Application of TGM2 in preparation of medicine for regulating and controlling osteogenic differentiation potential of BMMSCs of diabetic patient and bone defect regeneration of diabetic patient

Abstract

The invention relates to application of TGM2 in preparation of a medicine for regulating and controlling BMMSCs osteogenic differentiation potential of diabetic patients and bone defect regeneration of the diabetic patients, relates to the technical field of biological medicine, and finds the molecular TGM2 which is closely related to osteogenic differentiation regulation and control of the diabetic patients and is used for bone defect regeneration of the diabetic patients for the first time. The expression of the TGM2 protein in stem cells subjected to osteogenic differentiation under the condition of diabetes mellitus is remarkably reduced. Through functional study, the TGM2 down-regulates the osteogenic differentiation potential of the damaged BMMSC, and after the TGM2 level is over-expressed under the condition of diabetes, the damage of the osteogenic differentiation potential of the BMMSC can be reversed. Therefore, the invention provides a novel and accurate molecular target TGM2 for regulating and controlling the differentiation potential of stem cells in a diabetic microenvironment and preparing a medicine for regenerating the bone defect of a diabetic patient, and provides a theoretical basis for realizing the regeneration of the bone defect of the diabetic patient and the like.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the application of TGM2 in the preparation of a drug for regulating the osteogenic differentiation potential of BMMSCs of diabetic patients and the regeneration of bone defects in diabetic patients. Background Art

[0002] Diabetes mellitus (DM) is a chronic metabolic disease characterized by long-term hyperglycemia, affecting tens of millions of patients and placing tremendous pressure on the global medical system. Poor blood sugar control leads to the accumulation of reactive oxygen species (ROS) and advanced glycosylation end products (AGEs), immune abnormalities, etc., which cause increased bone fragility and hindered bone defect regeneration in diabetic patients. Bone marrow mesenchymal stem cells (BMMSCs) can differentiate into osteoblasts under appropriate conditions and play an important role in regulating bone metabolism stability. At the same time, previous studies have shown that delayed bone defect regeneration in diabetic patients is related to abnormal osteogenic differentiation potential of BMMSCs.

[0003] Transglutaminase type 2 (TGM2, also known as transglutaminase 2 or tissue transglutaminase) is a member of the transglutaminase family and a widely expressed multifunctional enzyme that catalyzes a wide range of protein post-translational modifications (PTMs), such as protein cross-linking and guanosinetriphosphate (GTP) hydrolysis activity. TGM2 is widely expressed in various tissues and different cell types, and its activity is involved in a series of physiological activities and pathological processes, including bone development, type 2 diabetes and its various complications. More importantly, TGM2 plays an important role in cell osteogenic differentiation and can significantly affect bone matrix mineralization. However, there is still a lack of research on the role of TGM2 in the abnormal osteogenic differentiation potential of BMMSCs under diabetic conditions. Summary of the invention

[0004] In order to solve the above problems, the present invention provides the use of TGM2 in the preparation of a drug for regulating the osteogenic differentiation potential of BMMSCs of diabetic patients and the regeneration of bone defects in diabetic patients.

[0005] In a first aspect, the present invention provides the use of TGM2 in the preparation of a drug for regulating the osteogenic differentiation potential of BMMSCs of diabetic patients and the regeneration of bone defects in diabetic patients.

[0006] Furthermore, the expression of TGM2 is significantly reduced in stem cells undergoing osteogenic differentiation under diabetic conditions.

[0007] Furthermore, downregulation of TGM2 impaired the osteogenic differentiation potential of BMMSCs, while overexpression of TGM2 levels under diabetic conditions reversed the impairment of BMMSC osteogenic differentiation potential.

[0008] In a second aspect, the present invention provides a molecular target for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, wherein the molecular target for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients is TGM2.

[0009] In a third aspect, the present invention provides a molecular target for preparing a drug for treating bone defect regeneration in diabetic patients, wherein the molecular target of the drug for treating bone defect regeneration in diabetic patients is TGM2.

[0010] In a fourth aspect, the present invention provides a method for screening drugs for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, wherein the method uses TGM2 as a target.

[0011] In a fifth aspect, the present invention provides a method for screening and preparing a drug for treating bone defect regeneration in diabetic patients, wherein the method uses TGM2 as a target.

[0012] The above technical solution provided by the embodiment of the present invention has at least the following advantages compared with the prior art:

[0013] The embodiment of the present invention provides the use of TGM2 in the preparation of drugs for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients. The present invention has discovered for the first time a molecule TGM2 that is closely related to the regulation of osteogenic differentiation in diabetic patients and the regeneration of bone defects in diabetic patients. The experimental results show that the expression of TGM2 protein in stem cells undergoing osteogenic differentiation under diabetic conditions is significantly reduced. Through functional studies, TGM2 downregulation damages the osteogenic differentiation potential of BMMSCs, and after overexpressing the level of TGM2 under diabetic conditions, the damage to the osteogenic differentiation potential of BMMSCs can be reversed. Therefore, the present invention provides a new and precise molecular target TGM2 for regulating the differentiation potential of stem cells in the diabetic microenvironment and preparing drugs for the regeneration of bone defects in diabetic patients, and provides a theoretical basis for achieving diabetic bone defect regeneration and other aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0016] Figure 1 This is a graph showing the test results of mRNA microarray chips screening for differentially expressed mRNAs in BMMSCs derived from normal rats and type 2 diabetic rats in an embodiment of the present invention.

[0017] Figure 2 This is a graph showing the test results of mRNAs molecules screened by qRT-PCR low-throughput verification in an embodiment of the present invention.

[0018] Figure 3 This is a graph showing the expression trend of TGM2 verified by Western blot in an embodiment of the present invention.

[0019] Figure 4 This is a graph showing the effect of silencing TGM2 on the osteogenic differentiation of BMMSCs from type 2 diabetic rats in an example of the present invention.

[0020] Figure 5 This is a graph showing the effect of overexpression of TGM2 on osteogenic differentiation of BMMSCs from normal rats in an example of the present invention. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0023] In order to make up for the shortcomings of the existing technology, the inventors combined the previous experimental basis, screened and identified a key molecule TGM2 that is closely related to abnormal regeneration of diabetic bone defects and can regulate the osteogenic differentiation potential of BMMSCs through high-throughput sequencing, and conducted in-depth research at the molecular mechanism level. It can be used as a molecular marker to evaluate the development of the disease, which is not only an important part of analyzing the pathogenesis of the disease, but also can provide an important basis for disease monitoring and risk assessment.

[0024] The technical solution provided by the present invention is specifically as follows:

[0025] In a first aspect, the present invention provides the use of TGM2 in the preparation of a drug for regulating the osteogenic differentiation potential of BMMSCs of diabetic patients and the regeneration of bone defects in diabetic patients.

[0026] In some specific embodiments, the expression of TGM2 is significantly reduced in stem cells undergoing osteogenic differentiation under diabetic conditions.

[0027] In some specific embodiments, down-regulation of TGM2 impairs the osteogenic differentiation potential of BMMSCs, while overexpression of TGM2 under diabetic conditions reverses the impairment of the osteogenic differentiation potential of BMMSCs.

[0028] In a second aspect, the present invention provides a molecular target for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, wherein the molecular target for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients is TGM2.

[0029] In a third aspect, the present invention provides a molecular target for preparing a drug for treating bone defect regeneration in diabetic patients, wherein the molecular target of the drug for treating bone defect regeneration in diabetic patients is TGM2.

[0030] In a fourth aspect, the present invention provides a method for screening drugs for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, wherein the method uses TGM2 as a target.

[0031] In a fifth aspect, the present invention provides a method for screening and preparing a drug for treating bone defect regeneration in diabetic patients, wherein the method uses TGM2 as a target.

[0032] It should be noted that the component raw materials involved in the application of TGM2 provided in the embodiments of the present invention in the preparation of drugs for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and regenerating bone defects in diabetic patients, unless otherwise specified or specified, can be directly commercially available products or homemade using existing public preparation methods; at the same time, the steps and parameters involved, unless otherwise specified or specified, can be carried out according to the methods and parameters disclosed in the prior art or directly using existing equipment, and the present invention document will not repeat them one by one.

[0033] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually measured according to national standards. If there is no corresponding national standard, then the conditions recommended by the manufacturer are followed.

[0034] The information of the main reagents and equipment involved in the following examples is as follows:

[0035] Rat bone marrow mesenchymal stem cell osteogenic differentiation kit (Cyagen, China).

[0036] Rat mRNA Array chip (ArrayStar, USA).

[0037] Micropoly TransfecterTM Cell Reagent (Micropoly, China).

[0038] Ⅱ1st Strand cDNA Synthesis SuperMix (Yisheng, China).

[0039] qPCR SYBR Green Master Mix (Yisheng, China).

[0040] CFX96 real-time fluorescence quantitative PCR system (Bio-Rad, USA).

[0041] Primers and small interfering RNA were ordered from Qingke Biotechnology Co., Ltd. The sequences are as follows:

[0042] β-actin(Forward),CCCATCTATGAGGGTTACGC;

[0043] β-actin(Reverse),TTTAATGTCACGCACGATTTC;

[0044] GAPDH(Forward),ACAGCAACAGGGTGGTGGAC;

[0045] GAPDH(Reverse),TTTGAGGGTGCAGCGAACTT;

[0046] ALP(Forward),GACAGACCCTCCCCACTCC;

[0047] ALP(Reverse),GGGTCTTTCTCTTTCTCTGGCA;

[0048] BSP(Forward),AGGACTGCCGAAGGAAGAAAT;

[0049] BSP(Reverse),TAGCGTGGCCGGTACTTAAA;

[0050] SP7(Forward),GTCCTCTCTGCTTGAGGAAG;

[0051] SP7(Reverse),CTCCTTTTCCCAGGGCTGTT;

[0052] TGM2(Forward),CATGGCCGAGGAGCTGAA;

[0053] TGM2(Reverse),GCAGCACCAGTTTCTGTTGG;

[0054] si-TGM2,5'-GGCUGACACUGUACUUCGA-3',3'-UCGAAGUACAGUGUCAGCC-5.

[0055] TGM2 overexpression plasmid (TSINGKE, China).

[0056] Example

[0057] This example provides the use of TGM2 in the preparation of drugs for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients. The present invention has discovered for the first time a molecule TGM2 that is closely related to the regulation of osteogenic differentiation in diabetic patients and the regeneration of bone defects in diabetic patients. The experimental results show that the expression of TGM2 protein in stem cells undergoing osteogenic differentiation under diabetic conditions is significantly reduced. Through functional studies, downregulation of TGM2 damages the osteogenic differentiation potential of BMMSCs, and overexpression of TGM2 levels under diabetic conditions can reverse the damage to the osteogenic differentiation potential of BMMSCs. Therefore, the present invention provides a new and precise molecular target TGM2 for regulating the differentiation potential of stem cells in the diabetic microenvironment and preparing drugs for the regeneration of bone defects in diabetic patients, and provides a theoretical basis for achieving diabetic bone defect regeneration and other aspects, and specifically includes the following steps:

[0058] 1. Screening and identification of molecules (TGM2 protein) closely related to osteogenic differentiation of stem cells under diabetic conditions

[0059] 1.1 mRNA microarray

[0060] The present invention constructs a rat model of type 2 diabetes mellitus (T2DM), extracts BMMSCs from its femur, and induces osteogenic differentiation of stem cells by adding osteogenic induction solution. After culturing stem cells from normal rats (normal group, marked as Nor in the figure) and stem cells from T2DM rats (type 2 diabetes group, T2DM in the figure) for 7 days, samples are collected and sent to mRNA microarray chip sequencing (Kangcheng Biology), and the key molecules closely related to the osteogenic differentiation of BMMSC under diabetic conditions are preliminarily screened and identified according to the sequencing results.

[0061] The specific steps of chip sequencing are as follows: After incubating the cells, add an appropriate amount of Trizol to extract total cell RNA. Then use the spectrophotometer NanoDropND-1000 to control RNA quality (OD260 / 280 is qualified when it is between 1.8-2.0). After the sample quality control is qualified, cDNA is obtained by reverse transcription, and then transcribed into labeled cRNA. The chip hybridization is completed by using the Agilent GeneExpression Hybridization Kit, and the hybridization chip is scanned by using the Agilent Microarray Scanner. Finally, the original data and standardized data are obtained. The above experiment has been commissioned to Shanghai Kangcheng Biotechnology Co., Ltd.

[0062] 1.2 Analysis of chip data to screen key differential mRNA molecules

[0063] Analysis of the sequencing results revealed that 1,678 mRNA molecules were differentially expressed in BMMSCs from type 2 diabetic rats, of which 894 mRNA molecules were upregulated and 784 mRNA molecules were downregulated.

[0064] Based on the above differentially expressed mRNA molecules, the 10 mRNA molecules with the highest up- and down-regulation fold changes were selected for subsequent quantitative real-time polymerase chain reaction (qRT-PCR) verification. The results showed that only 8 mRNA molecules had consistent qRT-PCR results with the chip results in terms of change trend, among which TGM2 had the highest fold change, suggesting that it may play an important role in the osteogenic differentiation of stem cells from T2DM rats.

[0065] Western blot was used to further verify the expression level of TGM2 protein. The results showed that, inconsistent with the expression trend of TGM2 mRNA, its protein level was significantly reduced in BMMSCs derived from T2DM rats.

[0066] 2. Functional verification of the effect of TGM2 on osteogenic differentiation of BMMSCs

[0067] In order to determine whether TGM2 is involved in the process of diabetes affecting BMMSC osteogenic differentiation, the present invention transfected BMMSCs with siRNA of the target molecule, silenced the expression of TGM2 molecules, and observed its effect on the osteogenic differentiation of stem cells.

[0068] 2.1 siRNA transfection into BMMSCs and evaluation of transfection efficiency

[0069] ① In order to silence the expression of TGM2 molecules, siRNA targeting the target molecule TGM2 and negative control (si-NC) were ordered from Qingke Biotechnology. The sequence of siRNA was si-TGM2, 5'-GGCUGACACUGUACUUCGA-3', 3'-UCGAAGUACAGUGUCAGCC-5'. After the test tube containing siRNA freeze-dried powder was centrifuged at low speed, sterile RNase-free ddH2O was added to prepare a 20μM working solution. ② At 1×10 5 BMMSCs were seeded into 6-well plates at a density of 100 μL / well. When the BMMSCs confluence reached 60%, 1200 μL of fresh culture medium was replaced and transient transfection was performed. ③ Preparation of transfection complex: First, 6 μL Micropoly Transfecter TM Cell Reagent transfection reagent was mixed with 6 μL si-NC or siRNA of the target molecule (both at a concentration of 20 μM) at a ratio of 1:1, and the mixture was gently blown 15 times with a pipette to mix, and the mixture was allowed to stand at room temperature for 10 min. ④ The prepared transfection complex was added to a 6-well plate, mixed thoroughly with its culture medium, and cultured in an incubator at 37°C and 5% CO2. ⑤ Evaluation of transfection efficiency: After 24-72 hours, the silencing efficiency of TGM2 in BMMSCs was evaluated by qRT-PCR. The results showed that siRNA could successfully transfect BMMSCs and silence the expression of TGM2, that is, compared with the cells in the control group (si-NC group), the siRNA group (si-TGM2 group) could significantly reduce the expression level of TGM2 in BMMSCs 24-72 hours after transfection of BMMSCs.

[0070] 2.2 Effect of silencing TGM2 on osteogenic differentiation of BMMSCs

[0071] After successfully verifying the interference effect of siRNA, si-TGM2 was used to silence the expression of TGM2 in BMMSCs. Since it was a transient transfection, the culture medium had to be replaced every 3 days and then re-transfected. After 7 days, qRT-PCR and Western blot were used to detect the effect of silencing TGM2 molecules on the expression of BMMSC osteogenic differentiation-related genes and protein markers (ALP, BSP and SP7). The results showed that compared with the control group (si-NC), silencing of TGM2 (si-TGM2) significantly inhibited the expression levels of BMMSC osteogenic differentiation-related genes and proteins.

[0072] 3. Further functional verification of the role of TGM2 in osteogenic differentiation of BMMSCs

[0073] The above experimental results have confirmed that silencing the expression of TGM2 significantly inhibits the osteogenic differentiation of BMMSCs. Next, the present invention will study the effect of TGM2 overexpression on BMMSCs.

[0074] 3.1 Transfection of BMMSCs with TGM2 overexpression plasmid

[0075] ① In order to overexpress TGM2, the TGM2 sequence was inserted into the plasmid vector TK-PCDH-copGFP-T2A-Puro downstream of the TK promoter, and then the Micropoly Transfecter TM Cell Reagent Transfection Reagent Instructions Use the above overexpression plasmid to transfect BMMSCs. The plasmid TK-PCDH-copGFP-T2A-Puro lacking the TGM2 sequence but with the same structure was used as a negative control vector (ov-NC). ② Use 1×10 5 / well in a 6-well plate. When the BMMSCs confluence reaches 60%, replace with 1200 μL of fresh culture medium and perform transient transfection. ③Prepare transfection complex: First, prepare 8 μL Micropoly Transfecter TMCell Reagent transfection reagent was mixed with 8μg ov-NC or ov-TGM2 plasmid in a ratio of 1:1, and the mixture was gently blown 15 times with a pipette to mix, and the mixture was allowed to stand at room temperature for 10 minutes. ④ The prepared transfection complex was added to a 6-well plate, mixed thoroughly with its culture medium, and cultured in an incubator at 37°C and 5% CO2. ⑤ Evaluation of transfection efficiency: After 24-72h, the overexpression efficiency of TGM2 in BMMSCs was evaluated by qRT-PCR. The results showed that ov-TGM2 could successfully transfect BMMSCs and increase the expression of TGM2, that is, compared with the control group (ov-NC group) cells, the overexpression group (ov-TGM2 group) could significantly increase the expression level of TGM2 in BMMSCs 24-72h after transfection of BMMSCs.

[0076] 3.2 Effect of TGM2 overexpression on osteogenic differentiation of BMMSCs

[0077] After successfully verifying the overexpression effect of the TGM2 overexpression plasmid, the ov-TGM2 plasmid was used to overexpress TGM2 expression in BMMSCs. Because it was a transient transfection, the culture medium needed to be replaced every 3 days and then re-transfected. After 7 days, qRT-PCR and Western blot were used to detect the effect of overexpression of TGM2 molecules on the expression of BMMSC osteogenic differentiation-related genes (ALP, BSP and SP7). The results showed that compared with the control group (ov-NC), the overexpression of TGM2 (ov-TGM2) significantly promoted the expression level of BMMSC osteogenic differentiation-related genes.

[0078] 4. Experimental Results

[0079] Figure 1 This is the test result diagram of mRNA microarray chip screening of differentially expressed mRNAs in BMMSCs from normal rats and T2DM rats. BMMSCs from normal rats and T2DM rats were subjected to osteogenic differentiation, and the volcano plot of differentially expressed mRNAs in BMMSCs from two different sources (P<0.05 and Fold change>=1.5 were considered to be statistically different, red indicates up-regulated mRNAs, and green indicates down-regulated mRNAs).

[0080] Figure 2 This is a graph showing the test results of mRNA molecules screened out by low-throughput qRT-PCR. The mRNA molecules screened out by high-throughput were verified. The qRT-PCR results of TGM2 were consistent with the chip results in terms of change trend, and the change multiple was the highest.

[0081] Figure 3In order to verify the expression trend result diagram of TGM2 by Western blot, the protein level of TGM2 was verified, which was inconsistent with the trend of chip and qRT-PCR results. The protein level of TGM2 was significantly reduced in BMMSCs derived from T2DM rats.

[0082] Figure 4 The results of the effect of silencing TGM2 on the osteogenic differentiation of BMMSCs from T2DM rats are shown in Figure 2. After siRNA transfection of BMMSCs, qRT-PCR was used to detect the expression of TGM2 gene in BMMSCs, confirming that siRNA can successfully transfect BMMSCs and silence the expression of TGM2. After si-TGM2 interfered with BMMSCs from T2DM rats, the silencing of TGM2 (si-TGM2) significantly inhibited the expression levels of osteogenic-related genes and proteins in BMMSCs compared with the control group (si-NC).

[0083] Figure 5 This figure shows the effect of overexpression of TGM2 on the osteogenic differentiation of BMMSCs derived from normal rats. After successfully verifying the overexpression effect of the TGM2 overexpression plasmid, compared with the control group (ov-NC), the overexpression of TGM2 (ov-TGM2) significantly promoted the expression levels of osteogenic differentiation-related genes in BMMSCs derived from normal rats.

[0084] Various embodiments of the present invention may be presented in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity, and should not be understood as a rigid limitation on the scope of the present invention; therefore, the range description should be considered to have specifically disclosed all possible sub-ranges and single numerical values ​​within the range. For example, the range description from 1 to 6 should be considered to have specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6, which apply regardless of the range. In addition, whenever a numerical range is indicated herein, it is meant to include any cited number (fractional or integer) within the indicated range.

[0085] The foregoing is merely a specific embodiment of the present invention, which enables those skilled in the art to understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features claimed herein.

Claims

1. Application of TGM2 in the preparation of drugs for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients.

2. The use according to claim 1, characterized in that: The expression of TGM2 is significantly reduced in stem cells undergoing osteogenic differentiation under diabetic conditions.

3. The use according to claim 1, characterized in that: Downregulation of TGM2 impaired the osteogenic differentiation potential of BMMSCs, while overexpression of TGM2 under diabetic conditions reversed the impairment of BMMSC osteogenic differentiation potential.

4. A molecular target for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, characterized in that: The molecular target for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients is TGM2.

5. A molecular target for preparing a drug for treating bone defect regeneration in diabetic patients, characterized in that: The molecular target of the drug for treating bone defect regeneration in diabetic patients is TGM2.

6. A method for screening drugs for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, characterized in that: The method uses TGM2 as a target.

7. A method for screening and preparing a drug for treating bone defect regeneration in diabetic patients, characterized in that: The method uses TGM2 as a target.

Images