Ferritin nanoparticles and their drug delivery system assembly method and application

By adjusting the pH value and adding PEG1500, self-assembly of ferritin mutants is achieved to form ferritin nanoparticles, solving the problem of extreme environment destruction of ferritin in the prior art and improving the safety and stability of the drug delivery system.

CN119326734BActive Publication Date: 2025-06-06ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411854399.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-17
Publication Date
2025-06-06
Estimated Expiration
2044-12-17

AI Technical Summary

Technical Problem

In existing ferritin enclosure and delivery technologies, extreme pH environments and urea concentrations may destroy ferritin, resulting in a decrease in drug enclosure capacity and stability. The process requires accurate and difficult conversion, and is not suitable for pH and urea-sensitive drugs.

Method used

By adjusting the pH value of the ferritin mutant solution system to 9.5~10.5, and adding PEG1500 to 15%~20% final mass percentage concentration, self-assembly of the ferritin mutant is achieved to form ferritin nanoparticles.

Benefits of technology

Retaining ferritin activity in a relatively mild environment is suitable for loading and delivery of more types of drugs, improving the safety and stability of drug delivery systems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119326734B_ABST
    Figure CN119326734B_ABST
Patent Text Reader

Abstract

The present invention provides an assembly method and application of ferritin nanoparticles and a drug delivery system thereof, and belongs to the technical field of biopharmaceutical preparation. The present invention adjusts the pH value of the genetically engineered ferritin mutant system to 9.5-10.5, adds PEG1500 with a final mass percentage concentration of 15%-20%, and obtains ferritin nanoparticles through self-assembly. The ferritin nanoparticle assembly method provided by the present invention can retain the activity of ferritin to a greater extent, and is suitable for the loading and delivery of more types of drugs. In addition, under mild conditions, depolymerization can remove the host nucleic acid remaining in the inner cavity of ferritin by nuclease, further improving the safety of ferritin drug delivery. Therefore, the assembly method provided by the present invention can further promote the application of ferritin in drug delivery.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biopharmaceutical preparation, and in particular relates to an assembly method and application of ferritin nanoparticles and a drug delivery system thereof. Background Art

[0002] Ferritin has a cage-like structure. Because of its cavity structure, it is often loaded with drugs as a drug encapsulation and delivery carrier. The most common loading method for ferritin encapsulation of drugs is pH and urea-mediated depolymerization / recombination. The pH-mediated depolymerization / recombination rule can be used for the encapsulation of macromolecular drugs. Its basic principle is to use the change of pH to make the ferritin cage structure complete a depolymerization (pH from 7.5→2 to depolymerize into monomers) and recombination (pH from 2→7.5), and achieve drug encapsulation in this process. The urea-mediated depolymerization / recombination rule is to mix ferritin with a high concentration of urea solution to completely depolymerize it into subunits, then add the drug to be encapsulated, and gradually reduce the concentration of urea solution to gradually complete the renaturation of the ferritin cage structure and complete the encapsulation of the drug. These two methods have obvious disadvantages. Extreme pH environment and urea concentration may permanently damage ferritin, causing a decrease in drug encapsulation capacity and stability. In addition, the process requires extremely precise and conversion is also difficult. It is not suitable for pH and urea sensitive drugs. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide a method for assembling ferritin nanoparticles, which can retain the activity of ferritin to a greater extent and is suitable for the loading and delivery of more types of drugs by adjusting the pH value of the system and adding PEG1500 to a specific concentration to achieve self-assembly of ferritin mutants.

[0004] The present invention provides a method for assembling ferritin nanoparticles, which comprises adjusting the pH value of a solution system of a recombinantly expressed ferritin mutant and adding PEG1500 to obtain ferritin nanoparticles through self-assembly.

[0005] The amino acid sequence of the ferritin mutant is shown in SEQ ID NO: 1;

[0006] The pH value of the solution system of the recombinantly expressed ferritin mutant was adjusted to 9.5-10.5;

[0007] The final mass percentage concentration of the PEG1500 is 15% to 20%.

[0008] Preferably, the pH value of the solution system of the recombinantly expressed ferritin mutant is adjusted to 10;

[0009] The final mass percentage concentration of the PEG1500 is 18%.

[0010] Preferably, the method for preparing the recombinantly expressed ferritin mutant comprises cloning a DNA fragment encoding the ferritin mutant into a vector, transforming the obtained recombinant expression vector into a host bacterium, culturing the obtained recombinant strain, and separating and purifying from the culture medium to obtain a solution system of the recombinantly expressed ferritin mutant.

[0011] Preferably, the nucleotide sequence of the DNA fragment encoding the ferritin mutant is shown in SEQ ID NO:4.

[0012] The invention provides application of the assembling method in preparing a drug delivery system.

[0013] Preferably, the drug delivery system uses the ferritin nanoparticles prepared by the assembly method as a drug delivery carrier, and also includes a drug coated on the drug delivery carrier.

[0014] Preferably, the drug comprises at least one of the following: a compound drug, a protein drug and a nucleic acid molecule.

[0015] Preferably, the nucleic acid molecule comprises siRanBP2 having a nucleotide sequence as shown in SEQ ID NO:7.

[0016] The present invention provides an assembly method of a drug delivery system, comprising mixing a solution system of a recombinantly expressed ferritin mutant and a drug, adjusting the pH value of the mixed system and adding PEG1500 to allow the ferritin mutant to self-assemble, thereby obtaining a drug delivery system;

[0017] The amino acid sequence of the ferritin mutant is shown in SEQ ID NO: 1;

[0018] The pH value of the mixed system is adjusted to 9.5-10.5;

[0019] The final mass percentage concentration of the PEG1500 is 15% to 20%.

[0020] Preferably, the pH value of the mixed system is adjusted to 10;

[0021] The final mass percentage concentration of the PEG1500 is 18%.

[0022] Preferably, the method for preparing the recombinantly expressed ferritin mutant comprises cloning a DNA fragment encoding the ferritin mutant into a vector, transforming the obtained recombinant expression vector into a host bacterium, culturing the obtained recombinant strain, and separating and purifying from the culture medium to obtain a solution system of the recombinantly expressed ferritin mutant.

[0023] Preferably, the nucleotide sequence of the DNA fragment encoding the ferritin mutant is shown in SEQ ID NO:4.

[0024] The present invention provides a method for assembling ferritin nanoparticles, wherein the pH value of a solution system of a recombinantly expressed ferritin mutant is adjusted and PEG1500 is added for self-assembly to obtain ferritin nanoparticles; the amino acid sequence of the ferritin mutant is shown in SEQ ID NO:1; the pH value of the solution system of the recombinantly expressed ferritin mutant is adjusted to 9.5-10.5; the final mass percentage concentration of the PEG1500 is 15%-20%. The present invention mutates the amino acids "GAPESG" at positions 160-165 in the DE loop region of the ferritin heavy chain (FTH) to "HHHHHH" by a genetic modification method to obtain a ferritin mutant (FTH-6H). The present invention utilizes the fact that the FTH-6H protein is in an unassembled monomer state after recombinant expression, and can well remove contaminated host nucleic acids. By adjusting the pH value of the system and adding PEG1500, the protein nanocage in a natural state can be self-assembled to obtain ferritin nanoparticles, and the assembled ferritin nanoparticles do not contain host nucleic acids and have good drug-carrying safety. It can be seen that the assembly method provided by the present invention realizes reassembly in a relatively mild environment, and can retain the activity of ferritin to a greater extent (the tumor targeting of ferritin depends largely on its activity and correct assembly). In view of the many advantages of safety, high activity, and self-assembly, ferritin nanoparticles as drug delivery carriers surpass the currently known common carriers and have wide application value in drug delivery systems. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Figure 1 is a diagram of the expression and identification of recombinant proteins of ferritin (FTH) and ferritin mutant (FTH-6H); A is a schematic diagram of the coding genes of ferritin (FTH) and ferritin mutant (FTH-6H) in the vector, B is the purification result of ferritin (FTH), and C is the formation result of nanoparticles analyzed by transmission electron microscopy. The scale bar in the figure is 100 nm.

[0026] Figure 2 The results of endogenous nucleic acid contamination analysis of FTH and FTH-6H nanoparticles; 1-heat treatment;

[0027] 2- ammonium sulfate precipitation; 3- universal nuclease treatment; 4- ultrafiltration concentration;

[0028] Figure 3 The controllable assembly analysis results of FTH-6H protein; A is the distribution result of nanocage particles before FTH assembly, B is the distribution result of nanocage particle size after FTH assembly, and C is a schematic diagram of FTH disassembly and assembly;

[0029] Figure 4The results of the analysis of the efficiency of FTH-6H nanoparticles encapsulating siRNA; A is the test result of FTH-6H protein and siRNA at different molar ratios; B is the test result of siRNA loading efficiency at different molar ratios of FTH-6H protein and siRNA;

[0030] Figure 5 The results of toxicity analysis of FTH-6H nanoparticles delivering siRNA to tumor cell lines A549 and PANC-1;

[0031] Figure 6 The results of the efficiency analysis of FTH-6H nanoparticles delivering siRNA to A549, where A is the fluorescence intensity detection result, and B is the fluorescence positive ratio detection result; 1 is the 1nM Cy3-siRanBP2@FTH-6H group; 2 is the 2nM Cy3-siRanBP2@FTH-6H group; 3 is the 4nM Cy3-siRanBP2@FTH-6H group; 4 is the 10nM Cy3-siRanBP2@FTH-6H group; 5 is the 10nM Cy3-siRanBP2+Lipo2000 group;

[0032] Figure 7 The results show the interference effect of siRNA delivered by FTH-6H nanoparticles on the target gene. A is the detection result of RanBP2 mRNA level in A549 cells, and B is the detection result of RanBP2 protein expression level. NC is 10nM Cy3-siNC+Lipo2000 group; 1 is 1nM Cy3-siRanBP2@FTH-6H group; 2 is 2nM Cy3-siRanBP2@FTH-6H group; 3 is 4nM Cy3-siRanBP2@FTH-6H group; 4 is 10nM Cy3-siRanBP2@FTH-6H group; 5 is 10nM Cy3-siRanBP2+Lipo2000 group. DETAILED DESCRIPTION

[0033] The present invention provides a method for assembling ferritin nanoparticles, comprising adjusting the pH value of a solution system of a recombinantly expressed ferritin mutant and adding PEG1500 to self-assemble into a natural nanocage to obtain ferritin nanoparticles; the amino acid sequence of the ferritin mutant is as shown in SEQ ID NO:1; the pH value of the solution system of the recombinantly expressed ferritin mutant is adjusted to 9.5-10.5; and the final mass percentage concentration of the PEG1500 is 15%-20%.

[0034] In the present invention, the amino acid sequence of the ferritin mutant is as follows:

[0035] MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMHHHHHHLAEYLFDKHTLGDSDNES*, where * indicates a stop codon.

[0036] In the present invention, the ferritin mutant is a ferritin heavy chain (FTH) DE loop region in which the amino acid "GAPESG" (SEQ ID NO: 2) at positions 160-165 is mutated to "HHHHHH" (SEQ ID NO: 3), and is in a non-assembled monomer state under physiological conditions (recombinant expression); the disassembly-reassembly process can be achieved under a mild state. During disassembly, the mild state refers to a pH value of 7 in the system; during reassembly, the mild state refers to a pH value of 9.5-10.5 in the system, which can be 10; the final mass percentage of PEG1500 can be 15%-18%. The ferritin mutant is in a disaggregated state under a mild state of pH 7, which is convenient for removing contamination of host nucleic acids during recombinant expression. Under the conditions of pH 10 and a final mass percentage of PEG1500 of 15%, the ferritin mutant spontaneously assembles into a protein nanocage in a natural state, which is characterized by a hollow structure consisting of 24 subunits.

[0037] In the present invention, the preparation method of the recombinantly expressed ferritin mutant comprises cloning a DNA fragment encoding the ferritin mutant into a vector, transforming the obtained recombinant expression vector into a host bacterium for expression, culturing the obtained recombinant strain, separating and purifying to obtain a solution system of the recombinantly expressed ferritin mutant. The DNA fragment encoding the ferritin mutant is a sequence that can encode an amino acid sequence such as SEQ ID NO: 1, for example, a codon-optimized sequence (SEQ ID NO: 4, ATGACGACCGCGTCCACCTCGCAG

[0038] ) may also include a coding gene whose base is replaced based on SEQ ID NO:4 but whose amino acid sequence is not changed.

[0039] In the present invention, the recombinant expression vector is a recombinant expression vector capable of expressing the ferritin mutant or comprising a DNA fragment encoding the ferritin mutant. According to the host type classification, the backbone vector of the recombinant expression vector preferably includes a prokaryotic expression vector and / or a eukaryotic expression vector. The prokaryotic expression vector preferably includes an Escherichia coli expression vector or a lactic acid bacteria expression vector. The eukaryotic expression vector preferably includes a yeast expression vector, an insect expression vector or a mammalian expression vector.

[0040] In the embodiment of the present invention, the E. coli expression vector (pET28a) is used as an example to illustrate the construction method of the recombinant expression vector. The construction method of the recombinant expression vector preferably comprises the following steps: cloning the coding gene fragment of the ferritin mutant into pET28a Nco Ⅰ and HindIII, and a recombinant expression vector is obtained after verification. The cloning method preferably includes a homologous recombination method and an enzyme cleavage connection. The temperature of the homologous recombination is preferably 37°C. The time of the homologous recombination is 30 minutes. The verification method is performed by at least one of enzyme cleavage or PCR amplification of the target gene and sequencing. The enzyme cleavage method preferably adopts Nco Ⅰ and Hind III double enzyme digestion treatment, the target fragment obtained is the coding gene of the ferritin mutant. The primer sequence for PCR amplification of the target gene preferably includes GTTTAACTTTAAGAAGG

[0041] AGATATACCATGACGACCGCGTCCACCTCGCA (SEQ ID NO:5) and CTCGA

[0042] GTGCGGCCGCAAGCTTTTAGCTTTCATTATCACTGTCTCCCAGGG (SEQ ID NO: 6).

[0043] In the present invention, the host bacteria of the genetically engineered strain preferably include a prokaryotic expression system and / or a eukaryotic expression system. The prokaryotic expression vector preferably includes an Escherichia coli expression system or a lactic acid bacteria expression system. The eukaryotic expression system preferably includes a yeast expression system, an insect expression system or a mammalian expression system.

[0044] In the embodiment of the present invention, Escherichia coli (BL21 STAR (DE3)) is used as a host bacterium as an example to illustrate the construction method of a genetically engineered strain, which preferably includes transforming a recombinant expression vector containing the encoding gene into the host bacterium, picking a single clone, and selecting positive bacteria for sequencing. The transformation method is preferably a calcium chloride transformation method. The method for selecting positive bacteria preferably includes a colony PCR method. The positive bacteria whose sequencing results are consistent with the expected target gene sequence are amplified and cultured for the recombinant expression of ferritin mutants. The colony PCR method is the same as the above-mentioned PCR amplification method for the target gene, and will not be repeated here.

[0045] In the present invention, the method of recombinantly expressing the ferritin mutant using the genetically engineered strain preferably includes the following steps: culturing the above-mentioned positive bacteria, inducing expression using IPTG, isolating the protein, verifying the target gene, and then isolating and purifying the recombinant protein. The culturing method inoculates the positive bacteria in an LB medium containing antibiotics at an inoculation rate of 0.8% to 2%. The culturing temperature is preferably 36 to 38°C, more preferably 37°C. The culturing time is preferably 6 to 8 hours, and most preferably 7 hours. The culturing speed is preferably 200 to 240 rpm, more preferably 220 rpm. When the OD 600When the pH is 0.8, IPTG is added. The working concentration of the IPTG is preferably 1 mM. The temperature for inducing expression is preferably 19-21°C, more preferably 20°C. The speed of the inducing expression is preferably 170-190 rpm, more preferably 180 rpm. The time for inducing expression is preferably 12-16 h, more preferably 13-15 h, and most preferably 14 h. The buffer for separating proteins is preferably an aqueous solution containing 1 mM PMSF, 50 mMTris, and 200 mM NaCl, with a pH of 7.5. The method for separating proteins is preferably to separate the bacterial cells from the culture fluid obtained by the above-mentioned induction culture, place it in a buffer for separating proteins, and perform ultrasonic treatment under ice bath conditions to separate the liquid phase. The method for separating bacterial cells is preferably centrifugation. The speed of the centrifugation is preferably 10000-12000 rpm, more preferably 10000 rpm. The power of the ultrasonic treatment is preferably 190-210 W, more preferably 200 W. The frequency of the ultrasonic treatment is preferably 18-22 kHz, more preferably 20 kHz. The time of the ultrasonic treatment is preferably 5 s. The interval time of the ultrasonic treatment is preferably 5s. The method for separating the liquid phase is preferably centrifugation at a speed of 15000g. Taking advantage of the extremely high heat resistance of ferritin, the separated supernatant containing the recombinant protein is sequentially heat-treated at 60°C and 72°C to remove denatured proteins. Subsequently, 60% ammonium salt is added to the supernatant to precipitate the protein in the supernatant. After high-speed centrifugation at 15000g for 30 min, the supernatant is discarded and the protein precipitate is dissolved in buffer B (containing 50mM Tris, 200mM NaCl, 5mM MgCl 2 , pH=8.0). A universal nuclease is added to the recombinant protein system to remove contaminated nucleic acids. The working concentration of the universal nuclease is preferably 20-30 U / mL, more preferably 25 U / mL. The treatment time of the universal nuclease is preferably 2-6 h, more preferably 4 h. The treatment temperature of the universal nuclease is preferably 37°C. After the nucleic acid of the host bacteria in the removal system, the universal nuclease is preferably inactivated by proteinase K, and then proteinase K is inactivated by high temperature. The universal nuclease is purchased from Shanghai Yisheng Biological Company with a catalog number of 20156ES25. The function of the universal nuclease is to remove various DNA and RNA from the host. The recombinant protein system from which the contaminated nucleic acids are removed is further purified by Superdex 200 gel filtration chromatography, the eluted protein solution is collected, and the FTH-6H protein is concentrated by an ultrafiltration step (with a cutoff value of 10 kDa). The verification method preferably uses SDS-PAGE identification to obtain a protein band of the target size, indicating that the ferritin mutant is successfully expressed. The ferritin mutant after recombinant expression exists in a monomeric state, that is, the ferritin mutant exists in a disaggregated state.

[0046] In the examples of the present invention, in order to screen a better method for removing residual host bacterial nucleic acid, ferritin mutants and ferritin were treated with heat treatment, ammonium sulfate precipitation, universal nuclease treatment and ultrafiltration concentration, respectively, and the nucleic acid residues in each sample were analyzed. The results showed that compared with FTH, FTH-6H was more effective in removing host-derived nucleic acids using universal nuclease, while other methods were less effective.

[0047] In the present invention, the pH value of the mixed system is preferably adjusted to 9.5-10.5, which can be 10. The solvent for adjusting the pH value of the mixed system is preferably a 0.1M sodium hydroxide solution. The final mass percentage concentration of the PEG1500 is 15%-20%, which can be 18%. The role of the PEG1500 is to stabilize the assembled FTH-6H nanoparticles to prevent them from depolymerizing when the neutral pH is restored. For the subsequent application of ferritin nanoparticles, the pH value of the self-assembled ferritin nanoparticles is preferably adjusted to 7.5.

[0048] In the present invention, the product obtained by the above-mentioned assembly method is observed under a transmission electron microscope, and granular ferritin nanoparticles are found. The dynamic light scattering (DLS) detection result shows that the particle size of the ferritin nanoparticles is 8.4-12.2 nm.

[0049] In view of the fact that the ferritin nanoparticles can achieve the transition from a disaggregated state to a self-assembled state under mild conditions and have the characteristics of low nucleic acid contamination and high safety, the present invention provides the application of the assembly method in the preparation of a drug delivery system.

[0050] In the present invention, the drug delivery system uses the ferritin nanoparticles prepared by the assembly method as a drug delivery carrier, and also includes a drug coated inside the drug delivery carrier.

[0051] In the present invention, the ferritin nanoparticles prepared by the assembly method are used as drug delivery carriers, and a drug delivery system with good targeting of target cells of the body is constructed by encapsulating drug active molecules. The ferritin nanoparticles not only have good drug safety, but also can achieve the delivery of various types of drug molecules, greatly expanding the application range of the drug delivery system.

[0052] In the present invention, the drug preferably includes a compound drug, a protein drug and a nucleic acid molecule. The nucleic acid molecule preferably includes interfering RNA (siRNA). The present invention has no special restrictions on the method of siRNA, and the type of siRNA for disease treatment known in the art can be used. In an embodiment of the present invention, the siRNA is siRanBP2, and the nucleotide sequence is such as GCUUGUCAGAAUCCAGGUAAATT (SEQ ID NO: 7).

[0053] The present invention provides an assembly method of the drug delivery system, which comprises mixing a solution system of the recombinantly expressed ferritin nanoparticles and a drug, and self-assembling the recombinant protein by adjusting the pH value of the mixed system and adding PEG1500 to obtain ferritin nanoparticles.

[0054] In the present invention, the molar ratio of the ferritin nanoparticles to the drug is 1 to 10:1, and can be 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1 and 1:1. Experiments show that as the molar ratio of the ferritin nanoparticles to the drug decreases, the assembly efficiency gradually decreases. The method for adjusting the pH value of the mixed system and the method for adding PEG1500 are the same as the above technical solution, and will not be repeated here.

[0055] In the present invention, the drug delivery system is preferably used for delivering siRNA into tumor cells.

[0056] In the present invention, the in vitro cytotoxicity and delivery efficiency of the drug delivery system are also evaluated. A549 cells and PANC-1 cells were treated with different concentrations of the drug delivery system (siRNA@FTH-6H, FTH-6H content was 10, 5, 2.5 and 0 μM, respectively), and the cell viability of A549 cells and PANC-1 cells was determined by CCK-8 reagent to evaluate cytotoxicity. The results showed that 10 μM FTH-6H showed obvious cytotoxicity, so a lower concentration of 5 μM was selected for subsequent experiments. A549 cells were transfected with different concentrations of Cy3-siRanBP2@FTH-6H (corresponding to 1, 2, 4 and 10 nM Cy3-siRanBP2). The number of Cy-3-positive cells and fluorescence intensity were quantitatively analyzed by flow cytometry, and the expression level of RanBP2 was detected. The results showed that Cy3-siRanBP2@FTH-6H could effectively enter the cells and exert an interference effect in a dose-dependent manner. 10 nM Cy3-siRanBP2@FTH-6H could significantly reduce the expression level of RanBP2.

[0057] The following is a detailed description of a ferritin mutant, ferritin nanoparticles, drug delivery system and applications thereof provided by the present invention in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0058] Example 1

[0059] Expression of FTH-6H protein and assembly of nanoparticles

[0060] 1) Synthesis of target gene

[0061] According to the sequence of FTH gene (accession number in NCBI database: NM_002032.3), amino acids 160-165 of the DEloop region of ferritin heavy chain (FTH) were mutated from "GAPESG" to "HHHHHH" (see Figure 1 The obtained coding gene was optimized according to the codon preference of Escherichia coli (as shown in SEQ ID NO: 4) and then delivered to a gene synthesis company for synthesis.

[0062] 2) Construction of recombinant plasmid

[0063] pET28a plasmid Nco Ⅰ and Hind The restriction endonuclease III was digested at 37°C for 2 h and then recovered. The linear vector digested with the codon-optimized FTH-6H was recombined with the homologous recombinase at 37°C for 30 min to transform E. coli Top 10 competent cells were selected for colony PCR identification (SEQ ID NO: 5 and SEQ ID NO: 6), and positive bacteria were sent for sequencing. The positive bacteria culture with sequencing consistent with the expected gene sequence was obtained, and the plasmid was extracted using a plasmid extraction kit.

[0064] 3) Preparation and cultivation of genetically engineered bacteria expressing FTH-6H

[0065] The positive plasmid was transformed into E. coli BL21 STAR (DE3) competent cells. After overnight culture, a single clone was picked and inoculated into a new culture medium for culture. 600 When the value was 0.6, IPTG with a final concentration of 1 mM was added for induction culture, and the correct expression of FTH-6H was determined by SDS-PAGE.

[0066] 4) Large-scale expression and purification of FTH-6H protein

[0067] The overnight cultured FTH-6H expressing bacteria were inoculated into 500 mL of LB medium (final Kan concentration 50 μg / mL) at a volume ratio of 1:100 and cultured at 37°C and 220 rpm for 8 h. 600When the concentration reached 0.8, IPTG was added at a final concentration of 1 mM, and the temperature and rotation speed were adjusted to 20 ° C and 180 rpm. The culture was continued for 12 hours to induce protein expression. At the same time, the wild-type FTH protein was expressed as a control. The centrifuged bacteria were resuspended in 50 mL buffer A (containing 1 mM PMSF, 50 mM Tris, 200 mM NaCl, pH = 7.5), and the bacteria were ultrasonically broken and lysed in an ice bath. After high-speed centrifugation at 15000g for 30 min, the supernatant was taken and heat-treated twice at 60 ° C and 72 ° C in sequence. Each treatment lasted 10 minutes, and in each step, the denatured protein was removed by centrifugation. Subsequently, 60% ammonium sulfate was added to the supernatant to precipitate the protein in the supernatant. After high-speed centrifugation at 15000g for 30 min, the supernatant was discarded, and the protein precipitate was dissolved in buffer B (containing 50 mM Tris, 200 mM NaCl, 5 mM MgCl 2 , pH=8.0). Subsequently, universal nuclease was added to a final concentration of 25 U / mL to remove contaminating nucleic acids. It was further purified by Superdex 200 gel filtration chromatography and the eluted protein solution was collected. Finally, the FTH-6H protein was concentrated by ultrafiltration step (cutoff value was 10 kDa). The purified protein was identified by SDS-PAGE.

[0068] The results are as follows Figure 1 As shown in Figure B. The results of SDS-PAGE showed that the molecular weight of the purified protein was relatively uniform.

[0069] 5) Transmission electron microscopy observation and dynamic light scattering (DLS) detection of FTH-6H protein

[0070] The purified FTH-6H and wild-type FTH proteins were diluted to 0.2-0.5 mg / mL with pure water, and negatively stained with 2% phosphotungstic acid. The formation of nanoparticles was observed using a transmission electron microscope. The results are as follows: Figure 1 As shown in Figure C, FTH can be assembled into nanoparticles of uniform size, while no obvious nanoparticles were observed in the FTH-6H group.

[0071] 6) Analysis of host nucleic acid residues of FTH-6H and wild-type FTH proteins

[0072] During the purification of FTH and FTH-6H, samples were taken and treated as follows:

[0073] 1: Heat treatment: After the cells are fully lysed, centrifuge at 15,000 g for 30 min, take the supernatant, and heat treat twice at 60°C and 72°C in sequence. Each treatment lasts 10 minutes, and in each step, remove denatured proteins by centrifugation.

[0074] 2: Ammonium sulfate precipitation: Add 60% ammonium sulfate to the supernatant of the previous step to precipitate the protein in the supernatant. After high-speed centrifugation at 15000g for 30 min, discard the supernatant and dissolve the protein precipitate in buffer B (containing 50 mM Tris, 200 mM NaCl, 5 mM MgCl 2, pH = 8.0).

[0075] 3: Treatment with universal nuclease: Add universal nuclease to the product of the previous step to a final concentration of 25 U / mL, and remove contaminated nucleic acids at 37°C. Further purify it by Superdex 200 gel filtration chromatography, and collect the eluted protein solution.

[0076] 4: Ultrafiltration concentration. In order to further concentrate for subsequent experiments, the eluted protein solution was added to Millipore's Amicon® Ultra-5 ultrafiltration tube, centrifuged at 2500g for 20 min, concentrated 10-15 times, and the concentrated protein was aspirated for later use.

[0077] The proteins after the above treatment were subjected to nucleic acid electrophoresis using 1.2% agarose gel to analyze the residual nucleic acid in each sample.

[0078] The results are as follows Figure 2 As shown. After the first two steps of treatment, there are still a lot of nucleic acids remaining in FTH and FTH-6H. After the third step of universal nuclease treatment and further purification, the nucleic acid content in FTH and FTH-6H is extremely low, and no obvious bands are observed. However, after concentrating FTH and FTH-6H in the fourth step, no obvious nucleic acid residues were observed in the FTH-6H group, while nucleic acid residues were found in the FTH group. This indicates that the nucleic acids in FTH were not completely removed in the previous treatment, which may be because the nuclease cannot effectively contact and digest the small amount of nucleic acids remaining inside the FTH nanocage, which can be detected after FTH is concentrated.

[0079] Example 2

[0080] Controllable assembly of FTH-6H in vitro

[0081] To further clarify the assembly conditions of FTH-6H, 0.1 mol / L sodium hydroxide solution was added to the obtained FTH-6H protein solution, and the pH value was adjusted to 10 on a magnetic stirrer for assembly. PEG1500 solution was then added to make the final concentration of PEG1500 in the solution 15%. The pH value of the solution was adjusted to 7.5 using 0.1 mol / L hydrochloric acid. At the same time, a dynamic light scattering test was performed to detect the assembly results of the nanocage.

[0082] The results are as follows Figure 3 As shown in A and B. Figure 3In Figure A, the diameter distribution of FTH-6H before assembly is 6~7.8 nm, the average diameter is 6.9 nm, and the volume proportion is 98.8%, which shows no obvious nanoparticle assembly. Figure 3 The diameter distribution of the assembled nanoparticles in Figure B is 8.4-12.2 nm, with an average diameter of 10.3 nm and a volume percentage of 97.3%, which is consistent with the diameter of ferritin nanoparticles in the natural state. This shows that FTH-6H protein solution can form nanoparticles by assembly under specific pH values ​​and specific concentrations of PEG1500 ( Figure 3 Middle C).

[0083] Example 3

[0084] In vitro assembly of FTH-6H and siRNA

[0085] To further explore the application of FTH-6H nanoparticles in siRNA delivery, the method for preparing ferritin nanocages loaded with siRNA inside is to fully mix FTH-6H protein solution (100 μM, pH=7.0) with siRNA (mixing molar ratio of 6:1, 4:1, 2:1), and further control the assembly by adjusting pH and adding PEG1500 by the aforementioned method to prepare ferritin nanocages loaded with siRNA inside (siRNA loaded FTH nanocage, siRNA@FTH-6H). The unencapsulated siRNA residues were digested by omnipotent nuclease treatment, and then the omnipotent nuclease was digested with proteinase K. Finally, the protein solution was treated at 60°C for half an hour to inactivate proteinase K by using the property that FTH-6H can withstand high temperature of 70°C. The final sample can be used for subsequent experiments. The specific siRNA loading efficiency was determined by 2% agarose gel electrophoresis.

[0086] The results are as follows Figure 4 As shown in A and B. When a fixed concentration of FTH-6H protein was used, the efficiency of siRNA encapsulation decreased with the increase of the added siRNA concentration. When the FTH-6H / siRNA molar ratio was 6, the encapsulation efficiency was about 60%. When the FTH-6H / siRNA molar ratio was 2, the encapsulation efficiency was only about 30%.

[0087] Example 4

[0088] In vitro cytotoxicity and delivery efficiency of siRNA-loaded ferritin nanoparticles

[0089] To study the in vitro cytotoxicity of siRNA-loaded ferritin nanoparticles, A549 cells (ATCC) and PANC-1 cells (ATCC) were seeded in 96-well plates at a density of 2000 cells per well. After overnight culture at 37°C, different concentrations of siRNA@FTH-6H (where the FTH-6H content was 10 μM, 5 μM, 2.5 μM, and 0 μM, respectively) were added to the plates and cultured for 24 h. The culture medium was then discarded, and 200 μL D-PBS buffer (0.01 M, pH = 7.0-7.2) was added for washing. CCK-8 reagent was added and incubated for 2 h. The cells were centrifuged briefly to remove bubbles, and the absorbance was measured at 450 nm.

[0090] The survival rates of A549 cells and PANC-1 cells under the action of different concentrations of siRNA@FTH-6H are shown in Figure 2 Figure 5 As shown, the results showed that 10 μM FTH-6H exhibited significant cytotoxicity, so a lower concentration of 5 μM was selected for subsequent experiments.

[0091] Example 5

[0092] To study the delivery efficiency of siRNA@FTH-6H in vitro, A549 cells were plated at 5×10 5 The cells were inoculated in 6-well plates and cultured overnight. Different concentrations of Cy3-siRanBP2@FTH-6H (1 nM, 2 nM, 4 nM and 10 nM corresponding to Cy3-siRanBP2) were added. At the same time, siNC (10 nM, ACGGGCGGCUAUCGCUGACU, SEQ ID NO: 8) and Cy3-siRanBP2 (10 nM, GCUUGUCAGAAUCCAGGUAAATT, SEQ ID NO: 7) transfected by Lipofectamine 2000 were set as negative and positive controls. After incubation for 12 h, the cells were washed three times with PBS, digested with trypsin into single-cell suspension, and then the number of Cy-3-positive cells was quantified by flow cytometry.

[0093] The results are as follows Figure 6 As shown in Figures A and B. The positive control group (Group 5, 10 nM Cy3-siRanBP2+Lipo2000) had the highest fluorescence intensity and number of fluorescence-positive cells. In the experimental group, as the concentration of Cy3-siRanBP2@FTH-6H increased, the number of positive cells also gradually increased. These results indicate that Cy3-siRanBP2@FTH-6H is taken up by A549 cells in a concentration-dependent manner, achieving the delivery of Cy3-siRanBP2.

[0094] After 24 hours, the cells were collected for RNA and protein extraction. qPCR quantitative analysis of the mRNA level of RanBP2 in each group. WB quantitative analysis of the protein level of RanBP2 in each group.

[0095] The results are as follows Figure 7 As shown in Figures A and B. On the premise of verifying the delivery efficiency in the previous step, the siRNA delivered into A549 cells was further tested to see whether it could function normally. The results showed that compared with the control group NC (Cy3-siNC+Lipo2000), the positive control group (Group 5, 10 nM Cy3-siRanBP2+Lipo2000) could significantly downregulate the mRNA and protein levels of RanBP2. In the experimental group, Cy3-siRanBP2@FTH-6H could effectively downregulate the expression levels of RanBP2 mRNA and protein in A549, and as the concentration increased, the corresponding effect became more significant. At 10 nM, the knockdown efficiency of Cy3-siRanBP2@FTH-6H reached 65%.

[0096] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for assembling ferritin nanoparticles, characterized in that: The pH value of the solution system of the recombinantly expressed ferritin mutant is adjusted, PEG1500 is added, and the pH value of the self-assembled ferritin nanoparticles is adjusted to 7.5 to obtain ferritin nanoparticles; The amino acid sequence of the ferritin mutant is shown in SEQ ID NO: 1; The pH value of the solution system of the recombinantly expressed ferritin mutant was adjusted to 9.5-10.5; The final mass percentage concentration of the PEG1500 is 15% to 20%.

2. The assembly method according to claim 1, characterized in that: The pH value of the solution system of the recombinantly expressed ferritin mutant was adjusted to 10; The final mass percentage concentration of the PEG1500 is 18%.

3. The assembly method according to claim 1 or 2, characterized in that: The method for preparing the recombinantly expressed ferritin mutant comprises cloning a DNA fragment encoding the ferritin mutant into a vector, transforming the obtained recombinant expression vector into a host bacterium, culturing the obtained recombinant strain, and separating and purifying the recombinantly expressed ferritin mutant from the culture fluid to obtain a solution system; The nucleotide sequence of the DNA fragment encoding the ferritin mutant is shown in SEQ ID NO:

4.

4. Use of the assembly method according to any one of claims 1 to 3 in the preparation of a drug delivery system.

5. The application according to claim 4, characterized in that: The drug delivery system uses the ferritin nanoparticles prepared by the assembly method as drug delivery carriers, and also includes drugs coated on the drug delivery carriers.

6. The use according to claim 5, characterized in that: The drug includes at least one of the following: a compound drug, a protein drug and a nucleic acid molecule.

7. The use according to claim 6, characterized in that: The nucleic acid molecule includes siRanBP2 with a nucleotide sequence as shown in SEQ ID NO:

7.

8. A method for assembling a drug delivery system, characterized in that: The solution system of the recombinantly expressed ferritin mutant and the drug are mixed, and the ferritin mutant is self-assembled by adjusting the pH value of the mixed system and adding PEG1500 to obtain a drug delivery system; The amino acid sequence of the ferritin mutant is shown in SEQ ID NO: 1; The pH value of the mixed system is adjusted to 9.5-10.5; The final mass percentage concentration of the PEG1500 is 15% to 20%.

9. The assembly method according to claim 8, characterized in that: The pH value of the mixed system is adjusted to 10; The final mass percentage concentration of the PEG1500 is 18%.

10. The assembly method according to claim 8, characterized in that: The method for preparing the recombinantly expressed ferritin mutant comprises cloning a DNA fragment encoding the ferritin mutant into a vector, transforming the obtained recombinant expression vector into a host bacterium, culturing the obtained recombinant strain, and separating and purifying the recombinantly expressed ferritin mutant from the culture fluid to obtain a solution system; The nucleotide sequence of the DNA fragment encoding the ferritin mutant is shown in SEQ ID NO:4.