to the 5' portion of the first blocker oligonucleotide 30 and the 5' portion of the second blocker oligonucleotide. Also shown is the 5' adenylated end 62 of the 3' adapter adjacent to the 3' end 28 of the first blocker oligonucleotide and the 5' adenylated end 62 of the 3' adapter adjacent to the 3' end 48 of the second blocker oligonucleotide.

[0059] Optionally, a ligation reaction is performed such that, under ligation conditions and in the presence of a ligase, ligation occurs between the 5' adenylated end 62 of the 3' linker and the adjacent 3' end 28 of the first blocker oligonucleotide; and, under ligation conditions and in the presence of a ligase, ligation occurs between the 5' adenylated end 62 of the 3' linker and the adjacent 3' end of the second blocker oligonucleotide 48 to form a ligation complex.

[0060] According to aspects of the present disclosure, the sequences of the first and second blocker oligonucleotides are identical.

[0061] According to aspects of the disclosure, the first and second blocker oligonucleotides differ in sequence.

[0062] The 5' portion of the blocker oligonucleotide of the present disclosure is complementary to the 3' adapter, such that the 5' portion of the blocker oligonucleotide hybridizes to the 3' adapter under hybridization conditions. The length of the blocker oligonucleotide can be longer, shorter, or the same as the 3' adapter. The 5' portion of the blocker oligonucleotide can be completely complementary to the 3' adapter, or can be 50%, 60%, 70%, 80%, 90% or more complementary using hybridization conditions suitable for forming a hybrid complex and subsequent ligation to form a ligated complex.

[0063] Methods described herein, blocker oligonucleotides and kits can be used to generate sequencing libraries from sample nucleic acids derived from any of a variety of sources. The sample nucleic acid, such as DNA or RNA, is generally present in a biological sample, which can be obtained from an individual, such as from a body sample, such as blood, lymph, oral swabs, skin tissue, urine, saliva, tissue, sputum, peritoneal fluid, fecal matter, gastric juice, semen, cerebrospinal fluid, biopsy material, wound exudate, etc., and cell lines derived therefrom. Prenatal biological sample nucleic acid can be obtained from fetal cells, fetal DNA and / or fetal RNA circulating in amniotic fluid, products of conception, blastocysts and blastomeres, chorionic villi, maternal blood. The sample nucleic acid can also be obtained from an in vitro source such as a cell line.

[0064] The methods, blocker oligonucleotides and kits described herein can be used to generate sequencing libraries from sample nucleic acids obtained from any of a variety of organisms, including but not limited to humans, non-human primates, rodents, rabbits, dogs, cats, horses, cattle, pigs, goats and sheep. Non-mammalian sources of sample nucleic acids can also be used, illustratively including fish and other aquatic organisms, birds, poultry, bacteria, viruses, plants, insects, reptiles, amphibians, fungi and mycobacteria. Therefore, the sample nucleic acid, such as sample DNA or sample RNA, can be obtained from any of these sources.

[0065] The sample nucleic acid, such as DNA or RNA, can be obtained from any source, including but not limited to humans, non-human mammals, vertebrates, invertebrates, microorganisms or plants. The sample nucleic acid, such as DNA or RNA, can be obtained from one or more in vitro or in vitro cells. For example, the sample nucleic acid, such as DNA or RNA, can be obtained from cultured cells, including but not limited to cell lines, primary cells or laboratory manipulated cells, such as recombinant cells.

[0066] According to aspects of the present disclosure, the sample nucleic acid is "small RNA". As used herein, the term "small RNA" refers to RNA ranging in length from about 10 nucleotides to about 300 nucleotides, such as RNA ranging in length from about 10 nucleotides to about 250 nucleotides, RNA ranging in length from about 10 nucleotides to about 200 nucleotides, RNA ranging in length from about 10 nucleotides to about 150 nucleotides, RNA ranging in length from about 10 nucleotides to about 100 nucleotides, RNA ranging in length from about 10 nucleotides to about 90 nucleotides, RNA ranging in length from about 10 nucleotides to about 80 nucleotides, RNA ranging in length from about 10 nucleotides to about 70 nucleotides, RNA ranging in length from about 10 nucleotides to about 60 nucleotides, RNA ranging in length from about 10 nucleotides to about 50 nucleotides, RNA ranging in length from about 10 nucleotides to about 40 nucleotides, or RNA ranging in length from about 10 nucleotides to about 30 nucleotides. Small RNA can be any of the following: RNA fragments, rRNA, viral RNA, microRNA (miRNA), small interfering RNA (siRNA), transfer RNA (tRNA), short hairpin RNA (shRNA), repeat-associated RNA (rasiRNA), small nucleolar RNA (snoRNA), Piwi-interacting RNA (piRNA), small Cajal body RNA (scaRNA), heterochromatin siRNA (hc-siRNA) and trans-acting RNA (ta-siRNA).

[0067] As used herein, the term "sequencing library" refers to a plurality of linear double-stranded DNA fragments, including an insert fragment, which is a target for sequencing of interest derived from a sample nucleic acid, which may or may not be derived from the same source. The DNA fragments of the sequencing library further include functional elements flanking the insert fragment, which provide for identification of the DNA fragment (e.g., barcode or index sequence), binding of amplification primers, binding of sequencing primers, or specific binding to the desired target, thereby allowing efficient processing in a sequencing method (particularly a massively parallel sequencing method). The sequencing library may include an insert fragment flanked by two adapters (5' adapter and 3' adapter), wherein the 5' adapter is covalently bound directly or indirectly to the 5' end of the insert fragment, and the 3' adapter is covalently bound directly or indirectly to the 3' end of the insert fragment. The indirect binding of an adapter to an insert fragment refers to a configuration in which another DNA sequence is located between the insert fragment and the adapter.

[0068] The term "massively parallel sequencing", including "sequencing by synthesis", also referred to as "next generation sequencing" and "high throughput sequencing", refers to a method of sequencing many nucleic acid sequencing library molecules (e.g., thousands of nucleic acid sequencing library molecules) simultaneously or nearly simultaneously. Oligonucleotide blocker sets provided according to aspects of the present disclosure are described herein, with particular reference to the Illumina Nextera and / or TruSeq platforms and configurations in some cases, but not limited thereto. More specifically, the compositions and methods of the present disclosure can be used in any of a variety of sequencing protocols and with a variety of sequencing equipment, including but not limited to semiconductor sequencing (Ion Torrent) systems.

[0069] The term "adapter" refers to a linear, single-stranded, double-stranded or partially double-stranded DNA fragment that includes functional elements that provide for, for example, identification, amplification, or specific binding to a desired target of the DNA fragment, thereby allowing efficient processing in a sequencing method. The adapter includes one or more functional elements, such as a sequencing primer binding sequence (also referred to as a sequencing primer binding site), an extension primer binding sequence (also referred to as an extension primer binding site), and an index sequence (also referred to as a barcode sequence or unique molecular identifier, UMI). The term "5' adapter" refers to an adapter that is covalently bound directly or indirectly to the 5' end of the insert or is intended to be covalently bound to the 5' end of the insert. The term "3' adapter" refers to an adapter that is covalently bound directly or indirectly to the 3' end of the insert or is intended to be covalently bound to the 3' end of the insert. The length of the adapter is generally about 10 to 150 nucleotides, such as about 10 to 25, 15 to 30, 25 to 40, 30 to 50, 45 to 75, 50 to 100, 90 to 125, or 120 to 150 nucleotides. It should be noted that the term "adapter" is alternatively spelled "adaptor".

[0070] According to aspects of the present disclosure, the 3' adaptor is 5' adenylated at its 5' end to facilitate ligation of the 3' adaptor to the sample nucleic acid and the blocker oligonucleotide.

[0071] According to aspects of the present disclosure, the 5' adenylated 3' linker included in the methods, compositions and / or kits is blocked at the 3' end, for example, by a 2',3'-dideoxynucleotide or a 3'(C3)propyl spacer.

[0072] As used herein, the term "end" of a nucleic acid molecule refers to the end of a linear nucleic acid molecule and can be used interchangeably with the term "terminus" or grammatically appropriate variants such as "termini" in this article. As used herein, the term "end portion" of a nucleic acid molecule refers to the nucleic acid sequence that encompasses the end of a nucleic acid molecule and an adjacent continuous nucleic acid sequence, but does not include the full length of the nucleic acid sequence of the nucleic acid molecule. According to aspects of the present disclosure, the "end portion" of a nucleic acid molecule refers to the nucleic acid sequence that encompasses the end of a nucleic acid molecule and an adjacent continuous nucleic acid sequence that is about half or less of the entire nucleic acid sequence length of the nucleic acid molecule.

[0073] The term "adapter-dimer" refers to an undesirable byproduct formed when a 5' adapter and a 3' adapter are attached to the 5' and 3' ends of a sample nucleic acid in a method of generating a sequencing library. Specifically, an adapter-dimer is the ligation product of the adenylated 5' end of the 3' adapter and the 3' end of the 5' adapter. Adapter-dimers are undesirable in methods of generating sequencing libraries because they can be amplified and compete with sequencing library molecules in aspects of the method of generating sequencing libraries, such as competing for binding sites in a flow cell, thereby significantly reducing sequencing quality.

[0074] As used herein, the term "ligation" refers to the covalent bonding of two linear nucleic acid molecules mediated by a ligase to form a longer linear nucleic acid molecule.

[0075] The terms "ligase enzyme" and "ligase" are used interchangeably herein and refer to an enzyme capable of covalently bonding two adjacent nucleic acids, forming a bond between the two nucleic acids, such as a phosphodiester bond, or, depending on the nature of the terminal nucleotides, a modified covalent bond, such as, but not limited to, a phosphorothioate bond or a phosphoamidate bond. Ligases include, but are not limited to, T7 ligase, T4 ligase, E. coli ligase, and Taq ligase. Ligases include ATP-dependent ligases, NAD+-dependent ligases, and include DNA ligases and RNA ligases, such as members of the enzyme class EC6.5 defined by The International Union of Biochemistry and Molecular Biology, including but not limited to EC 6.5.1.1 (ATP-dependent ligase), EC 6.5.1.2 (NAD+-dependent ligase), EC 6.5.1.3 (RNA ligase), EC 6.5.1.6 DNA ligase (ATP or NAD+), EC 6.5.1.7 DNA ligase (ATP, ADP or GTP) and EC 6.5.1.8 3'-phosphate / 5'-hydroxyl nucleic acid ligase.

[0076] Conditions for using ligases are well known.

[0077] Nucleotides, nucleotide analogs and non-naturally occurring nucleotides

[0078] The term "nucleotide" refers to a molecule comprising a core base, a sugar and a phosphate. A nucleotide is a monomeric unit of a nucleic acid sequence (such as a DNA or RNA sequence). The term nucleotide includes ribonucleoside triphosphates, such as ATP, TTP, UTP, CTP and GTP, and deoxyribonucleoside triphosphates, such as dATP, dCTP, dUTP, dGTP and dTTP. With respect to core bases, nucleotides are commonly referred to as A, T, G, C or U as abbreviations, see Table 1.

[0079] The standard IUPAC nucleotide codes used in this article are shown in Table 1.

[0080]

[0081]

[0082] The terms "nucleic acid", "nucleotide sequence" and "nucleic acid sequence" refer to RNA, DNA or RNA / DNA molecules having more than one nucleotide and / or any form of nucleotide analogs, including linear, single-stranded, double-stranded, oligonucleotides or polynucleotides.

[0083] The term "nucleotide analog" refers to a modified or non-naturally occurring nucleotide, particularly a nucleotide analog that can be polymerized with naturally occurring nucleotides and / or non-naturally occurring nucleotides by template-directed nucleic acid polymerization or non-template-directed nucleic acid polymerization catalyzed by a nucleic acid polymerase. The term "nucleotide analog" refers to a nucleotide containing one or more modifications to the base moiety and / or sugar moiety and / or phosphate moiety, which modifications modify at least one aspect of the chemical properties of the nucleotide analog compared to a reference standard nucleotide, while retaining other properties that allow the nucleotide analog to perform its intended function. Nucleotide analogs and their incorporation into nucleic acids are well known in the art and can be synthesized according to standard procedures and / or commercially available.

[0084] Specific nucleotide analogs are capable of Watson-Crick pairing with complementary nucleotides through hydrogen bonds, and illustratively include, but are not limited to, naturally occurring and non-naturally occurring nucleotides and analogs thereof, including those containing nucleotide bases such as substituted purines or pyrimidines, deazapurines, methylpurines, methylpyrimidines, aminopurines, aminopyrimidines, thiopurines, thiopyrimidines, indoles, pyrroles, 7-deazaguanine, 7-deazaadenine, 7-methylguanine, hypoxanthine, pseudocytosine, pseudoisocytosine, isocytosine, isoguanine, 2-thiopyrimidine, 4-thiothymine, 6-thioguanine, nitropyrroles, nitroindole, and 4-methylindole. Nucleotide analogs include those containing deoxyribose, such as substituted deoxyribose, substituted or unsubstituted arabinose, substituted or unsubstituted xylose, and substituted or unsubstituted pyranose. Nucleotide analogs include those containing phosphate analogs, such as phosphorothioates, phosphorodithioates, phosphoroamidates, phosphoroselenoates, phosphoroanilothioates, phosphoroanilidates, phosphoamidates, boronophosphates, phosphotriesters, and alkylphosphonates, such as methylphosphonate.

[0085] Non-naturally occurring nucleotides (e.g., iso-dG and iso-dC) provide base pairing that is unique to each other, and there is no base pairing (or hybridization) between non-naturally occurring nucleotides and naturally occurring nucleotide bases, such as iso-dG will not pair with dC, and iso-dC will not pair with dG. The term "iso-dG" refers to isoguanosine. It is noteworthy that the term "iisodG" is also used herein to refer to isoguanosine, such as isoguanosine incorporated into the sequence. The term "iso-dC" refers to isocytosine. It is noteworthy that the term "iMe-isodC" is also used herein to refer to isocytosine, such as isocytosine incorporated into the sequence.

[0086] The term "T m " and "melting temperature" refer to the temperature at which 50% (half) of a population of double-stranded nucleic acid molecules become separated (i.e., single stranded). Calculate T m Methods are well known in the art.

[0087] The term "T m The term "increased nucleotide analogs" refers to an increase in the melting temperature (T) of a double-stranded oligonucleotide compared to the same double-stranded oligonucleotide without the nucleotide analogs. m ) nucleotide analogs. mThe added nucleotide analogs may include modified nucleobases, modified sugars, modified phosphates, or a combination of any two or more such modifications.

[0088] T m The added nucleotide analogs include, but are not limited to, locked nucleic acid (LNA) monomers, peptide nucleic acid (PNA) monomers, and bridged nucleic acid (BNA) monomers.

[0089] According to aspects of the present disclosure, a variety of T m Any of the added nucleotide analogs, including but not limited to LNA monomers, PNA monomers, BNA monomers or any two or more thereof.

[0090] The term "LNA monomer" is used interchangeably herein with the terms "LNA nucleotide" and "LNA base", and refers to a nucleotide analog that includes a locked ribose due to the presence of a covalent bond between the 2' oxygen and 4' carbon of the ribose ring, i.e., a 2'-O,4'-C-methylene-β-D-ribofuranosyl monomer, which can be incorporated into an oligonucleotide to produce a "locked nucleic acid". LNA monomers have similar or improved Watson-Crick base pairing selectivity compared to conventional nucleotides. Examples of LNA monomers include, but are not limited to, adenine bicyclic nucleoside monomers, cytosine bicyclic nucleoside monomers, guanine bicyclic nucleoside monomers, 5-methylcytosine bicyclic nucleoside monomers, thymine bicyclic nucleoside monomers, and uracil bicyclic nucleoside monomers. The Tm of an oligonucleotide that includes one or more LNA monomers is increased due to enhanced properties, such as enhanced base stacking. Typically, each LNA monomer incorporated into an LNA oligonucleotide increases the Tm of a by 2 to 8°C. LNA monomers can be synthesized using well-known methods or obtained commercially. The terms "locked nucleic acid" and LNA are used interchangeably herein to refer to an oligonucleotide comprising one or more LNA monomers. A variety of T m Any of the nucleotide analogs that increase the Tm, including but not limited to 5-methyl dC, 2,6-diaminopurine, propynyl-deoxyuridine, 5-hydroxybutynyl-2'-deoxyuridine and any combination of two or more thereof. Any Tm-increasing nucleotide analogs and / or derivatives thereof may be included, as long as the derivative retains the increased melting temperature (Tm) of the double-stranded oligonucleotide including the nucleotide analog compared to the same double-stranded oligonucleotide without the nucleotide analog m ) function.

[0091] According to aspects of the present disclosure, the blocker oligonucleotide has a T in the range of 55°C to 100°C. m, for example 60°C to 100°C, for example 65°C to 100°C, for example 70°C to 100°C, for example 75°C to 99°C, for example 75°C to 90°C, for example 75°C to 85°C, for example 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100°C.

[0092] According to aspects of the present disclosure, a set of blocker oligonucleotides have a T ranging from 55°C to 100°C. m , for example 60°C to 100°C, for example 65°C to 100°C, for example 70°C to 100°C, for example 75°C to 99°C, for example 75°C to 90°C, for example 75°C to 85°C, for example 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100°C.

[0093] According to aspects of the present disclosure, for example, in the post-hybridization capture PCR step, the 3' end of one or more blocker oligonucleotides is optionally modified to prevent polymerase extension from the 3' end. Any of a variety of techniques for modifying the 3' end of one or more blocker oligonucleotides to prevent polymerase extension from the 3' end can be used, including but not limited to removing or modifying the hydroxyl group at the 3' end of the oligonucleotide, for example, including 3' dideoxy-C (ddC), a phosphate group or a 3' spacer. According to aspects of the present disclosure, the spacer is present at the 3' end of the blocker oligonucleotide. A non-limiting example is a 3' spacer C3 (abbreviated as 3SpC3), which is a 3 carbon chain (C3) connected to the terminal 3' hydroxyl of the oligonucleotide blocker. Alternatively, the 3' end of the blocker oligonucleotide is not modified to prevent polymerase extension from the 3' end, for example, if the post-hybridization capture PCR step or other polymerase-mediated extension step post-hybridization capture is not used.

[0094] The terms "hybridization" and "hybridized" refer to the pairing and binding of complementary nucleic acids. Hybridization occurs to varying degrees between two nucleic acids, depending on factors well known in the art, such as the degree of complementarity of the nucleic acids, the melting temperature T of the nucleic acids, and the degree of affinity of the nucleic acids. m The stringency of hybridization conditions and post-hybridization washing conditions. The term "stringency of hybridization conditions" refers to the conditions of the composition of temperature, ionic strength and hybridization medium relative to specific common additives (e.g., formamide, betaine and polyethylene glycol). The term "stringency of post-hybridization washing conditions" refers to the conditions of the composition of temperature, ionic strength and hybridization medium, although additives (e.g., surfactants, formamide, betaine and polyethylene glycol) are not usually used for washing conditions. The specific surfactants that can be used include, for example, SDS (sodium dodecyl sulfate), sodium lauroyl sarcosinate (Sarkosyl) and CTAB (cetyltrimethylammonium bromide). The determination of specific hybridization conditions and post-hybridization wash conditions associated with specific nucleic acids is routine and well known in the art, for example, as described in J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; and FM Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002. High stringency hybridization conditions are those conditions that only allow substantially complementary nucleic acid hybridization. High stringency post-hybridization wash conditions are those conditions that only maintain substantially complementary nucleic acid hybridization. As used herein, the term "annealing" refers to the pairing and binding of an oligonucleotide to a target nucleic acid. There is no deliberate distinction between the terms "annealing" and "hybridizing".

[0095] As used herein, the term "complementary" encompasses, but is not limited to, Watson-Crick base pairing between nucleotides, between nucleotide analogs, or between nucleotides and nucleotide analogs, wherein nucleotides and / or nucleotide analogs are hydrogen bonded to each other, such as thymine or uracil residues connected to adenine residues by two hydrogen bonds, cytosine and guanine residues connected by three hydrogen bonds. Typically, a nucleic acid includes a nucleotide sequence that is described as having "percent complementarity" with a specified second nucleotide sequence. For example, a nucleotide sequence may have 80%, 90%, or 100% complementarity with a specific second nucleotide sequence, indicating that 8 of 10 nucleotides, 9 of 10 nucleotides, or 10 of 10 nucleotides of the sequence are complementary to the specified second nucleotide sequence. For example, the nucleotide sequence 3'-TCGA-5' is 100% complementary to the nucleotide sequence 5'-AGCT-3'. In addition, the nucleotide sequence 3'-TCGA-5' is 100% or fully complementary to the region of the nucleotide sequence 5'-TTAGCTGG-3'. As used herein, the term "complement" refers to a nucleotide sequence that is complementary to a given nucleotide sequence.

[0096] Typically, nucleic acids with about 85-100% complementarity are considered to be highly complementary and hybridize under high stringency conditions. Examples of moderate stringency conditions are conditions for hybridization of nucleic acids with moderate complementarity (about 50-84% complementarity) and nucleic acids with high complementarity. In contrast, low stringency hybridization conditions are conditions for hybridization of nucleic acids with low complementarity. The terms "specific hybridization" and "specifically hybridizes" refer to hybridization of a specific nucleic acid with a target nucleic acid without substantial hybridization with nucleic acids other than the target nucleic acid in the sample.

[0097] The term "palindromic nucleotide sequence" refers to a nucleotide sequence that is an inverted repeat, such that the nucleotide sequence is identical whether read in the 5' to 3' direction or when read from 5' to 3' on the complementary strand. For example, a palindromic nucleotide sequence read from 5' to 3' is 5'-GGATCC-3', which is identical when read from 5' to 3' on the complementary strand, i.e., 3'-CCTAGG-5'.

[0098] Annealing of the blocker oligonucleotide to the excess linker is performed at an annealing temperature. The annealing temperature depends on a variety of factors, including the nucleic acid sequence of the blocker oligonucleotide and the target nucleic acid, as well as the composition of the reaction medium, including a variety of factors such as salt concentration and the concentration of additives, such as but not limited to formamide, betaine, polyethylene glycol, surfactants (e.g., SDS) and DMSO. Typically, the annealing temperature is in the range of 30°C to 65°C, but may be higher or lower. The annealing temperature may be higher or lower than the melting temperature (T m ), however, typically the blocker oligonucleotide according to aspects of the present disclosure has a T above the annealing temperature m To ensure that the blocker oligonucleotide binds to its target, i.e., hybridizes, during the annealing period. Similarly, one or more post-hybridization washes can be performed at a temperature below the T of the blocker oligonucleotide. m carried out at a temperature of .

[0099] After annealing of the blocker oligonucleotides to the excess adapters, a hybridization complex is generated in which the 3' end of the first blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the first unligated 3' adapter and the 3' end of the second blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the second unligated 3' adapter, thereby reducing the excess unligated 3' adapters.

[0100] Optionally, the 3' end of the first blocker oligonucleotide of the hybridization complex is ligated to the adjacent adenylated nucleotide at the 5' end of the first unligated 3' linker, and the 3' end of the second blocker oligonucleotide of the hybridization complex is ligated to the adjacent adenylated nucleotide at the 5' end of the second unligated 3' linker to produce a ligated complex, thereby reducing excess unligated 3' linkers.

[0101] The hybrid complex or ligated complex can be separated from the desired sequencing library molecule. The separation of the hybrid complex or ligated complex from the desired sequencing library molecule can be size-based separation, such as by column-based separation, filter-based separation, gel-based separation, binding of the ligated complex or desired sequencing library molecule to a solid or semi-solid support, followed by separation of unbound material from bound material. According to aspects of the present disclosure, the solid support comprises magnetic beads.

[0102] Amplification of the template DNA is achieved using an in vitro amplification method. The terms "amplify," "amplification," and "amplifying" are generally used to refer to methods or techniques for replicating a template nucleic acid to produce a nucleic acid comprising a copy of all or a portion of the template nucleic acid, the resulting nucleic acid also being referred to as an amplicon. Amplification methods included in embodiments of the present invention include template-directed primer extension catalyzed by a nucleic acid polymerase, using a pair of primers flanking the target nucleic acid, illustratively including but not limited to polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR). Ligation-mediated PCR (LM-PCR), phi-29 PCR, real-time quantitative PCR (qPCR), whole genome amplification and other nucleic acid amplification methods, for example, as described in CW Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2003; V. Demidov et al., DNA Amplification: Current Technologies and Applications, Taylor & Francis, 2004; and Kroneis, T. (Ed.), Whole Genome Amplification: Methods and Protocols (Methods in Molecular Biology), 2015, Humana Press ISBN-10: 1493929895.

[0103] The term "isothermal amplification" refers to nucleic acid amplification, which includes a single temperature amplification and thus avoids the need for thermal cycling (as in PCR). Examples of isothermal amplification include, but are not limited to, circular helicase-dependent amplification (cHDA), genomic exponential amplification reaction (GEAR), helicase-dependent amplification (HDA), isothermal multiple displacement amplification (IMDA), loop-mediated isothermal amplification (LAMP), multiple displacement amplification (MDA), nickase amplification reaction (NEAR), nucleic acid sequence-based amplification (NASBA), ramification amplification (RAM), recombinase polymerase amplification (RPA), rolling circle amplification (RCA), self-directed sequence replication (3SR), signal-mediated RNA technology amplification (SMART), strand displacement amplification (SDA), single primer isothermal amplification (SPIA), and transcription-mediated amplification (TMA).

[0104] The terms "amplified nucleic acid," "amplified DNA," and "amplicon," and their plural forms, refer to the product of a process in which a target nucleic acid template is replicated.

[0105] The amplified nucleic acid optionally contains additional materials, such as, but not limited to, nucleic acid sequences, functional groups for chemical reactions, and detectable labels, which are present in the primers and not present in the original nucleic acid template. Non-limiting examples of primer-derived nucleic acid sequences that can be incorporated into the amplicon and thus into the generated library include universal sequences, adapters, index sequences, recognition sequences, detection sequences, sorting sequences, capture sequences, restriction enzyme sites, sequencing primer binding site sequences, and amplification primer binding site sequences.

[0106] The term "universal sequence" refers to a nucleic acid sequence present in multiple nucleic acid molecules, which also contains a nucleic acid sequence that is not common to the multiple nucleic acid molecules. Universal sequences allow multiple nucleic acid molecules to share common functional aspects, such as binding to specific primers or capture moieties. Non-limiting examples of universal extension primer binding sites include sequences that are identical or complementary to P5 and P7 primers. P5 and P7 primers, their complements and uses are known in the art (e.g., for capture onto flow cell substrates in flow cells for next generation sequencing (NGS)), such as described in WO2015106941.

[0107] According to aspects of the present disclosure, index sequences are incorporated into amplicons during library preparation. An index sequence is a unique nucleic acid sequence common to a group of amplicons, such as used to identify the group of amplicons as being derived from a specific source. Index sequences allow for multiplexing, as multiple nucleic acids from different sources can be combined for sequencing, and, if desired, can be "demultiplexed" later for data analysis.

[0108] The term "primer" refers to an oligonucleotide that is capable of acting as a template-directed site of synthesis initiation of a primer extension product under conditions that induce synthesis of an oligonucleotide primer extension product complementary to a template nucleic acid. Such conditions include the presence of nucleotides and / or nucleotide analogs and a suitable polymerase at a suitable temperature and pH.

[0109] The length of the primer is generally about 10-30 continuous nucleotides, and can be longer or shorter. The oligonucleotide primer is completely or substantially complementary to the region of the template nucleic acid, so that under hybridization conditions, the oligonucleotide primer anneals to the complementary region of the template nucleic acid. Suitable reaction conditions for synthesizing primer extension products according to aspects of the present disclosure include the presence of suitable reaction components, including but not limited to polymerase; and nucleotides and / or nucleotide analogs.

[0110] A variety of primers can be used in methods according to aspects of the present disclosure, such as amplification primers, sequencing primers, and primers for reverse transcription.

[0111] Primer design is well known to those skilled in the art and is designed according to well-known methods and standards. For example, when a pair of primers is used, such as in an amplification reaction, the annealing temperatures of the primers should be approximately the same (within a few degrees). Typically, primers should not form dimers with each other, and primers should not form secondary structures, such as hairpins. Methods and considerations for primer design and amplification procedures are described in detail in Yuryev, A., PCR Primer Design, Methods in Molecular Biology, vol. 42, Human Press, 2007; CW Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2003; and V. Demidov et al., DNA Amplification: Current Technologies and Applications, Taylor & Francis, 2004.

[0112] Primer extension to generate the first strand of complementary DNA is accomplished using a polymerase under extension reaction conditions compatible with the polymerase activity to generate the complementary strand. Specific conditions and protocols for primer extension are described in detail in J. Sambrook and D. W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; and FM Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002.

[0113] According to aspects of the present disclosure, the sample nucleic acid is RNA, ie, sample RNA, and the sample RNA is reverse transcribed to produce cDNA. The sample RNA can be reverse transcribed before or after adding an adapter.

[0114] According to aspects of the methods of the present disclosure, the methods include annealing a reverse transcription primer to a target nucleic acid, the target nucleic acid including RNA; and reverse transcribing the RNA to produce a first strand complementary DNA (cDNA) complementary to the RNA.

[0115] Annealing of the reverse transcription primer or reverse transcription primer set with the target nucleic acid is performed at an annealing temperature. The annealing temperature depends on various factors, including the nucleic acid sequence of the reverse transcription primer or primer and the target nucleic acid, and the composition of the reaction medium, including various factors, such as the concentration of salt concentration and additives, such as but not limited to formamide, betaine, polyethylene glycol, SDS and DMSO. Typically, the annealing temperature is in the range of 30°C to 65°C, but can be higher or lower. The annealing temperature can be higher or lower than the reverse transcription primer melting temperature (Tm). Typically, the annealing temperature is higher than the Tm of the reverse transcription primer to improve the stringency of the reaction.

[0116] According to the present disclosure, a method for producing a sequencing library is provided, which includes reverse transcribing a target RNA to produce a first strand complementary DNA (cDNA), wherein the method is performed using a reverse transcriptase under reaction conditions compatible with the reverse transcriptase activity of the transcribed target RNA. The specific conditions and protocols for reverse transcription are described in detail in J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; and FM Ausubel Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002.

[0117] According to the present disclosure, a method for producing a sequencing library is provided, which further includes polymerizing a second DNA strand complementary to the first strand cDNA to produce a double-stranded cDNA. Polymerizing the second DNA strand complementary to the first strand cDNA may include providing a suitable DNA polymerase and polymerizing under reaction conditions compatible with the activity of the DNA polymerase that produces the double-stranded cDNA to produce the double-stranded cDNA.

[0118] Suitable polymerases may include bacterial DNA polymerases, eukaryotic 30 DNA polymerases, archaeal DNA polymerases, viral DNA polymerases, Taq polymerases, DNA polymerase I, T4 DNA polymerases, Pfu polymerases, and bacteriophage DNA polymerases, including the Klenow fragment of DNA polymerase I, SEQUENASE 1.0 and SEQUENASE 2.0 (USBiochemical), T5 DNA polymerase, and Phi29 DNA polymerase, among others.

[0119] Sequencing of the amplicons is accomplished using any of a variety of sequencing methods, including traditional Sanger sequencing and massively parallel sequencing methods ("next generation sequencing").

[0120] Advantageously, paired end reads are performed. The term "paired end reads" refers to a sequencing technique that includes a sequencing "read" from each end of the amplicon to be sequenced. This allows for greater sequencing data yield and increases confidence in the sequencing results.

[0121] According to aspects of the present disclosure, excess unconnected 3' adapters are reduced but not eliminated by forming a hybridization complex or a ligation complex, so that the step of connecting a 5' adapter to a library insert also includes connecting a 5' adapter to some excess unconnected 3' adapters to produce adapter-dimers, wherein the 5' adapter is covalently bound by connecting to the 3' adapter at the 5' adapter-3' adapter interface. Therefore, according to aspects of the present disclosure, the method of reducing adapter-dimers in a sequencing library further includes inhibiting the amplification of adapter-dimers in an amplification reaction, so that the sequencing library molecules are selectively enriched by the amplification reaction compared to the adapter-dimers.

[0122] According to aspects of the disclosure, inhibiting amplification of adaptor-dimers comprises removing at least some adaptor-dimers prior to amplification.

[0123] According to aspects of the present disclosure, removing at least some linker-dimers prior to amplification comprises one or more of: 1) specific enzymatic cleavage of linker-dimers; 2) CRISPR / Cas9-based cleavage of linker-dimers; 3) gel purification; 4) SPRI-bead-based size selection; and 5) adding a linker-dimer blocker oligonucleotide to the mixture that effectively inhibits amplification of linker-dimers.

[0124] The specific enzymatic cleavage of the adapter-dimer refers to the use of a restriction endonuclease to cut the adapter-dimer into two or more fragments, thereby reducing the number of adapters-dimers. The nucleotide sequence of the adapter-dimer can be analyzed to determine which restriction endonuclease will cut the adapter-dimer, or a variety of restriction endonucleases can be measured to determine which restriction endonuclease effectively cuts the adapter-dimer, preventing the amplification of the adapter-dimer.

[0125] CRISPR / Cas-based cutting refers to using the CRISPR / Cas system to cut the adapter-dimer into two or more fragments, thereby reducing the number of adapter-dimers. According to aspects of the present disclosure, the adapter-dimer contains a CRISPR stem-loop and the Cas protein recognizes the stem-loop, cuts the adapter-dimer, or binds to the stem-loop with high affinity without cutting the adapter-dimer, thereby preventing the expansion of the adapter-dimer.

[0126] Solid Phase Reversible Immobilization (SPRI)-bead-based size selection can be used to separate adapter-dimers from sequencing library molecules in a mixture, either by immobilizing the adapter-dimers on a solid support and removing the solid support with the immobilized adapter-dimers from the mixture, or by immobilizing the sequencing library molecules on a solid support and removing the solid support with the immobilized sequencing library molecules from the mixture, followed by eluting the sequencing library molecules from the solid support.

[0127] The term "adapter-dimer blocker oligonucleotide" refers to an oligonucleotide that specifically hybridizes with at least a portion of an adapter-dimer containing an amplification primer binding site to prevent adapter-dimer amplification. The length of the adapter-dimer blocker oligonucleotide is in the range of about 10 to about 300 nucleotides, depending on various factors, such as the size of the adapter-dimer and hybridization conditions to be used. According to aspects of the present disclosure, the length of the adapter-dimer blocker oligonucleotide is in the range of about 10 to about 300 nucleotides, about 10 to about 200 nucleotides, about 10 to about 100 nucleotides, about 10 to about 75 nucleotides, about 10 to about 50 nucleotides, about 10 to about 40 nucleotides, about 10 to about 30 nucleotides, or about 10 to about 20 nucleotides. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the linker-dimer blocker oligonucleotide are non-naturally occurring nucleotides. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the linker-dimer blocker oligonucleotide are T m According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the linker-dimer blocker oligonucleotide are LNA monomers, PNA monomers, BNA monomers, other T m Increased nucleotide analogs, or any two or more thereof. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the linker-dimer blocker oligonucleotide are LNA monomers.

[0128] An example of a linker-dimer blocker oligonucleotide is 5'-C+G+AG+AA+T+T+CC+A+GA+T+CG+T+C+G+GA+C+T+G-3' (SEQ ID NO: 2), wherein + represents an LNA base (i.e., an incorporated LNA monomer). In a preferred example, 3SpC3 (3'(C3)propyl spacer) is present at the 3' end.

[0129] According to aspects of the present disclosure, a kit for reducing adapter-dimers in a sequencing library is provided, comprising one or more blocker oligonucleotides and / or blocker oligonucleotide pairs for reducing adapter-dimers in a sequencing library.

[0130] According to aspects of the present disclosure, a kit for reducing adapter-dimers in a sequencing library further comprises one or more adapter-dimer blocker oligonucleotides effective to block adapter-dimer amplification.

[0131] According to aspects of the present disclosure, a kit for reducing adapter-dimers in a sequencing library is provided, comprising an adapter-dimer blocker oligonucleotide complementary to one or more adjacent portions of an adapter-dimer, the one or more adjacent portions comprising at least one nucleotide of a 5' adapter at a 5' adapter-3' adapter interface, and an adjacent portion of a 3' adapter comprising an amplification primer binding site.

[0132] The kit according to aspects of the present disclosure includes one or more blocker oligonucleotides and / or one or more joint-dimer blocker oligonucleotides in aqueous, buffered or lyophilized form. The one or more blocker oligonucleotides and / or one or more joint-dimer blocker oligonucleotides can be packaged together or separately. One or more blocker oligonucleotides and / or one or more joint-dimer blocker oligonucleotides can be divided into an amount suitable for sequencing library preparation, or can be packaged in bulk for users to divide equally. Additional kit components may include but are not limited to buffer, diluent, stabilizer, preservative, reagent such as nucleotide, nucleotide analogs and enzyme.

[0133] Compositions and methods according to aspects of the present disclosure have utility in many applications, including but not limited to reducing adapter-dimers sequenced in sequencing protocols, particularly in sequencing libraries comprising small inserts.

[0134] Compositions and methods according to aspects of the present disclosure provide high sensitivity, allowing for more frequent detection of rare nucleic acids present in a sample. Reliable detection of rare nucleic acids allows for diagnostic and therapeutic methods of analyzing nucleic acids in patient samples.

[0135] Embodiments of the compositions and methods of the present invention are illustrated in the following examples. These examples are provided for illustrative purposes and are not to be construed as limiting the scope of the compositions and methods of the present invention.

[0136] Example

[0137] Example 1

[0138] 3' adapter ligation

[0139] a. Combine the following ingredients on ice:

[0140] i. 1μL input RNA (1ng / μL)

[0141] ii.9.5 μL nuclease-free water

[0142] iii. 1 μL 5 uM 3' linker C3 / 5rApp / TGGAATTCTCGGGTGCCAAGG / 3SpC3 / (SEQ ID NO:3)

[0143] iv.7 μL 3' ligation buffer

[0144] v.1.5μL 3' Ligase Mix

[0145] vi. 20 μL total reaction volume

[0146] b. Incubate as follows:

[0147] i. 1 hour at 25°C

[0148] ii. Keep at 4℃

[0149] Inactivation of unligated 3' linkers

[0150] a. On ice, add 1 μL of 10 μM oligonucleotide blocker with palindromic 3' ends to the reaction and mix until uniform 5'-CACCCGAGAATTCCAC / iisodG / / iMe-isodC / / iisodG / / iMe-isodC / G-3' (SEQ ID NO: 1). Note that in this example, the palindromic 3' end of the oligonucleotide blocker allows the 3' portions of the two oligonucleotide blocker molecules to hybridize with each other, and the 5' portion of the blocker oligonucleotide hybridizes with the excess 3' linker under hybridization conditions to form a hybridization complex.

[0151] b. Incubate as follows:

[0152] i. 10 minutes at 70°C

[0153] ii. Maintain at 4°C

[0154] 5' adapter ligation

[0155] a. Combine the following ingredients on ice:

[0156] i. 21 μL of the reaction from the previous step

[0157] ii. 1.5 μL 2.5 uM 5' linker 5'-rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC-3' (SEQ ID NO:4) - Note that "r" is used here to emphasize that the nucleotides shown are ribonucleotides.

[0158] iii.1.5μL 10mM ATP (NEB cat#P0756L)

[0159] iv.2 μL 5' ligase mixture

[0160] v.26μL total reaction volume

[0161] b. Incubate as follows:

[0162] i. 1 hour at 20℃

[0163] ii. Keep at 4℃

[0164] Reverse transcription

[0165] a. Start on a thermal cycler using 26 μL of the 5' ligation reaction from the previous step.

[0166] b. Program the thermal cycler as follows:

[0167] i. 2 minutes at 70°C

[0168] ii. 30 minutes at 50°C

[0169] iii. 5 minutes at 90℃

[0170] iv. Maintain at 4°C

[0171] c. Prepare RT master mix as follows:

[0172] i. 13 μL RT buffer

[0173] ii. 1 μL 25 uM RT primer 5'-CCTTGGCACCCGAGAATTCCA-3' (SEQ ID NO: 5)

[0174] iii.2μL EnzScript reverse transcriptase (Enzymatics)

[0175] iv. 16 μL total volume.

[0176] d. Start the program on the thermal cycler using 26 μL of the mixture from step a above in the 5' adapter ligation section.

[0177] e. After the thermocycler has ramped down to 50°C, add 16 μL of the RT master mix and mix on the thermocycler. Do not remove the reaction from the thermocycler.

[0178] f. Allow incubation to complete and gradually decrease to 4°C.

[0179] Bead cleanup

[0180] a. Add and mix 40 μL of adapter depletion solution

[0181] b. Add and mix 40 μL NEXTFLEX Cleanup beads

[0182] c. Add and mix 90 μL of isopropanol

[0183] d. Incubate at room temperature for 5 minutes

[0184] e. Place on a magnetic stand for 5 minutes or until the solution is clear

[0185] f. Remove the supernatant by suction

[0186] g. Wash by adding 200 μL 80% ethanol, incubate for 30 seconds, and remove the supernatant by aspiration

[0187] h. Repeat the above steps and wash 2 times

[0188] i. Dry on the magnetic stand for a total of 3 minutes. After 1 minute, aspirate and remove any liquid collected at the bottom of the wells

[0189] j. Remove from magnetic stand and resuspend in 40 μL nuclease-free water

[0190] k. Incubate for 2 minutes

[0191] l. Place on a magnetic stand

[0192] m. Once the beads form a pellet, take 18 μL and add it to a strip tube. This pure cDNA is saved as a backup.

[0193] n. Take another 18 μL and transfer to a new well. This cDNA will be amplified in the following steps.

[0194] PCR

[0195] a. Combine the following ingredients on ice:

[0196] i. 18 μL cDNA from step 5n above

[0197] ii. 2μL NEXTFLEX UDI Barcoded Primer Mix

[0198] iii.5 μL NEXTFLEX PCR Master Mix

[0199] iv. 1 μL 10 μM long dblock02C3 (or water) 5'-C+G+AG+AA+T+T+CC+A+GA+T+CG+T+C+G+GA+C+T+G / 3SpC3 / (SEQ ID NO:2)

[0200] v.26μL total reaction volume

[0201] b. Incubate the reaction as follows:

[0202] i. 98℃ for 30 seconds

[0203] ii. 98℃ for 10 seconds

[0204] iii. 65℃ for 20 seconds, repeat for 22 cycles

[0205] iv. 15 seconds at 72°C

[0206] v. 72℃ for 2 minutes

[0207] vi. Keep at 4°C

[0208] Bead purification

[0209] a. Take 25 μL of the PCR reaction from the previous step

[0210] b. Add and mix 48.6 μL NEXTFLEX Cleanup beads

[0211] c. Incubate at room temperature for 5 minutes

[0212] d. Place on magnetic stand for 5 minutes or until solution is clear

[0213] e. Remove the supernatant by suction

[0214] f. Wash by adding 200 μL 80% ethanol, incubate for 30 seconds, and remove the supernatant by aspiration

[0215] g. Repeat the above steps and wash 2 times

[0216] h. Dry on the magnetic stand for a total of 3 minutes. After 1 minute, aspirate and remove any liquid collected at the bottom of the wells.

[0217] i. Remove from magnetic stand and resuspend in 20 μL nuclease-free water

[0218] j. Incubate for 2 minutes

[0219] k. Place on a magnetic stand

[0220] l. Once the beads have formed a pellet, remove 18 μL. This is your sequencing library.

[0221] Sequencing parameters (MiSeq)

[0222] a.2% phiX

[0223] b.1x 76

[0224] The results are as follows Figure 3shown.

[0225] Example 2

[0226] 1.3' connector connection

[0227] a. Combine the following ingredients on ice:

[0228] i. "X" μL input RNA (1ng total RNA)

[0229] ii.1 μL tRNA / YRNA Blocking Reagent

[0230] iii. "Y" μL nuclease-free water

[0231] iv. 1 μL 3' adenylated linker 5'-rApp / TGGAATTCTCGGGTGCCAAGG / 3SpC3 / -3' (SEQ ID NO: 3)

[0232] v.12.5μL 3' Ligation Buffer

[0233] vi. 1.5 μL 3' ligase mixture

[0234] vii. 20 μL total reaction volume (water and RNA should equal 4 μL total volume)

[0235] viii. Mix viscous reactions by vortexing for at least 3 seconds until homogeneous.

[0236] b. Incubate as follows:

[0237] i. 1 hour at 25°C

[0238] ii. Maintain at 4°C

[0239] 2. Inactivation of the unligated 3' linker

[0240] a. On ice, add 4 μL of adapter inactivation mix, including an oligonucleotide blocker with a palindromic 3' end: 5'-CACCCGAGAATTCCAC / iisodG / / iMe-isodC / / iisodG / / iMe-isodC / G-3' (SEQ ID NO: 1), to the reaction and mix until homogeneous.

[0241] b. Incubate as follows:

[0242] i. 2 minutes at 70°C

[0243] ii. Maintain at 4°C

[0244] (The reaction product should turn yellow)

[0245] 3.5' connector connection

[0246] a. Combine the following ingredients on ice:

[0247] i. 24 μL of the reaction from the previous step

[0248] ii.1μL 5' adapter 5'-UCUUUCCCUACACGACGCUCUUCCGAUCU-3' (SEQ ID NO: 6)

[0249] iii. 3 μL 5' ligation buffer

[0250] iv.2 μL 5' ligase mixture

[0251] v.30μL total reaction volume

[0252] b. Incubate as follows:

[0253] i. 1 hour at 20℃

[0254] ii. Keep at 4℃

[0255] (The reaction should turn orange)

[0256] 4. Reverse Transcription

[0257] a. Combine the following ingredients on ice:

[0258] i.7 μL RT buffer

[0259] iii.2 μL RT enzyme mix

[0260] iv. 1 μL 25 uM RT primer 5'-CCTTGGCACCCGAGAATTCCA-3' (SEQ ID NO: 5)

[0261] v.40μL total reaction volume

[0262] b. Incubate as follows:

[0263] ii. 60 minutes at 50°C

[0264] iii. 5 minutes at 90℃

[0265] iv. Maintain at 4°C

[0266] c. Allow incubation to complete and gradually decrease to 4°C.

[0267] 5. Bead Purification

[0268] a. Add and mix 40 μL of adapter depletion solution

[0269] b. Add and mix 40 μL NEXTFLEX Cleanup beads

[0270] c. Add and mix 90 μL of isopropanol

[0271] d. Incubate at room temperature for 5 minutes

[0272] e. Place on magnetic stand for 5 minutes or until solution is clear

[0273] f. Remove the supernatant by suction

[0274] g. Wash by adding 200 μL 80% ethanol, incubate for 30 seconds, and remove the supernatant by aspiration.

[0275] h. Repeat the above steps and wash 2 times

[0276] i. Dry on the magnetic stand for a total of 3 minutes. After 1 minute, aspirate and remove any liquid collected at the bottom of the wells

[0277] j. Remove from magnetic stand and resuspend in 18 μL nuclease-free water

[0278] k. Incubate for 2 minutes

[0279] l. Place on a magnetic stand

[0280] m. Take 16 μL and transfer to a new well. This cDNA will be amplified in the following steps.

[0281] 6.PCR

[0282] a. Combine the following ingredients on ice:

[0283] i. 16 μL cDNA from the previous step m from the bead purification section above

[0284] ii. 4 μL RNAUDI Barcoded Primer Mix 12.5 μM

[0285] iii.6 μL NEXTFLEX Small RNA PCR Master Mix

[0286] iv.26 μL total reaction volume

[0287] b. Incubate the reaction as follows:

[0288] i. 98℃ for 30 seconds

[0289] ii. 98℃ for 10 seconds

[0290] iii. 20 seconds at 65°C

[0291] iv. 15 seconds at 72°C

[0292] Repeat ii, iii and iv for a total of 22 cycles

[0293] v. 72℃ for 2 minutes

[0294] vi. Keep at 4°C

[0295] 7. Double-sided beads purification

[0296] a. Take 26 μL of the PCR reaction from the previous step

[0297] b. Add and mix 34 μL NEXTFLEX Cleanup beads

[0298] c. Incubate at room temperature for 5 minutes

[0299] d. Transfer 56 μL of supernatant to a new well

[0300] e. Add and mix 13 μL NEXTFLEX Cleanup beads

[0301] d. Place on magnetic stand for 5 minutes or until solution is clear

[0302] e. Remove the supernatant by suction

[0303] f. Wash by adding 200 μL 80% ethanol, incubate for 30 seconds, and remove the supernatant by aspiration

[0304] g. Repeat the above steps and wash 2 times

[0305] h. Dry on the magnetic stand for a total of 3 minutes. After 1 minute, aspirate and remove any liquid collected at the bottom of the wells.

[0306] i. Remove from magnetic stand and resuspend in 17 μL nuclease-free water

[0307] j. Incubate for 2 minutes

[0308] k. Place on a magnetic stand

[0309] l. Once the beads have formed a pellet, remove 15 μL. This is your sequencing library.

[0310] 8. Sequencing parameters (MiSeq)

[0311] a.2% phiX

[0312] b.1x 75

[0313] The results are as follows Figure 4 shown.

[0314] project

[0315] Item 1. A method for reducing adapter-dimers in a sequencing library, comprising:

[0316] In a mixture under ligation reaction conditions, sample nucleic acids each having a 5' end and a 3' end are combined with a 3' adapter and a ligase, wherein each 3' adapter has a 5' end portion of at least 8 nucleotides in length and a 5' end that is an adenylated nucleotide, to produce 1) first ligation products, each of which includes the 3' end of the sample nucleic acid ligated to the 5' end of the 3' adapter, and 2) excess unligated 3' adapter in the mixture;

[0317] Adding a blocker oligonucleotide to the mixture comprises:

[0318] a) a first blocker oligonucleotide comprising:

[0319] i) a first blocker oligonucleotide 5' portion that is at least 8 nucleotides in length, and ii) a first blocker oligonucleotide 3' portion that is at least 1 to 20 nucleotides in length and includes the 3' end of the first oligonucleotide, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; and

[0320] b) a second blocker oligonucleotide comprising:

[0321] iii) a second oligonucleotide 5' portion of at least 8 nucleotides in length, and iv) a second blocker oligonucleotide 3' portion of at least 1 to 20 nucleotides in length and including the second blocker oligonucleotide 3' end, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide;

[0322] wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other;

[0323] wherein the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to the 5' end portion of the 3' adapter;

[0324] The mixture is incubated under hybridization conditions such that the 3' portion of the first blocker oligonucleotide hybridizes to the 3' portion of the second blocker oligonucleotide, the 5' portion of the first blocker oligonucleotide hybridizes to excess unligated 3' adapters, and the 5' portion of the second blocker oligonucleotide hybridizes to excess unligated 3' adapters, producing a hybridization complex wherein the 3' end of the first blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the first unligated 3' adapter and the 3' end of the second blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the second unligated 3' adapter, thereby reducing excess unligated 3' adapters in the mixture and producing a purified mixture.

[0325] Item 2. A method according to Item 1, wherein the 3' end of the first blocker oligonucleotide and the 3' end of the second blocker oligonucleotide are both capable of connecting to the adenylated nucleotide at the 5' end of the excess unconnected 3' linker; and further comprising connecting the 3' end of the first blocker oligonucleotide of the hybridization complex to the adjacent adenylated nucleotide at the 5' end of the first unconnected 3' linker, and connecting the 3' end of the second blocker oligonucleotide of the hybridization complex to the adjacent adenylated nucleotide at the 5' end of the second unconnected 3' linker, to produce a connection complex, thereby reducing the excess unconnected 3' linkers in the mixture and producing a purified mixture.

[0326] Item 3. A method according to Item 1 or 2, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the first blocker oligonucleotide are non-naturally occurring nucleotide analogs, and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the second blocker oligonucleotide are non-naturally occurring nucleotide analogs.

[0327] Item 4. A method according to any one of Items 1, 2 or 3, wherein when the lengths of the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides, the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each include a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is the same as the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion.

[0328] Item 5. The method according to any one of items 1 to 4 further comprises: adding a 5' adapter to the mixture, wherein the 5' adapter has a 3' end, wherein the first connection products each include the 3' end of the sample nucleic acid connected to the 5' end of the 3' adapter, and the 5' end of the sample nucleic acid connected to the 3' end of the 5' adapter, thereby generating a sequencing library molecule, wherein the sequencing library molecule includes a sample nucleic acid insert located between and bound to the 5' adapter and the 3' adapter.

[0329] Item 6. The method according to any one of Items 1 to 5 further comprises: adding a 5' adapter to the purified mixture; and incubating the purified mixture under ligation reaction conditions, thereby 1) ligating the 5' adapter to the first ligation product to produce a sequencing library molecule, wherein the sequencing library molecule comprises a sample nucleic acid insert located between and bound to the 5' adapter and the 3' adapter.

[0330] Item 7. A method according to any one of Items 1 to 6, wherein excess unconnected 3' adapters are reduced but not eliminated, so that the connection includes connecting the 5' adapter to at least a portion of the excess unconnected 3' adapters to produce an adapter-dimer, which includes a 5' adapter bound to the 3' adapter at the 5' adapter-3' adapter interface; further includes inhibiting the amplification of the adapter-dimer in the amplification reaction, so that the sequencing library molecules are selectively enriched by the amplification reaction compared to the adapter-dimer.

[0331] Item 8. A method according to any one of Items 1 to 7, wherein inhibiting amplification of adapter-dimers comprises removing at least some adapter-dimers prior to amplification.

[0332] Item 9. A method according to Item 7 or 8, wherein inhibiting the amplification of the linker-dimer may include one or more of the following: specific enzymatic cleavage of the linker-dimer; CRISPR / Cas9-based cleavage of the linker-dimer; gel purification; SPRI bead-based size selection; and adding a linker-dimer blocker oligonucleotide to the mixture, wherein the linker-dimer blocker oligonucleotide effectively inhibits the amplification of the linker-dimer.

[0333] Item 10. A method according to Item 9, wherein the linker-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the linker-dimer, wherein the one or more adjacent portions include at least one nucleotide of the 5' linker at the 5' linker-3' linker interface, and an adjacent portion of the 3' linker including an amplification primer binding site.

[0334] Item 11. The method according to any one of Items 1 to 10, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

[0335] Item 12. The method according to Item 1, wherein the sample nucleic acid is or includes RNA, and further includes reverse transcribing the RNA to produce reverse transcribed sequencing library molecules.

[0336] Item 13. A method according to Item 1, wherein the sample nucleic acid is or includes DNA.

[0337] Item 14. The method according to Item 12 or 13 further comprises amplifying the sequencing library molecules.

[0338] Item 15. An oligonucleotide pair for reducing adapter-dimers in a sequencing library, comprising:

[0339] a) a first blocker oligonucleotide comprising:

[0340] i) a first blocker oligonucleotide 5' portion that is at least 8 nucleotides in length, and ii) a first blocker oligonucleotide 3' portion that is at least 1 to 20 nucleotides in length and includes the 3' end of the first oligonucleotide, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; and

[0341] b) a second blocker oligonucleotide comprising:

[0342] iii) a second oligonucleotide 5' portion of at least 8 nucleotides in length, and iv) a second blocker oligonucleotide 3' portion of at least 1 to 20 nucleotides in length and including the second blocker oligonucleotide 3' end, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide;

[0343] wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; and

[0344] wherein the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to the 5' end portion of the 3' adapter;

[0345] Item 16. An oligonucleotide pair for reducing adapter-dimers in a sequencing library according to Item 15, wherein the 3' end of the first blocker oligonucleotide and the 3' end of the second blocker oligonucleotide are both capable of ligating to the adenylated nucleotide at the 5' end of excess unligated 3' adapter.

[0346] Item 17. An oligonucleotide pair for reducing adapter-dimers in a sequencing library according to Item 15 or 16, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the first blocker oligonucleotide are non-naturally occurring nucleotide analogs, and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the second blocker oligonucleotide are non-naturally occurring nucleotide analogs.

[0347] Item 18. An oligonucleotide pair for reducing adapter-dimers in a sequencing library according to any one of Items 15, 16 or 17, wherein when the lengths of the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides, the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each include a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is the same as the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion.

[0348] Item 19. An oligonucleotide pair for reducing adapter-dimers in a sequencing library according to any one of Items 15 to 18, wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length in the range of about 11 to about 50 nucleotides.

[0349] Item 20. An oligonucleotide pair for reducing adapter-dimers in a sequencing library according to any one of Items 15 to 19, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

[0350] Item 21. A kit for reducing adapter-dimers in a sequencing library, comprising the oligonucleotide pair of any one of items 15 to 20.

[0351] Item 22. The kit according to Item 21 further comprises an adapter-dimer blocker oligonucleotide that effectively blocks adapter-dimer amplification.

[0352] Item 23. A kit according to Item 22, wherein the linker-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the linker-dimer, wherein the one or more adjacent portions include at least one nucleotide of the 5' linker at the 5' linker-3' linker interface, and an adjacent portion of the 3' linker including an amplification primer binding site.

[0353] Item 24. The method according to any one of Items 1 to 14 or the kit according to any one of Items 21 to 23, wherein the first blocker and the second blocker have the same nucleic acid sequence.

[0354] Item 25. The method according to any one of Items 1 to 14 or the kit according to any one of Items 21 to 24, wherein the first blocker and the second blocker have different nucleic acid sequences.

[0355] Item 26. A method, kit or oligonucleotide pair substantially as shown or described herein.

[0356] Item 27. The method according to any one of Items 1 to 14, wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length in the range of about 11 to about 50 nucleotides.

[0357] Any patents or publications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0358] The compositions and methods described herein currently represent preferred embodiments, are exemplary, and are not intended to be limitations on the scope of the invention. Those skilled in the art will appreciate changes and other uses therein. Such changes and other uses may be made without departing from the scope of the invention set forth in the claims.

Claims

1. A method for reducing adapter-dimers in a sequencing library, comprising: In a mixture under ligation reaction conditions, sample nucleic acids each having a 5' end and a 3' end are combined with a 3' adapter and a ligase, wherein each 3' adapter has a 5' end portion of at least 8 nucleotides in length and a 5' end that is an adenylated nucleotide, to produce 1) first ligation products, each of which includes the 3' end of the sample nucleic acid ligated to the 5' end of the 3' adapter, and 2) excess unligated 3' adapter in the mixture; Adding a blocker oligonucleotide to the mixture comprises: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion that is at least 8 nucleotides in length, and ii) a first blocker oligonucleotide 3' portion that is at least 1 to 20 nucleotides in length and includes the 3' end of the first oligonucleotide, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; and b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5' portion of at least 8 nucleotides in length, and iv) a second blocker oligonucleotide 3' portion of at least 1 to 20 nucleotides in length and including the second blocker oligonucleotide 3' end, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; wherein the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to the 5' end portion of the 3' adapter; The mixture is incubated under hybridization conditions such that the 3' portion of the first blocker oligonucleotide hybridizes to the 3' portion of the second blocker oligonucleotide, the 5' portion of the first blocker oligonucleotide hybridizes to excess unligated 3' adapters, and the 5' portion of the second blocker oligonucleotide hybridizes to excess unligated 3' adapters, producing a hybridization complex wherein the 3' end of the first blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the first unligated 3' adapter and the 3' end of the second blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the second unligated 3' adapter, thereby reducing excess unligated 3' adapters in the mixture and producing a purified mixture.

2. The method according to claim 1, wherein the 3' end of the first blocker oligonucleotide and the 3' end of the second blocker oligonucleotide are both capable of connecting to the adenylated nucleotide at the 5' end of the excess unconnected 3' linker; and further comprising connecting the 3' end of the first blocker oligonucleotide of the hybrid complex to the adjacent adenylated nucleotide at the 5' end of the first unconnected 3' linker, and connecting the 3' end of the second blocker oligonucleotide of the hybrid complex to the adjacent adenylated nucleotide at the 5' end of the second unconnected 3' linker, to produce a connection complex, thereby reducing the excess unconnected 3' linker in the mixture and producing a purified mixture.

3. The method of claim 1 or 2, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the first blocker oligonucleotide are non-naturally occurring nucleotide analogues, and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the second blocker oligonucleotide are non-naturally occurring nucleotide analogues.

4. The method according to any one of claims 1, 2 or 3, wherein when the length of the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides, the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each comprise a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is the same as the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion.

5. The method according to any one of claims 1 to 4, further comprising: A 5' adapter having a 3' end is added to the mixture, wherein the first ligation products each include the 3' end of the sample nucleic acid connected to the 5' end of the 3' adapter, and the 5' end of the sample nucleic acid connected to the 3' end of the 5' adapter, thereby generating a sequencing library molecule including the sample nucleic acid insert fragment located between and bound to the 5' adapter and the 3' adapter.

6. The method according to any one of claims 1 to 5, further comprising: Add 5' adapter to the purified mixture; and incubating the purified mixture under ligation reaction conditions, thereby 1) ligating the 5' adapter to the first ligation product to generate a sequencing library molecule comprising a sample nucleic acid insert located between and bound to the 5' adapter and the 3' adapter.

7. The method according to any one of claims 1 to 6, wherein excess unligated 3' adapters are reduced but not eliminated, so that the ligation includes ligating a 5' adapter to at least a portion of the excess unligated 3' adapter to produce an adapter-dimer, which includes a 5' adapter bound to a 3' adapter at a 5' adapter-3' adapter interface; further includes inhibiting the amplification of the adapter-dimer in the amplification reaction, so that the sequencing library molecules are selectively enriched by the amplification reaction compared to the adapter-dimer.

8. The method according to any one of claims 1 to 7, wherein inhibiting amplification of adapter-dimers comprises removing at least some adapter-dimers prior to amplification.

9. The method according to claim 7 or 8, wherein inhibiting the amplification of the linker-dimer may include one or more of the following: specific enzymatic cleavage of the linker-dimer; CRISPR / Cas9-based cleavage of the linker-dimer; gel purification; SPRI bead-based size selection; and adding a linker-dimer blocker oligonucleotide to the mixture, wherein the linker-dimer blocker oligonucleotide effectively inhibits the amplification of the linker-dimer.

10. The method according to claim 9, wherein the adapter-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the adapter-dimer, the one or more adjacent portions including at least one nucleotide of the 5' adapter at the 5' adapter-3' adapter interface, and an adjacent portion of the 3' adapter including an amplification primer binding site.

11. The method according to any one of claims 1 to 10, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

12. The method according to claim 1, wherein the sample nucleic acid is or comprises RNA, and further comprises reverse transcribing the RNA to produce reverse transcribed sequencing library molecules.

13. The method according to claim 1, wherein the sample nucleic acid is or comprises DNA.

14. The method according to claim 12 or 13, further comprising amplifying the sequencing library molecules.

15. An oligonucleotide pair for reducing adapter-dimers in a sequencing library, comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion that is at least 8 nucleotides in length, and ii) a first blocker oligonucleotide 3' portion that is at least 1 to 20 nucleotides in length and includes the 3' end of the first oligonucleotide, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; and b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5' portion of at least 8 nucleotides in length, and iv) a second blocker oligonucleotide 3' portion of at least 1 to 20 nucleotides in length and including the second blocker oligonucleotide 3' end, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; and wherein the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to the 5' end portion of the 3' adapter; 16. The oligonucleotide pair for reducing adapter-dimers in a sequencing library according to claim 15, wherein the 3' end of the first blocker oligonucleotide and the 3' end of the second blocker oligonucleotide are both capable of ligating to the adenylated nucleotide at the 5' end of the excess unligated 3' adapter.

17. An oligonucleotide pair for reducing adaptor-dimers in a sequencing library according to claim 15 or 16, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the first blocker oligonucleotide are non-naturally occurring nucleotide analogues, and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of at least 1 to 20 nucleotides of the 3' portion of the second blocker oligonucleotide are non-naturally occurring nucleotide analogues.

18. An oligonucleotide pair for reducing adaptor-dimers in a sequencing library according to any one of claims 15, 16 or 17, wherein when the length of the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides, the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each comprise a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is the same as the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion.

19. The oligonucleotide pair for reducing adapter-dimers in a sequencing library according to any one of claims 15 to 18, wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length ranging from about 11 to about 50 nucleotides.

20. The oligonucleotide pair for reducing adaptor-dimers in a sequencing library according to any one of claims 15 to 19, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

21. A kit for reducing adapter-dimers in a sequencing library, comprising the oligonucleotide pair according to any one of claims 15 to 20.

22. The kit according to claim 21, further comprising an adapter-dimer blocker oligonucleotide effective to block adapter-dimer amplification.

23. A kit according to claim 22, wherein the adapter-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the adapter-dimer, the one or more adjacent portions including at least one nucleotide of the 5' adapter at the 5' adapter-3' adapter interface, and an adjacent portion of the 3' adapter including an amplification primer binding site.

24. The method according to any one of claims 1 to 14 or the kit according to any one of claims 21 to 23, wherein the first blocker and the second blocker have the same nucleic acid sequence.

25. The method according to any one of claims 1 to 14 or the kit according to any one of claims 21 to 24, wherein the first blocker and the second blocker have different nucleic acid sequences.

26. A method, kit or oligonucleotide pair substantially as herein described.

Images