Use of (-)-gallocatechin gallate in the preparation of a medicine for preventing and / or treating porcine delta coronavirus
By activating the HK2 gene with (-)-Gallocatechin gallate, the proliferation and replication of porcine deltacoronavirus were inhibited, solving the problem of the lack of effective control of PDCoV in existing technologies and achieving significant virus inhibition effect and drug application.
Patent Information
- Application Number
- CN202411098014.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-12
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-08-12
AI Technical Summary
The current lack of effective vaccines and control measures for porcine deltacoronavirus (PDCoV) has led to increased costs for porcine farms, and existing technologies have failed to effectively inhibit the proliferation and replication of PDCoV.
By using (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof, the proliferation and replication of PDCoV were inhibited by activating the porcine hexokinase 2 (HK2) gene, and the expression of the PDCoV-N gene was downregulated or the expression level of the PDCoV-M protein was reduced.
It significantly inhibits the proliferation of porcine deltacoronavirus, reduces the infection rate, and has no effect on host cell activity in the concentration range of 1 μM to 5 μM, providing a drug application for the prevention and treatment of porcine deltacoronavirus.
Smart Images

Figure CN119326755B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to application of (-)-Gallocatechin gallate in preparation of a medicine for preventing and / or treating porcine deltacoronavirus, and belongs to the field of porcine deltacoronavirus treatment. BACKGROUND
[0002] Porcine deltacoronavirus (PDCoV) is a new enteropathogenic coronavirus belonging to the Deltacoronavirus genus of the Coronaviridae family, and is a single-stranded positive-sense RNA virus with an envelope. PDCoV can infect pigs of different ages, and newborn piglets are more susceptible. Infected pigs will have clinical symptoms such as diarrhea, vomiting, dehydration, and decreased appetite. Histopathological manifestations are intestinal damage, and multifocal to diffuse atrophy of villi in the proximal jejunum to the ileum. PDCoV has a high morbidity and mortality rate, causes large-scale piglet diarrhea, and causes significant economic losses to the global pig industry. According to a report in Nature, scientists detected and isolated PDCoV in serum samples from three febrile children in Haiti, indicating that PDCoV can cross species. At present, there is no effective PDCoV vaccine. For the prevention and control of PDCoV, the production mainly relies on biological safety control to prevent the spread and infection of the virus, which greatly increases the cost of breeding enterprises.
[0003] As a specific intracellular parasite, viruses can use various metabolic pathways of the host to meet the biological energy and biosynthesis requirements of their offspring production. Glycolysis is the earliest metabolic pathway to be elucidated, which mainly occurs in the cytosol of cells, and converts glucose into pyruvate through a series of enzymatic reactions, and produces ATP as an energy source. For example, adenovirus infection promotes the expression of GLUT1 and GLUT4 proteins in human primary skeletal muscle cells, and then increases glucose uptake through the PI3 kinase pathway activated by RAS. Hexokinases (HKs) are the first rate-limiting enzyme in the glycolysis process, and play an important role in the process. Viruses can affect host metabolism by utilizing HK2, thereby creating a microenvironment conducive to viral replication. For example, Hepatitis B virus (HBV) can isolate the MAVS of RIG-I by forming a hexokinase ternary complex, preventing its aggregation and mitochondrial localization during HBV infection, indicating that HK2 plays an important role in HBV immune escape.
[0004] Polyphenolic compounds are phytochemicals present in many plants and fruits. They have been reported to have the effects of antioxidants, free radical scavengers, metal chelators, anti-allergic, anticancer, antioxidant, anti-inflammatory, antifungal, antiviral and antibacterial agents. In general, these polyphenolic compounds are known to have medicinal and chemopreventive effects on human health. In particular, (-)-Gallocatechin gallate is one of the catechins. (-)-Gallocatechin gallate is the most abundant catechin, especially in tea and other plants, and it is an effective antioxidant that can have therapeutic effects on many diseases including cancer. There are also reports that (-)-Gallocatechin gallate has benefits for treating brain cancer, prostate cancer and other types of cancer. There is no report on the study of (-)-Gallocatechin gallate against porcine delta coronavirus. SUMMARY
[0005] The technical problem to be solved by the present application is to provide the use of (-)-Gallocatechin gallate in the preparation of a medicine for preventing and / or treating porcine delta coronavirus for the first time.
[0006] Technical scheme: In order to solve the above technical problems, the present application provides the use of (-)-Gallocatechin gallate or a pharmaceutically acceptable salt thereof in the preparation of a medicine for preventing and / or treating porcine delta coronavirus.
[0007] Preferably, the prevention is to prevent cells from being infected with porcine delta coronavirus or to reduce the infection rate of porcine delta coronavirus disease in cells.
[0008] Preferably, the treatment is to inhibit the growth and replication of porcine delta coronavirus in cells.
[0009] Preferably, the proliferation of PDCoV is inhibited.
[0010] Preferably, the expression of PDCoV-N gene is down-regulated or the expression amount of PDCoV-M protein is reduced.
[0011] Preferably, the proliferation of PDCoV is inhibited by activating the porcine HK2 gene with accession number NM_001122987.1, and the (-)-Gallocatechin gallate has an obvious activation effect on the expression of the HK2 gene, thereby having an obvious inhibitory effect on the proliferation of PDCoV.
[0012] Preferably, the HK is hexokinase, which has types I-IV.
[0013] Preferably, the HK2 is hexokinase type II.
[0014] The HK2 can inhibit the growth and replication of porcine delta coronavirus in cells.
[0015] The structure of the (-)-Gallocatechin gallate is as follows:
[0016]
[0017] The application further provides application of the (-)-Gallocatechin gallate or the pharmaceutically acceptable salt thereof in preparation of a medicine for inhibiting PDCoV proliferation.
[0018] The application further provides application of the (-)-Gallocatechin gallate or the pharmaceutically acceptable salt thereof in preparation of a medicine for down-regulating PDCoV-N gene expression or reducing PDCoV-M protein expression.
[0019] The application further provides application of the (-)-Gallocatechin gallate or the pharmaceutically acceptable salt thereof in preparation of a medicine for activating a porcine HK2 gene with an accession number of NM_001122987.1.
[0020] The (-)-Gallocatechin gallate has no toxic concentration of 1-5 μM to cells.
[0021] The (-)-Gallocatechin gallate has a concentration of 2-5 μM for inhibiting porcine delta coronavirus proliferation by activating HK2.
[0022] The medicine has any one of pharmaceutically acceptable dosage forms.
[0023] The medicine has oral preparations, spray preparations or injection preparations.
[0024] The medicine comprises a stereoisomer of the (-)-Gallocatechin gallate or a solvate of the (-)-Gallocatechin gallate as an effective component.
[0025] The medicine comprises a pharmaceutically acceptable salt of the (-)-Gallocatechin gallate or a solvate of the pharmaceutically acceptable salt of the (-)-Gallocatechin gallate.
[0026] Beneficial effects: Compared with the prior art, the present application has the following remarkable advantages: (1) the present application first discovers that (-)-Gallocatechin gallate has the activity of activating HK2, providing the application in preparing drugs for preventing and / or treating porcine delta coronavirus, and (-)-Gallocatechin gallate shows a significant inhibitory effect on the proliferation of porcine delta coronavirus in host cells, and has a good and stable anti-porcine delta coronavirus effect; (2) in the examples of the present application, pig testicular cells (ST) are used as a cell model, and the experimental results show that (-)-Gallocatechin gallate has no effect on cell activity in the concentration range of 1 μM-5 μM; in the concentration range of 2 μM-5 μM, it has a significant effect of activating HK2, and the virus inhibition effect shows a positive correlation with the concentration of (-)-Gallocatechin gallate, and can be used for preparing drugs for preventing and / or treating porcine delta coronavirus. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 Figure 1 is a molecular docking mode diagram of (-)-Gallocatechin gallate and HK2, showing the interaction site of (-)-Gallocatechin gallate and HK2;
[0028] Figure 2 Figure 2 is a graph of CCK-8 method for detecting the effect of different concentrations of (-)-Gallocatechin gallate on ST cell activity;
[0029] Figure 3 Figure 3 is a graph of fluorescence quantitative PCR (RT-qPCR) for detecting the effect of overexpression of HK2 gene on PDCoV-N gene in ST cells;
[0030] Figure 4 Figure 4 is a graph of Western Blot for detecting the effect of overexpression of HK2 gene on PDCoV-M protein in ST cells;
[0031] Figure 5 Figure 5 is a graph of fluorescence quantitative PCR (RT-qPCR) for detecting the effect of different concentrations of (-)-Gallocatechin gallate on PDCoV-N gene in ST cells: A: HK2 gene expression amount; B: PDCoV-N gene expression amount;
[0032] Figure 6 Figure 6 is a graph of Western Blot for detecting the effect of different concentrations of (-)-Gallocatechin gallate on PDCoV-M protein in ST cells. DETAILED DESCRIPTION
[0033] The technical solutions of the present application are further described below in conjunction with the drawings.
[0034] The cells, viruses and main reagents used in the present application are as follows:
[0035] Cell line: porcine testis ST cells (preserved in the laboratory), cultured in DMEM (Basal Media, Shanghai, China) with 10% fetal bovine serum (Ozfan, Nanjing, China).
[0036] Strain: PDCoV (CHN-GD16-05) is preserved in the laboratory and disclosed in Porcine Deltacoronavirus Infection Disrupts the Intestinal Mucosal Barrier and Inhibits Intestinal Stem Cell Differentiation to Goblet Cells via the Notch Signaling Pathway.
[0037] Main reagents: DMEM medium (Shanghai Yuanpei Biotechnology Co., Ltd.); fetal bovine serum (Nanjing Shenghang Biotechnology Co., Ltd.); CCK8 reagent kit (Nanjing Novizan Biotechnology Co., Ltd.); penicillin-streptomycin mixture (Beijing Solarbio Science & Technology Co., Ltd.); 0.25% trypsin (Gibco, USA); TRIzol (Baori Biotechnology (Beijing) Co., Ltd.); DEPC water (Beijing Solarbio Science & Technology Co., Ltd.); HiScript Q RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit (Nanjing Novizan Biotechnology Co., Ltd.); AceQ qPCR SYBR Green Master Mix Real-Time Fluorescence Reagent Kit (Nanjing Novizan Biotechnology Co., Ltd.); Protein Lysis Buffer (Shanghai Beyotime Biotechnology Co., Ltd.); Protease Inhibitor (TargetMOI, MA, USA); 5× Non-denaturing Protein Loading Buffer (Shanghai Yamei Biomedical Technology Co., Ltd.); 10% Protein Precast Gel (Shanghai Yamei Biomedical Technology Co., Ltd.); PDCoV-M Antibody (Catalog No.: DA0324, Shanghai Youlong Biotechnology Co., Ltd.) and HK2 Protein Antibody (22029-1-AP, Wuhan Sanying Biotechnology Co., Ltd.); Anti-GAPDH Antibody (60004-1-Ig, Wuhan Sanying Biotechnology Co., Ltd.); High-Sensitive ECL Chemiluminescence Kit (Suzhou Xinsaimei Biotechnology Co., Ltd.); CoraLite594-conjugated Goat Anti-Mouse IgG (H+L) Secondary Antibody (AA042111, Nanjing Baode Biotechnology Co., Ltd.).
[0038] All reagents not specifically described in the application are conventional reagents and are commercially available; all methods not specifically described in detail are conventional experimental methods and are known from the prior art.
[0039] Example 1: Predicting the interaction sites between (-)-Gallocatechin gallate and HK2 using molecular docking
[0040] This invention employs a semi-flexible docking method to form a stable complex. This process is crucial for elucidating mechanisms of action and screening lead compounds, thus becoming one of the fundamental methods in structure-based drug design. Gallocatechin gallate (PubChem CID: 199472) was molecularly docked with protein HK2 (Uniprot ID: Q1W674_) using AutoDockVina 1.1.2 software. The dimensions of the protein docking box are... Grid spacing The coordinates of the docking box are: x:y:z:-16.329:1.962:31.101. Other parameters remain the default value. The docking results are set to output 9 best docking positions. The docking conformation with the lowest binding energy and the highest clustering frequency is considered as the most potential binding mode between the ligand and the protein. Finally, the docking results are visualized using Pymol 2.4 software. In this way, the binding of the ligand and the receptor can be observed intuitively, and the stability and interaction of the complex can be further analyzed.
[0041] The results are shown in Figure 1 HK2 (Q1W674) was selected as the receptor, and Gallocatechin gallate was selected as the ligand. The hydrogen bond is represented by yellow, showing the interaction site of (-)-Gallocatechin gallate with HK2.
[0042] Example 2: CCK-8 method for detecting the effect of different concentrations of (-)-Gallocatechin gallate on ST cell activity
[0043] 2000 ST cells (100 μL) per well were mixed with 10% FBS DMEM medium and inoculated in a 96-well plate, and cultured in a 37°C, 5% CO2 incubator for 24 h. When the cell density reached 80%, (-)-Gallocatechin gallate (Shanghai Taoshu Biological Technology Co., Ltd.) was dissolved in DMSO to 10 μM, and then water was added to dilute to 1 μM, 2 μM, 5 μM, 10 μM, 20 μM, 50 μM, 100 μM, respectively, and added to the 96-well plate (3 replicates for each concentration), and a control group (only DMSO was added) was set up, and the treatment time was set to 24 h. Then the cell viability was detected using the CCK-8 kit, and the CCK-8 solution was added to the 96-well plate at 10 μL per well. The optical density value was detected at 450 nm using a Tecan Infinit200 enzyme label instrument (Sunrise, Tecan, Switzerland). The data was analyzed using GraphPad 8.0.1 software, and the Student t test was used for statistical analysis, ns indicates no significant difference, *p<0.05 indicates significant difference, ***p<0.001 indicates extremely significant difference.
[0044] The results are shown in Figure 2 Compared with the blank group, (-)-Gallocatechin gallate had no significant effect on cell activity in the concentration range of 1-5 μM.
[0045] Example 3: Effect of overexpression of HK2 gene on PDCoV-N gene in ST cells detected by fluorescent quantitative PCR (RT-qPCR)
[0046] ST cells were inoculated in a 12-well plate at a density of 2 x 10 5 cells / well in 1 mL of DMEM medium, and HK2 overexpression plasmid transfection was performed when the cell confluence reached about 60%. The steps of HK2 overexpression plasmid transfection were as follows: The CDS region of the porcine HK2 gene (NM_001122987.1) was amplified using PCR amplification technology with the cDNA of ST cells as the template; primers were designed according to the CDS region of HK2, and enzyme cutting sites (EcoR-I, BamH-I) were added to the primers. The primer sequences were OE-HK2-F: GTGACCGGCGCCTAC GAATTC AT GATCGCCTCGCATCTGCT (underlined as EcoR-I enzyme cutting site); R: ATCGATGGACCGGTCG GGATCC CCGCTGTCCAGCCTCTCGGAT (underlined as BamH-I enzyme cutting site). The nucleotide fragment with a size of 2751 bp consistent with the target fragment was obtained by PCR amplification and gel verification, and the target fragment was recovered by purification and sequencing. The sequencing results were compared with the sequence fragment to determine the correct sequence. The amplification program was as follows: 98°C for 3 min; 98°C for 10 s; 60°C for 20 s; 72°C for 90 s; 72°C for 5 min, 35 cycles; the amplification system was as follows: cDNA: 2 μL; Forward primer: 1 μL; Reverse primer: 1 μL; 2 x Hieff Cana ce Plus PCR Master Mix (With Dye): 12.5 μL; ddH2O: supplemented to 25 μL. The sequence of the target fragment with a size of 2751 bp was as follows:
[0047] ATGATCGCCTCGCATCTGCTCGCCTACTTCTTTACAGAGCTCAACCATGACCAA
[0048] GTGCAGAAGGTTGACCAGTATCTCTACCACATGCGCCTCTCCGATGAGACCCTTCT
[0049] GGAGATAGCTAAGCGGTTCCGCAAGGAGATGGAGAAAGGGCTTGGAGCTACCACC
[0050] CACCCCACTGCTTCAGTAAAAATGCTGCCCACCTTTGTGAGGTCTACTCCGGATGG
[0051] GACAGAACACGGAGAGTTCCTGGCTCTGGATCTTGGGGGGACCAATTTCCGGGTG
[0052] CTTTGGGTGAGAGTAACAGACAACGGACTCCAGAAGGTTGAGATGGAGAACCAG
[0053] ATCTACGCCATCCCCGAGGACATCATGCGAGGCAGTGGCACCCAGCTGTTCGACC
[0054] ACATTGCCGAGTGCCTGGCTAACTTCATGGATAAGCTACAAATCAAAGACAAGAA
[0055] GCTCCCTTTGGGTTTCACCTTCTCATTCCCTTGCATCCAAACCAAATTAGATGAGAG
[0056] TTTCCTGGTTTCATGGACCAAGGGTTTCAAGTCCAGTGGTGTGGAAGGGAAAGAC
[0057] GTGGTTACTCTAATCCGGAAGGCCATCCAGAGGAGAGGGGACTTTGATATTGATAT
[0058] TGTGGCCGTGGTGAATGACACAGTTGGGACCATGATGACCTGTGGTTATGATGACC
[0059] AGAACTGCGAGATCGGTCTCATTGTGGGCACGGGCAGCAACGCCTGCTACATGGA
[0060] GGAGATGCGTCACATCGACATGGTAGAAGGTGACGAGGGGCGTATGTGTATCAAC
[0061] ATGGAGTGGGGGGCCTTTGGGGATGACGGCGCCCTTGACGACATCCGCACCGAGT
[0062] TTGACCAGGAGATCGACATGGGCTCTCTGAACCCCGGGAAGCAACTATTTGAGAA
[0063] GATGATCAGTGGATTGTACATGGGGGAGCTGGTGAGGTTGATCCTGGTGAAGATGG
[0064] CCAAGGAGGAGCTGCTTTTCGGGGGGAAGCTCAGTCCTGAACTCCTTGCCACGGG
[0065] CCACTTTGAGACCAAAGATGTTTCGGATATTGAAGGGGAGAAGGATGGCATCCGG
[0066] AAGGCCCGGGAGGTCCTGGTGCGGCTGGGCCTGGACCCGACACAGGAGGACTGT
[0067] GTGGCCACTCACCGGGTCTGCCAGATCGTGTCCACACGCTCAGCCAGCCTGTGTG
[0068] CGGCCACACTGGCGGCCGTGCTACGGCGCATCAAGGAGAACAAGGGCGAGGAGC
[0069] GGCTGCGCTCCACCATCGGCGTGGACGGCTCTGTCTACAAGAAACACCCCCATTTC
[0070] GCCAAGCGTCTTCACAAGACCTTGCGGCGCCTGGTGCCTGACTGCGACATCCGCT
[0071] TCCTCCGCTCTGAGGACGGCAGTGGCAAGGGGGCTGCCATGGTGACAGCAGTGGC
[0072] CTACCGGCTGGCCGATCAACACCGAGCCCGCCAGAAGACTCTGGAGCCTCTAAAG
[0073] CTGAGCCGTGAGCAGCTGCTGGAGGTCAAGAGGAGGATGAAGGTGGAAATGGAG
[0074] CGAGGTCTGAGCAAGGAGACTCATGCCATTGCCCCAGTCAAGATGCTGCCCACCT
[0075] ATGTGTGTGCCACCCCGGATGGCACAGAGAAAGGCGACTTCCTGGCCTTGGACCT
[0076] CGGGGGTACCAATTTCCGGGTCCTGCTGGTGCGCGTGCGGAATGGGAAGCGACGC
[0077] GGAGTGGAGATGCACAACAAGATCTACTCGATCCCGCAGGAGGTCATGCACGGCA
[0078] CAGGGGACGAGCTCTTTGACCACATCGTCCAGTGCATTGCTGACTTCCTCGAGTAC
[0079] ATGGGCATGAAGGGCGTGTCCCTGCCTCTGGGTTTCACCTTCTCCTTCCCCTGCCA
[0080] GCAGAACAGCCTGGATGAGAGCATCCTTCTCAAGTGGACTAAAGGCTTCAAGGCC
[0081] TCTGGCTGTGAGGGCGAGGACGTGGTCACACTGCTGAAGGAAGCCATCCACCGGC
[0082] GAGAGGAGTTTGACCTGGACGTGGTCGCTGTGGTGAATGACACGGTTGGGACTAT
[0083] GATGACCTGTGGCTATGAAGACCCTCACTGCGAAGTCGGCCTCATCGTTGGCACG
[0084] GGCAGCAATGCCTGCTACATGGAGGAGATGCGGAATGTCGAGCTGGTGGAAGGGG
[0085] AAGAGGGGCGGATGTGTGTCAACATGGAGTGGGGGGCCTTCGGGGACAATGGATG
[0086] CCTGGATGACTTCCGCACAGAATTTGATGCGGCCGTGGATGAACTTTCCCTCAATG
[0087] CTGGCAAACAGAGGTTCGAGAAAATGATCAGCGGCATGTACCTGGGTGAGATTGT
[0088] TCGTAACATCCTCATCGATTTCACCAAGCGTGGGCTGCTCTTTCGTGGCCGCATCTC
[0089] GGAGCGACTCAAGACGAGGGGCATCTTTGAAACCAAGTTCCTGTCTCAGATTGAG
[0090] AGTGACTGCCTGGCCCTGCTGCAGGTCCGCGCCATCCTGCACCACTTGGGGCTTG
[0091] AGAGCACTTGCGGCGACAGCATCATTGTCAAGGAGGTGTGCACGGTGGTGGCGCG
[0092] GCGGGCAGCCCAGCTCTGCGGTGCAGGCATGGCCGCCGTGGTGGACAAAATACGA
[0093] GAAAACCGGGGGCTGGACACCCTCAAAGTGACGGTGGGCGTGGACGGGACCCTC
[0094] TACAAGCTACATCCTCACTTTGCCAAAATCATGCATGAGACAGTGAAGGACCTGGC
[0095] TCCAAAATGTGACGTGTCCTTCCTGGAGTCAGAGGACGGCAGTGGGAAGGGGGC
[0096] AGCCCTCATCACTGCTGTGGCCTGCCGCATCCGAGAGGCTGGACAGCGG
[0097] The recovered product with correct sequencing was subjected to double enzyme digestion at 37°C for 3h in a metal bath. After enzyme digestion, the linearized fragment was recovered using a purification recovery kit. The recovered product was stored at -20°C for further use. The enzyme digestion product was further purified and ligated to the enzyme-digested pcDNA3.1(-) vector (enzyme digestion system: EcoR-I 1 μL, BamH-I 1 μL, rCutsmart 5 μL, pcDNA3.1(-) 2000 ng, ddH2O supplemented to 50 μL; enzyme digestion reaction: 37°C, 3h). After 50°C for 5min, the ligation was transformed into competent cells DH5α Chemically Competent Cell and smeared on an agarose gel plate containing ampicillin. The plate was incubated in a 37°C incubator overnight. The bacteria were picked and sequenced. The positive results were sent to Shanghai Shengong Bioengineering Co., Ltd. for sequencing. The sequencing results showed that the HK2 overexpression vector was successfully constructed. The HK2 overexpression vector was subsequently transfected into ST cells.
[0098] At 24 h post-transfection, ST cells were inoculated with PDCoV (MOI = 1), and 2 h later, the virus solution was discarded and replaced with maintenance solution containing 2% FBS (containing 50 mL of DMEM medium, 2% fetal bovine serum FBS, 4 μg / mL trypsin). After 24 h of culture at 37°C, 5% CO2, the cells were collected to obtain the OE-HK2+PDCoV group cells. Control group (MOCK+PDCoV): blank ST cells plus virus group. Total RNA was extracted from the treated cells: 1 mL of TriZol was added to the cell well, and the cells were lysed by blowing up and down, and collected into a 1.5 mL EP tube. 200 μL of chloroform was added to each tube, mixed thoroughly, and placed on ice for 10 minutes; centrifuged at 4°C, 13000 rpm for 20 minutes. After centrifugation, the upper aqueous phase was transferred to a new 1.5 mL EP tube, and an equal amount of pre-cooled isopropanol was added. The mixture was placed in a -20°C refrigerator for 30 minutes, and centrifuged at 13000 rpm for 20 minutes; the supernatant was discarded, and the RNA precipitate was washed with 1 mL of 75% alcohol; the RNA precipitate was washed again with 75% alcohol at 13000 rpm for 15 minutes; the supernatant was discarded, and the RNA precipitate was air-dried for 5 minutes. The extracted RNA was dissolved in 20 μL of DEPC water, and the purity and concentration of the extracted RNA were detected using a NanoDrop-1000 micro-volume assay instrument. The samples were stored at -80°C for later use. According to the gene sequence published in the GenBank database, GAPDH (accession number: NM_001206359.1) was used as an internal reference gene, and qPCR primers were designed using the NCBI website. The GAPDH upstream primer was 5'-ACATC ATCCCTGCTTCTACTGG-3', the downstream primer was 5'-CTCGGACGCCTGCTTCAC-3', the PDCoV-N upstream primer was 5'-AGCTGCTACCTCTCCGATTC-3', and the downstream primer was 5'-ACATTGGCACCA GTACGAGA-3'. The primers were prepared by TsingKe, Beijing, China. Complementary DNA (cDNA) was generated using the HiScript Q RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit as the RT-PCR template: 20 μL of the reverse transcription system contained 1000 ng of RNA, 4 μL of reverse transcriptase 5×qRT SuperMix, and DEPC water to make up 20 μL. The reverse transcription program was 50°C for 15 minutes and 85°C for 5 seconds. GAPDH was used as an internal reference, and real-time fluorescent quantitative PCR was performed using the above-designed GAPDH primers and PDCoV-N primers to detect the expression of the PDCoV-N gene.qPCR analysis was performed using a real-time fluorescent quantitative kit (Vazyme, Nanjing, China), and three independent repeats were set for each analysis sample. The data were analyzed using GraphPad 8.0.1 software, and the Student t test was used for statistical analysis. *p < 0.05 indicates significant difference.
[0099] The results are shown in Figure 3 After transfection of the HK2 gene overexpression plasmid, the expression of the PDCoV-N gene was down-regulated, indicating that HK2 inhibited the proliferation of PDCoV.
[0100] Example 4: Western Blot analysis of the effect of overexpression of the HK2 gene on PDCoV-M protein in ST cells
[0101] As in Example 3, ST cells were seeded at a density of 2 x 10 5 cells per well in a 6-well plate containing 2 mL of medium, and HK2 overexpression plasmid transfection was performed when the cell confluence reached about 60%. 24 h after transfection, ST cells were inoculated with PDCoV (MOI = 1), and 2 h later, the virus liquid was discarded and replaced with maintenance liquid containing 2% FBS for continued culture for 24 h. Protein lysis buffer (RIPA) was used, and protease inhibitors were added at a ratio of 1:100 for low-temperature lysis for 20 min. Centrifugation was performed at 14,000 rpm for 20 min at 4°C to obtain the supernatant. The protein concentration was determined using a BCA protein assay kit (Beyotime, Shanghai, China) and denatured at 98°C for 10 min.
[0102] Polyacrylamide gel electrophoresis was performed on the samples, and electrophoresis was performed on PVDF membranes (Millipore, Canada, USA). After blocking at room temperature for 2 h, PDCoV-M antibodies and anti-GAPDH antibodies were used, respectively, and incubated at 4°C overnight. The PVDF membrane was washed with TBST, incubated with CoraLite594-conjugated Goat Anti-Mouse IgG (H+L) secondary antibody (Proteintech, Wuhan, China) at room temperature, and the samples were washed with TBST and analyzed by ECL.
[0103] The results are shown in Figure 4 After transfection of the HK2 gene overexpression plasmid, the expression of the PDCoV-M protein was down-regulated, indicating that HK2 inhibited the proliferation of PDCoV. Among them, OE-HK2: ST cells transfected with HK2 overexpression vector; PDCoV: PDCoV cells; PDCoV-M: PDCoV-M protein; GAPDH: GAPDH protein.
[0104] Example 5: Real-time quantitative PCR (RT-qPCR) to detect the effect of different concentrations of (-)-Gallocatechin gallate on PDCoV-N gene in ST cells
[0105] As in Example 3, ST cells were seeded at 2 x 10 5The density of 1 cell / hole was inoculated in a 12-well plate containing 1 mL of medium, and HK2 overexpression plasmid transfection was performed when the cell confluence reached about 60%. 24 h after transfection, ST cells were inoculated with PDCoV (MOI=1), and 2 h later, the virus liquid was discarded and replaced with maintenance liquid containing 2% FBS, and then 2 μM or 5 μM of (-)-Gallocatechin gallate was added to each well, respectively. After 24 h of continuous culture, the cells were collected. Total RNA was extracted from the treated cells: 1 mL of TriZol was added to the cell well, and the cells were lysed by blowing up and down, and collected into a 1.5 mL EP tube. 200 μL of chloroform was added to each tube, mixed thoroughly, and then placed on ice for 10 minutes; centrifuged at 13000 rpm for 20 minutes at 4°C. After centrifugation, the upper aqueous phase was transferred to a new 1.5 mL EP tube, and an equal amount of pre-cooled isopropanol was added. The mixture was placed in a -20°C refrigerator for 30 minutes, and then centrifuged at 13000 rpm for 20 minutes; the supernatant was discarded, and the RNA precipitate was washed with 1 mL of 75% alcohol; the RNA precipitate was washed again with 75% alcohol at 13000 rpm for 15 minutes; the supernatant was discarded, and the RNA precipitate was air-dried for 5 minutes. The extracted RNA was dissolved in 20 μL of DEPC water, and the purity and concentration of the extracted RNA were detected using a NanoDrop-1000 micro-volume accounting instrument. The samples were stored at -80°C for later use. The HiScript Q RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit was used to generate complementary DNA (cDNA) as an RT-PCR template: the 20 μL reverse transcription system contained 1000 ng of RNA, 4 μL of reverse transcriptase 5× qRT Super Mix, and DEPC water was added to 20 μL. The reverse transcription program was 50°C for 15 minutes and 85°C for 5 seconds. GAPDH was used as an internal reference, and the HK2 gene and PDCoV-N expression were detected by real-time fluorescent PCR using the GAPDH primers and PDCoV-N primers designed in Example 3 and the HK2 primers: F: GAAACACCCCCATTTCGCCA, R: GTCTCCTTGCTC AGACCTCG. Real-time fluorescent quantitative reagent kit (Vazyme, Nanjing, China) was used for qPCR analysis, and each analysis sample was set up in three independent repeats. The data were analyzed using GraphPad 8.0.1 software, and the Student t test was used for statistical analysis. *p<0.05 indicates a significant difference, and **p<0.01 indicates a very significant difference.
[0106] The results are shown in Figure 5 Compared with the control group, the expression of the HK2 gene was up-regulated after the addition of (-)-Gallocatechin gallateFigure 5 A), and the expression of PDCoV-N gene was significantly down-regulated Figure 5 B), the proliferation of virus was inhibited.
[0107] Example 6: Western Blotting to detect the effect of different concentrations of (-)-Gallocatechin gallate on PDCoV-M protein in ST cells
[0108] As in Example 3, ST cells were seeded in a 6-well plate at a density of 2x10 5 After 24h of transfection, ST cells were inoculated with PDCoV (MOI = 1), and 2h later, the virus solution was discarded and replaced with maintenance medium containing 2% FBS. Then, 2μM and 5μM of (-)-Gallocatechin gallate were added, respectively, and the cells were cultured for another 24h. After that, the cells were collected. The cells were lysed with RIPA (Applygen, Beijing, China) containing protease inhibitors (Target MOI, MA, USA) at low temperature for 20min, and the supernatant was obtained by centrifugation at 14,000rpm for 20min at 4°C. The protein concentration was adjusted using the BCA protein assay kit (Beyotime, Shanghai, China) and denatured at 98°C for 10min.
[0109] Polyacrylamide gel electrophoresis was performed on the samples, and the proteins were transferred to PVDF membranes (Millipore, Canada, USA) by electrophoresis. After blocking at room temperature for 2h, the HK2 protein antibody, PDCoV-M antibody, and anti-GAPDH antibody were used for incubation at 4°C overnight, respectively. The PVDF membranes were washed with TBST, and incubated with CoraLite594-conjugated Goat Anti-Mouse IgG (H+L) secondary antibody at room temperature for 2h. After washing the samples with TBST, the samples were analyzed by ECL.
[0110] The results are shown in Figure 6 Compared with the control group, the expression of HK2 protein was up-regulated, the expression of PDCoV-M protein was significantly down-regulated, and the proliferation of virus was inhibited after the addition of (-)-Gallocatechin gallate.
[0111] The above results show that (-)-Gallocatechin gallate has the effect of stabilizing the activation of HK2 and inhibiting the replication of porcine delta coronavirus.
Claims
1. Use of (-)-gallocatechin gallate or a pharmaceutically acceptable salt thereof in the preparation of a drug for preventing and / or treating porcine deltacoronavirus.
2. Use according to claim 1, characterized in that, inhibit the proliferation of PDCoV.
3. Use according to claim 1 or 2, characterized in that, down-regulate the expression of PDCoV-N gene or reduce the expression amount of PDCoV-M protein.
4. The use according to any one of claims 1 to 3, characterized in that, inhibit the proliferation of PDCoV by activating the porcine HK2 gene with accession number NM_001122987.
1.
5. Use of (-)-gallocatechin gallate or a pharmaceutically acceptable salt thereof in the preparation of a drug for inhibiting the proliferation of PDCoV.
6. Use according to claim 1 or 5, characterized in that, The concentration of the (-)-gallocatechin gallate is 2 µM ~ 5 µM.
7. Use according to claim 1 or 5, characterized in that, The dosage form of the drug includes oral preparation, spray preparation or injection preparation.
Citation Information
Patent Citations
Application of nano-selenium in preparation of medicine for resisting porcine deltacoronavirus
CN116850204A