Application of animal FcRn protein in controlling infection of porcine reproductive and respiratory syndrome virus

Abstract

The invention discloses an application of animal FcRn protein in control of porcine reproductive and respiratory syndrome virus infection. According to the application, firstly, the fact that FcRn has a positive regulation effect on PRRSV (porcine reproductive and respiratory syndrome virus) infection is found through shRNA (short hairpin Ribonucleic Acid) specific knockout pig FCGRT and overexpression FCGRT experiments, then the fact that blocking FcRn can inhibit PRRSV proliferation is further found through a specific anti-FcRn IgG (Immunoglobulin G) or normal IgG FcRn blocking experiment, and then the fact that FcRn is an indispensable receptor of PRRSV infection is further confirmed through a CRISPR / Cas9 gene editing technology knockout and FcRn back-supplementing experiment. And then determining that the FcRn participates in PRRSV decapsification, and discovering that the FcRn and M and N proteins of the PRRSV perform endosomal interaction in the early stage. Therefore, the FcRn can be used as a target for anti-PRRS pig breeding, antiviral vaccine and drug research and development.

Description

Technical Field

[0001] The invention belongs to the field of animal genetic engineering and biomedicine, and specifically relates to the application of animal FcRn protein in controlling the infectivity of porcine reproductive and respiratory syndrome virus. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a highly contagious disease caused by PRRS virus (PRRSV), characterized by reproductive failure in sows and respiratory difficulties in pigs of all ages (Pejsak et al 1997). Since the outbreak in North America and Europe in the late 1980s, the disease has caused huge losses to the global pig industry (Neumann et al 2005, Tian et al 2007). At present, the prevalence of PRRS in my country is as follows: Lineage 1PRRSV (NADC30-like, NADC34-like) belonging to PRRSV-2 has become the mainstream strain, and Lineage 8, Lineage 5, and Lineage 3PRRSV coexist (Zhang Hongliang 2022); PRRSV-1 is distributed in many places across the country, but the detection rate is low (Tan Feifei et al 2022). PRRSV has high variability. Currently, commercial inactivated vaccines and live attenuated vaccines can only provide partial protection for pigs infected with Lineage 1PRRSV (Wei et al 2019, Li et al 2022), and vaccines against NADC30 and NADC34 strains have not yet been launched. At the same time, my country has not yet approved PRRSV-1 vaccines. The situation of PRRS prevention and control in my country is complex and severe.

[0003] Foreign research teams have bred gene-edited pigs with CD163 SRCR5 gene deletion that are resistant to PRRSV infection (Whitworth et al 2016) and applied for a patent (Lillico et al 2019). Therefore, finding new host factors or receptors that are resistant to PRRSV infection has important scientific significance and great application value.

[0004] Neonatal Fc receptor (FcRn) is the only transport receptor for IgG, which is composed of a heavy chain (α chain encoded by the FCGRT gene) and a light chain (β2 microglobulin, β2m encoded by the B2M gene) to form a heterodimer to exert biological functions (Simister and Mostov 1989). Recent studies have found that FcRn is an uncoating receptor for some enteroviruses (Usoltseva et al 2019, Zhao et al 2019, Vandesande et al 2020, Chen et al 2022), but whether FcRn affects PRRSV infection has not been reported in China. Summary of the invention

[0005] The purpose of the present invention is to provide application of animal FcRn protein in controlling the infectivity of porcine reproductive and respiratory syndrome virus.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] The protection scope of the present invention includes:

[0008] Application of animal FcRn protein in controlling the infectivity of porcine reproductive and respiratory syndrome virus.

[0009] The applications described above are as follows:

[0010] The invention discloses an application of an animal FcRn protein blocker or expression inhibitor in the preparation of a drug for resisting porcine reproductive and respiratory syndrome virus infection, wherein the FcRn protein is a neonatal Fc receptor protein.

[0011] In the above application, preferably, the animal FcRn protein blocker comprises: animal FcRn protein antibody or animal IgG;

[0012] In the above application, preferably, the animal IgG includes pig IgG, rabbit IgG and / or mouse IgG.

[0013] In the above application, preferably, the animal FcRn protein antibody is FCGRT and / or B2M antibody;

[0014] In the above application, the inhibitor of animal FcRn protein expression targets the inhibitor of the heavy chain and / or light chain encoding gene of the animal FcRn protein.

[0015] In the above-mentioned application, the inhibitor is a gRNA, antisense RNA or small interfering RNA targeting the heavy chain and / or light chain encoding gene of the animal FcRn protein.

[0016] In the above application, preferably, the animal comprises a pig or a green monkey.

[0017] In the above application, preferably, the heavy chain is the porcine FCGRT gene, with GenBank accession number XM_021093554.1; the light chain is the porcine B2M gene, with GenBank accession number XR_002345118.1.

[0018] In the above application, preferably, the heavy chain is the FCGRT gene of green monkey, with GenBank accession number XM_037991921.1; the light chain is the B2M gene of green monkey, with GenBank accession number XM_038009930.1.

[0019] In the above application, preferably, the inhibitor of the gene encoding the heavy chain of the porcine FcRn protein is shRNA: GGAACAAGCAGAAGCTCTTTC, GCGAGGAGTTTATGAAGTTCG, GGTCGTCGCTAAC AGTCAAGA and GCTTCCTACTGCTCTTGATCG.

[0020] In the above-mentioned application, preferably, the inhibitor of the heavy chain encoding gene of the green monkey FcRn protein is sgRNA: CCTGAGCTACGATAGCCTG and / or the light chain encoding gene sgRNA: ACCCAGACACATAGCAATT C.

[0021] A method for preparing cells resistant to porcine reproductive and respiratory syndrome virus infection comprises knocking out or inhibiting the heavy chain and / or light chain encoding gene of FcRn protein in the cells.

[0022] A method for preparing porcine reproductive and respiratory syndrome virus susceptible cells comprises overexpressing animal FcRn protein in the cells.

[0023] The cells prepared by the method described above are used to prepare a porcine reproductive and respiratory syndrome virus susceptible cell model.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] The present invention firstly found that FcRn has a positive regulatory effect on PRRS V infection through shRNA specific knockdown of FCGRT and overexpression of FCGRT, and then further found that blocking FcRn inhibited PRRSV proliferation through specific anti-FcRn IgG or normal IgG blocking FcRn experiments, and then confirmed that FcRn is an indispensable receptor for PRRSV infection through CRISPR / Cas9 gene editing technology knockout and complementation of FcRn experiments, and then determined that FcRn is involved in PRRSV uncoating through adsorption, internalization experiments and IFA, and finally found that FcRn interacts with M and N proteins of PRRSV in early endosomes through confocal and immunoprecipitation experiments. The present invention provides a new target for the development of effective drugs for the prevention and treatment of PRRS, and also provides a new candidate gene for the breeding research of anti-PRRS pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Effects of knockdown and overexpression of FcRn on PRRSV infection

[0027] Among them: A: Western blot was used to detect the efficiency of knocking down FCGRT by shRNAs and the effect of knocking down FCGRT on CD163 expression; B: Western blot was used to detect the effect of knocking down FCGRT on the expression of nsp1α and N protein of PRRSV-2FJ strain; C: Western blot was used to detect the effect of knocking down FCGRT on the expression of N protein of PRRSV-2SH strain; D: qPCR was used to detect the effect of knocking down FCGRT on the expression of ORF7 gene of PRRSV-1SH2022 strain; E: Western blot was used to detect the effect of overexpression of pFCGR T on the expression of PRRSV N protein; F: Western blot was used to detect the effect of overexpression of mkFCGRT on the expression of PRRSV N protein. GAPDH was used as an internal reference, and the differences between groups were tested by two-tailed unpaired t test. ANOVA test was used for three or more groups. "ns" means no significant difference (p>0.05), and "***" means p<0.001.

[0028] Figure 2 :Effects of specific anti-FcRn IgG and normal IgG blocking on PRRSV infection

[0029] Among them: A: Western blot detection of the effect of FCGRT polyclonal antibody on the expression of N protein of PRRSV-2FJ strain in MARC-145 cells; B: Western blot detection of the effect of B2M monoclonal antibody on the expression of N protein of PRRSV-2FJ strain in MARC-145 cells; C: Western blot detection of the effect of B2M monoclonal antibody on the expression of N protein of PRRSV-2FJ strain in PAMs; D: Western blot detection of the effect of porcine IgG on the expression of N protein of PRRSV-2FJ strain in PAMs; E: Western blot detection of the effect of rabbit IgG on the expression of N protein of PRRSV-2FJ strain in PAMs; F: Western blot detection of the effect of mouse IgG on the expression of N protein of PRRSV-2FJ strain in PAMs, GAPDH was used as the internal reference.

[0030] Figure 3 :Effects of FcRn knockout on PRRSV infection

[0031] Among them: A: Western blot detection of the expression of FCGRT, B2M, and CD163 in three monoclonal cells; B: Bright field observation of cell CPE and IFA detection of the expression of PRRSV-2FJ strain N protein; C: Western blot detection of the expression of PRRSV-2FJ strain N protein in the supernatant and cell lysate of three single gene knockout cells; D: qPCR detection of the copy number of ORF7 gene of PRRSV-2FJ strain in three single gene knockout cells; E: Western blot detection of the expression of PRRSV-2XJ strain, JXA1-R strain and R98 strain N protein in three single gene knockout cells; F: TCID 50 The proliferation of PRRSV-2FJ strain in three single gene knockout cells was detected. GAPDH was used as an internal reference, and the differences between groups were tested by two-tailed unpaired t test. ANOVA test was used for three or more groups. "ns" means no significant difference (p>0.05), and "****" means p<0.0001.

[0032] Figure 4 :The effect of FcRn complementation on PRRSV proliferation

[0033] Among them: A: Western blot detection of the expression of PRRSV N protein in FCGRT-KO and B2M-KO cells after complementation of FCGRT and B2M respectively; B: Western blot detection of the expression of PRRSV N protein in FCGRT-KO+FCGRT and B2M-KO+B2M cells; C: TCID 50 Detection of PRRSV titer in the supernatant of FCGRT-KO+FCGRT and B2M-KO+B2M cells; D: Western blot detection of the expression of FCGRT of different species in FCGRT-KO cells and the expression of N protein after PRRSV infection; E: TCID 50 The PRRSV titer of the supernatant was detected after complementation of different species of FCGRT in FCGRT-KO cells. GAPDH was used as an internal reference, and the differences between groups were tested by two-tailed unpaired t-test. ANOVA test was used for three or more groups. "ns" means no significant difference (p>0.05), "***" means p<0.001, and "****" means p<0.0001.

[0034] Figure 5 :FcRn is involved in PRRSV uncoating

[0035] Among them: A and C are respectively the effects of knocking out FcRn on PRRSV adsorption and internalization detected by qPCR; B and D are respectively the effects of knocking out FCGRT on PRRSV adsorption and internalization detected by LSCM; E: IFA detected the expression of nsp2 in WT and three KO cells after PRRSV infection for 24 hours. The differences between groups were tested by two-tailed unpaired t test, and ANOVA test was used for three or more groups, and "ns" means no significant difference (p>0.05).

[0036] Figure 6 :FcRn interacts with PRRSV in the early endosome

[0037] Among them: A: LSCM detection of the localization of FcRn, EEA1, and PRRSV in MARC-145 cells; B: LSCM detection of the localization of FcRn, CD163, and PRRSV in MARC-145 cells; C: Co-IP detection of the interaction between FcRn and PRRSV protein at different pH values; D and E are Co-IP detection of the interaction between FcRn and PRRSV protein in MARC-145 cells and PAMs at pH 6.0, respectively; F: Co-IP detection of the interaction between Fc Rn and PRRSV N protein in HEK-293T cells transfected with plasmids; G: Co-IP verification that FcRn and CD163 do not interact in MARC-145 cells. DETAILED DESCRIPTION

[0038] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels.

[0039] Example 1: Effects of knockdown and overexpression of FcRn on PRRSV infection

[0040] 1. Effect of knocking down FcRn expression on PRRSV infection

[0041] 1.1 Construction of pFCGRT-shRNA recombinant lentiviral expression plasmid:

[0042] Primer design: The shRNA sequence targeting porcine FCGRT (GenBank accession number: XM_021093554) was designed using the website (https: / / rnaidesigner.thermofisher.com / rnaiexpress / sort.do), and 4 pairs of sequences with high scores were selected and synthesized by Wuhan Qingke Biotechnology Co., Ltd., as follows:

[0043] pFCGRT target site sequence (5'-3'):

[0044] shRNA1:GGAACAAGCAGAAGCTCTTTC

[0045] shRNA2:GCGAGGAGTTTATGAAGTTCG

[0046] shRNA3:GGTCGTCGCTAACAGTCAAGA

[0047] shRNA4: GCTTCCTACTGCTCTTGATCG.

[0048] The primer sequences are shown in Table 1.

[0049] Table 1 shRNA primer sequences

[0050]

[0051] Acquisition of DNA fragments: Short DNA fragments can be obtained by directly annealing the upstream and downstream primers of the shRNA sequence.

[0052] Linearization of empty vector: Double digestion of empty vector pLVX-shRNA2 (YouBio, VT1457) with restriction endonucleases (Takara, 1611 and 1605)

[0053] Recovery and enzyme ligation of the linearized empty vector: The shRNA short DNA fragment with sticky ends was ligated to pLVX-shRNA2 using T4 DNA ligase (Thermo Scientific, EL0014).

[0054] Transformation and identification of enzyme-linked products: Add 5 μL of ligation products to 50 μL of DH5α competent cells, mix well, then place in an ice bath for 30 minutes, heat shock at 42°C for 90 seconds, place in an ice bath for 2 minutes, then add 600 μL of LB medium, and place in a 37°C 200r / min shaker for 60 minutes of recovery. Take 200 μL of bacterial solution and evenly spread it on the LA plate containing ampicillin. After the liquid is fully absorbed, invert and culture it in a 37°C incubator for 12 hours to observe the appearance of white single colonies. Pick 3 clones from each plate into a test tube, add 2 mL of LB medium containing ampicillin, place in a 37°C 200r / min shaker for several hours, and when the culture medium becomes turbid, send the bacterial solution PCR positive to Wuhan Qingke Company for sequencing.

[0055] Extraction of recombinant plasmid: expand the culture of monoclonal bacteria with correct sequencing, preserve the bacterial solution and extract the plasmid according to the instructions of OMEGA endotoxin-free plasmid extraction kit, measure the plasmid concentration and store it in a -20℃ refrigerator for later use. Thus, 4 recombinant lentiviral expression plasmids (named pFCGRT-shRNA1 to pFCGRT-shRNA4) and a group of non-target recombinant lentiviral expression plasmids (Non-target) were obtained.

[0056] 1.2 Packaging of recombinant lentivirus

[0057] Cell preparation: Before transfection, prepare 6-well plates of HEK-293T (human embryonic kidney cells) with vigorous growth, good morphology and about 80% confluence.

[0058] Plasmid transfection: According to the liposome-mediated transient transfection method and Lipofectamine 2000 (Invitrigen, 11668500), the recombinant lentiviral expression plasmid prepared in 1.1, packaging plasmid psPAX2 (Addgene, 12260), and envelope plasmid pMD2.G (Addgene, 12259) were mixed at a mass ratio of 3:2:1, that is, 9 μg of recombinant expression plasmid, 6 μg of psPAX2, and 3 μg of pMD2.G. The mixed plasmid was added to the liposome and gently mixed evenly, and then slowly added to the cell culture medium after standing.

[0059] Acquisition of lentivirus solution: Replace the cell growth medium 24 hours after transfection, collect the cell supernatant 48 hours after transfection and store it in a 4°C refrigerator, and add new cell growth medium. Collect the cell supernatant for the second time 72 hours after transfection, mix it with the supernatant collected for the first time, filter it through a 0.45μm filter (Millipore, SLHV033R) to remove impurities, and dispense the recombinant lentivirus solution at 1mL / tube. The virus solution can be used to infect the target cells immediately or stored in a -80°C refrigerator for standby use.

[0060] 1.3 Detection of FcRn knockdown efficiency and CD163 expression level

[0061] Preparation of PAMs (porcine alveolar macrophages): Take out the PAMs frozen in liquid nitrogen (isolated and stored in our laboratory) and follow the 10 6 The PAMs were evenly plated in a 12-well cell plate with a specification of 10 cells / well.

[0062] Lentivirus transduction of shRNA: After PAMs recovered for 24 hours, the cell culture medium was discarded, and the cells were washed once with PBS, and then 500 μL of growth medium was added, followed by 500 μL of recombinant lentivirus expressing shRNA targeting pFCGRT or shRNA without target. At the same time, a cell control group (MOCK) without recombinant lentivirus was set up.

[0063] Sample collection and detection: After 36 hours of lentivirus infection of PAMs, the cell supernatant was discarded, washed once with PBS, and then the cell samples were collected with RIPA. The expression of FCGRT and CD163 proteins was detected by Western Blot using rabbit anti-swine FCGRT cytoplasmic tail polyclonal antibody (prepared in this laboratory) and mouse anti-CD163 monoclonal antibody (GeneTex, GTX42364). PAMs were treated in the same way, and the cytotoxicity of PAMs infected with lentivirus for 36 hours was detected by CCK-8 kit (Biosharp, BS350A).

[0064] Results: It showed that shRNA had no obvious toxicity to PAMs; Figure 1 Middle A shows that after knocking down FCGRT expression with four groups of shRNAs, FCGRT expression was significantly reduced, without affecting the expression of CD163.

[0065] 1.4 Detection of the effect of FcRn knockdown on PRRSV infection

[0066] The preparation of PAMs and lentiviral transduction of shRNA are the same as described in 1.3 of Example 1 of the present invention.

[0067] PRRSV inoculation of FCGRT-knockdown PAMs: 36 hours after lentivirus infection of PAMs, the cell supernatant was discarded, the cells were washed once with PBS, and 1 MOI of PRRSV-2FJ strain (Sublineage 8.7; isolated and preserved in this laboratory; GenBank accession number: OR102497), NAD30-like SH strain (Sublineage 1.8; isolated and preserved in this laboratory; GenBank accession number: OR102498) or PRRSV-1SH2022 strain (isolated and preserved in this laboratory; GenBank accession number: PQ306310) was added, and the virus was adsorbed at 37°C for 1 hour, the inoculum was discarded, and the cell maintenance medium was added.

[0068] Sample collection and detection: 30 hours after PRRSV infection, the cell supernatant was aspirated and stored for later use, washed once with PBS, and then collected with RIPA. Rabbit anti-PRRSV nsp1α polyclonal antibody (GeneTex, GTX133695) and rabbit anti-PRRSV N protein polyclonal antibody (GeneTex, GTX135351) were used to detect the expression of PRRSV-2nsp1α and N protein by Western Blot; qPCR was used to detect the expression of ORF7 gene of PRRSV-1SH2022 strain.

[0069] result: Figure 1 Middle B shows that knockdown of FCGRT inhibits the expression of nsp1α and N protein of PRRSV-2FJ strain; Figure 1Middle C shows that knocking down FCGRT inhibits the expression of N protein of PRRSV-2 SH strain (i.e., NADC30-like SH strain); Figure 1 D shows that knockdown of FCGRT significantly inhibited the expression of ORF7 gene of PRRSV-1 SH2022 strain. These results indicate that knockdown of FC GRT inhibits the proliferation of PRRSV-1 and PRRSV-2 in PAMs.

[0070] 2. Effect of overexpression of FcRn on PRRSV infection

[0071] 2.1 Construction of pCMV-Tag2B-FCGRT overexpression plasmid

[0072] Primer design: The coding sequence (CDS) amplification primers were designed for porcine FCGRT (GenBank accession number: XM_021093554) and green monkey FCGRT (GenBank accession number: XM_037991921) using the software SnapGene, and a FLAG tag was added to the 3' end of the CDS.

[0073] The specific operations are as follows:

[0074] The cDNA derived from PAMs was amplified using primers (pFCGRT-F: ATGCGGGTCCCCCGGCCTCA, pFCGRT-R: AGATTCAGCATCCTTGGCCAGGTCG) to obtain the DNA fragment of pFCGRT; a FLAG tag was added to the C-terminus of pFCGRT using primers [pFCGRT-F(HR): GGGCTGCAGGaattcATGCGGGTCCCCCGGCCTC, pFCGRT-FLAG-R: CTTATCGTCGTCATCCTTGTAATCAGATTCAGCATCCTTGG]; upstream and downstream homology arms were added to pFCGRT-FLAG using primers [pFCGRT-F(HR): GGGCTGCAGGaattcATGCGGGTCCCC CGGCCTC, pFCGRT-FLAG-R(HR): GGTATCGATAAGCTtCTTATCGTCGTCATCCTT GTAATC].

[0075] Following the same method, cDNA from MARC-145 cells (green monkey embryonic kidney epithelial cells) was amplified using primers (mkFCGRT-F: ATGAGGGTCCCGCGGCCTCAGCC, mk FCGRT-R: GGCAGTGGCTGGGATCACATTTA) to obtain the mkFCGRT DNA fragment; and mkFCGRT-FLAG-R: CTTATCGTC GTCATCCTTGTAATCGGCAGTGGCTGGGATCACAT] to add a FLAG tag to the C-terminus of mkFCGRT; use primers [mkFCGRT-F (HR): GGGCTGCAGGAATTCATGAGGGTCCCGCGGCCTC, mkFCGRT-FLAG-R (HR): GGGCCCCCCCTCGAGTTACTTATCGTCGTCATCCTTGT] to add upstream and downstream homology arms to mkFCGRT-FLAG. Max DNA Polymerase (Takara, R045A) was used according to the instructions.

[0076] Connection of target DNA fragment with empty vector: First, use EcoRI and HindIII to linearize the empty vector pCMV-Tag2B, and then use homologous recombinase (ABclonal, RK21020) to clone the DNA fragments with homology arms (pFCGRT-FLAG and mkFCGRT-FLAG) into pCMV-Tag2B. Recombined with the linearized empty vector pCMV-Tag2B, the recombinant plasmid pCMV-Tag2B-pFCGRT overexpressing the porcine FCGRT gene and the recombinant plasmid pCMV-Tag2B-mkFCGRT overexpressing the green monkey FCGRT gene were obtained.

[0077] The transformation of the ligation product, PCR identification, sequencing, and plasmid extraction are the same as described in 1.1 of Example 1 of the present invention.

[0078] 2.2 Detection of the effect of overexpressed FcRn on PRRSV infection

[0079] 1.5 μg plasmid (pCMV-Tag2B-pFCGRT, pCMV-Tag2B-mkFCGRT, pCMV-Tag2B) was transfected into 12-well MARC-145 cells for 36 h. The cells were infected with PRRSV-2FJ strain (MOI=1) for a specified time (12, 24, 36 h) and the cell supernatant and cell lysate were collected. The expression of PRRSV N protein was detected by Western Blot.

[0080] result: Figure 1 Middle E shows that overexpression of pFCGRT promotes the expression of N protein of PRRSV FJ strain; Figure 1 F in the middle shows that overexpression of mkFCGRT promotes the expression of PRRSV N protein. These results indicate that overexpression of FcRn in MARC-145 cells promotes the proliferation of PRRSV 12 and 24 h after infection, indicating that overexpression of the FCGRT gene can enhance PRRSV infection.

[0081] Embodiment 2:

[0082] Effects of specific anti-FcRn IgG and normal IgG blocking on PRRSV infection

[0083] 1. Effect of FcRn Antibody on PRRSV Infection

[0084] 1.1 Detection of cell toxicity of FcRn antibodies

[0085] The cell viability was detected using the CCK-8 kit. The specific steps are as follows:

[0086] Cell preparation: Prepare 96-well plates of PAMs or MARC-145 cells that are growing vigorously and in good condition.

[0087] Antibody incubation: Aspirate the cell growth medium, dilute the antibodies [FCGRT rabbit polyclonal antibody (proteintech, 16190-1-AP), B2M mouse monoclonal antibody (proteintech, 66207-1-Ig)] to the specified concentrations (5, 10, 20, 40 μg / mL), add to the 96-well cells, and incubate in a cell culture incubator for 30 h.

[0088] Incubation with CCK-8 solution: add 10 μL CCK-8 solution to every 100 μL cell culture medium, set up three groups, one group: containing cells, culture medium, antibody, CCK-8 solution; group two: containing culture medium, CCK-8 solution, no cells; group three: containing cells, culture medium, CCK-8, no antibody. Place the 96-well plate in the incubator and incubate for 1 hour before taking it out.

[0089] The absorbance of the cell supernatant at 450 nm (OD 450 ).

[0090] Cell viability analysis: Calculate cell viability [OD 450 (One group)-OD 450 (Group 2)] / [OD 450 (Three groups)-OD 450(Group II)] × 100%, and then analyze whether the antibodies have an effect on cell viability.

[0091] Results: FCGRT polyclonal antibody or B2M monoclonal antibody at a concentration of 40 μg / mL or below had no significant toxicity to MARC-145 cells, and B2M monoclonal antibody at a concentration of 40 μg / mL or below had no significant toxicity to PAMs.

[0092] 1.2 Effect of FcRn antibodies on PRRSV infection

[0093] Cell preparation: Prepare 24-well plates of MARC-145 cells and PAMs that are growing vigorously and in good condition.

[0094] Incubation with antibodies: Add culture medium containing FCGRT polyclonal antibody or B2M monoclonal antibody at a final concentration of 5, 10, or 20 μg / mL to MARC-145 cells, and add culture medium containing B2M mAb at a final concentration of 5, 10, or 20 μg / mL to PAMs, incubate at 37°C for 1 h, and set up 20 μg / mL isotype control IgG.

[0095] Inoculation with PRRSV: Inoculate cells with PRRSV FJ strain (MOI=1), incubate at 37°C for 1 hour, then discard the inoculum, add maintenance medium containing the corresponding concentration of antibodies, and continue culturing for 30 hours.

[0096] Sample collection and detection: aspirate the cell supernatant, wash once with PBS, and then use RIPA to collect the cell lysate. Use Western Blot to detect the expression of PRRSV N protein, TCID 50 Detect the PRRSV titer of cell supernatant.

[0097] result: Figure 2 Center A shows that FCGRT polyclonal antibody inhibits the expression of PRRSV N protein in MARC-145 cells; Figure 2 Middle B shows that B2M mAb inhibits PRRSV N protein expression in MARC-145 cells; Figure 2 Middle C shows that B2M mAb inhibits the expression of PRRSV N protein in PAMs. These results indicate that FcRn antibodies can block the proliferation of PRRSV in cells in a dose-dependent manner.

[0098] 2. Effect of IgG on PRRSV infection

[0099] 2.1 Detection of IgG toxicity to cells

[0100] The FcRn antibody was replaced with pig IgG (Bioss, bs-0309P) or rabbit IgG (ABclonal, AC042), and the experiment was carried out using PAMs. The rest was the same as described in 1.1 of Example 2 of the present invention.

[0101] Results: Pig or rabbit IgG at concentrations of 40 μg / mL or below had no significant toxicity to PAMs.

[0102] 2.2 Effect of IgG on PRRSV infection

[0103] The FcRn antibody was replaced with pig IgG, rabbit IgG, mouse IgG (proteintech, 66360-3-Ig), and the experiment was carried out using PAMs. The rest was the same as described in 1.2 of Example 2 of the present invention.

[0104] result: Figure 2 Middle D shows that porcine IgG inhibited PRRSV N protein expression in PAMs; Figure 2 Middle E shows that rabbit IgG inhibited PRRSV N protein expression in PAMs; Figure 2 F shows that mouse IgG2b inhibits the expression of PRRSV N protein in PAMs. These results show that normal animal IgG can block the proliferation of PRRSV in cells in a dose-dependent manner.

[0105] Embodiment 3:

[0106] Effect of FcRn knockout on PRRSV infection

[0107] 1. Construction and verification of FcRn knockout MARC-145 cells

[0108] 1.1 Construction of MARC-145 cell line stably expressing Cas9

[0109] Preparation of wild-type cells: Prepare 6-well plates of MARC-145 cells with vigorous growth, good morphology and about 50% confluence.

[0110] Lentivirus transduction of Cas9: Aspirate the cell culture medium, wash twice with PBS, add 1mL of cell growth medium, and then add 1mL of recombinant lentivirus expressing Cas9. After 24 hours of infection, add lentivirus again to repeat the infection once, and set up cells without lentivirus solution as a control. The preparation method of recombinant lentivirus expressing Cas9 is: pLV-Cas9-Puro (lentivirus Cas9 expression vector), psPAX2 (packaging plasmid), pMD2.G (envelope plasmid) are co-transfected into 6-well HEK-293T cells at 9μg, 6μg, and 3μg respectively, and the cell supernatant is collected at 48h and 72h after transfection to obtain recombinant lentivirus solution expressing Cas9.

[0111] Screening of polyclonal cells: Aspirate and discard the virus inoculum, wash twice with PBS, add cell growth medium, then add Puromycin (Beyotime, ST551) with a final concentration of 10 μg / mL and continue culturing for 1-3 days, during which the cell status is observed.

[0112] Screening of monoclonal cells: Use the limiting dilution method to further screen monoclonal cells from polyclonal cells. After culturing the cells for 7-14 days, find and mark the monoclonal cells in a 96-well plate, transfer the monoclonal cells to a 24-well plate for continued culture, and then transfer the cells to a 6-well plate. After the cells have grown a full monolayer, take some cells for detection and continue to culture the remaining cells.

[0113] Detection of Cas9 protein: Rabbit anti-Cas9 polyclonal antibody (ABclonal, A14997) was used to detect the expression of Cas9 protein in monoclonal cell lines by Western Blot, and then the monoclonal cells in good condition and expressing Cas9 protein were expanded and preserved.

[0114] Detection of stable expression of Cas9 protein: A monoclonal B cell line was selected for serial passage, and cells were collected and cell lysates were prepared at the 1st, 5th, 10th, 15th, 20th, and 30th generations, and the expression of Cas9 in cells of each generation was detected by Western Blot.

[0115] Results: It was shown that monoclonal cells A and B expressed Cas9 protein, and it was also shown that monoclonal cell B continued to express Cas9 protein after 30 consecutive generations. These results indicate that the MARC-145 cell line stably expressing Cas9, namely MARC-Cas9 cells, was successfully constructed.

[0116] 1.2 Construction and verification of three single gene knockout cells: FCGRT, B2M, and CD163

[0117] 1.2.1 Construction of sgRNA recombinant lentiviral expression plasmid

[0118] Primer design: Use the website (http: / / crispor.tefor.net / crispor.py) to design sgRNA sequences for green monkey FCGRT (GenBank accession number: XM_037991921), B2M (GenBank accession number: XM_038009930), and CD163 (GenBank accession number: JF753553), and select the sequences with high scores, as follows:

[0119] Target site sequence (5'-3')

[0120] sgRNA for mkFCGRT: CCTGAGCTACGATAGCCTG

[0121] sgRNA for mkB2M: ACCCAGACACATAGCAATTC.

[0122] The primers were synthesized and the primer sequences are shown in Table 3.

[0123] Table 3 sgRNA primer sequences

[0124]

[0125] Acquisition of short DNA fragments: Short DNA fragments can be obtained by directly annealing the upstream and downstream primers. The empty vector pLV-sgRNA-EGFP is transformed from the empty vector pGL3-U6-sgRNA-EGFP (addgene#107721), that is, Bbs is added between the U6 promoter and the gRNA scaffold. Ⅰ Restriction site. The linearization of pLV-sgRNA-EGFP and the construction of the recombinant plasmid were the same as described in 1.1 of Example 1 of the present invention. pLV-sgRNA-EGFP was linearized with restriction endonuclease Bbs I (NEB, R0539) and then enzyme-ligated to obtain recombinant lentiviral expression plasmids pLV-mkFCGRT-sgRNA-EGFP, pLV-mkB2M-sgRNA-EGFP, and pLV-mkCD163-sgRNA-EGFP.

[0126] The recombinant lentivirus solution was obtained in the same manner as in Example 1.

[0127] 1.2.2 Construction and verification of three single gene knockout cells: FCGRT, B2M, and CD163

[0128] Cell preparation: Prepare 6-well plates of MARC-Cas9 cells that are growing vigorously and in good condition.

[0129] Lentivirus transduction of sgRNA: discard the cell culture medium, wash twice with PBS, add 1 mL of cell growth medium, and then add 1 mL of recombinant lentivirus solution expressing sgRNA targeting green monkey FCGRT, B2M, and CD163 genes respectively, infect for 48 hours, and set cells without lentivirus solution as a control.

[0130] Screening of monoclonal cells: Observe the cells for green fluorescence under a fluorescence microscope (Olympus). If most cells show green fluorescence, use the limiting dilution method to screen monoclonal cells. Otherwise, use the lentivirus from the previous step to repeatedly infect the cells.

[0131] Sequencing of the target region: After expanding the cultured cells, extract the genomic DNA, amplify the CRISPR / Cas9 target region by PCR and send it for sequencing. The primer sequences are shown in Table 4.

[0132] Detection of target protein: Monoclonal cells with single peaks and frameshift mutations in the previous step were used to prepare protein samples. Western Blot was used to detect the expression of green monkey FCGRT, B2M, and CD163 proteins. Subsequently, monoclonal cells in good condition with successful knockout of the target gene were expanded and cultured and preserved.

[0133] Table 4 Genome sequencing primers

[0134]

[0135] result: Figure 3 A in the middle shows that the three single gene knockout cells do not express FCGRT, B2M, and CD163 proteins. The results show that the three single gene knockout MARC-145 cell lines FCGRT-KO, B2M-KO, and CD163-KO were successfully constructed.

[0136] 2. Effect of FcRn knockout on PRRSV proliferation

[0137] Cell preparation: Prepare FCGRT-KO, B2M-KO, CD163-KO and WTMARC-145 cells that are growing vigorously and in good condition.

[0138] Virus inoculation: Different PRRSV strains [FJ, XJ (isolated and preserved in our laboratory, belonging to sublineage 8.7 strains; GenBank accession number: OR102496), JXA1-R (attenuated vaccine strain from JXA1, purchased from Wuhan Keqian Biological), R98 (sublineage 5.1 strain; purchased from China Animal Husbandry Industry Co., Ltd.)] were inoculated into three single gene knockout and WT cells at an MOI dose of 0.1 or 1, and samples were collected at designated time points after inoculation.

[0139] Sample collection and detection: Use an optical microscope to observe the cell status 48 hours after inoculation with the FJ strain to determine whether there is CPE phenomenon; use IFA to detect whether there is a fluorescent signal of PRRSV N protein in the cells. Western blot was used to detect the expression of PRRSV N protein in the cell lysate and cell supernatant 48 hours after inoculation with the FJ strain; qPCR was used to detect the expression of PRRSV ORF7 gene mRNA in the cells 48 hours after inoculation with the FJ strain. Western blot was used to detect the expression of PRRSV N protein in the cell lysate 48 hours after inoculation with the XJ strain, JXA1-R strain, and R98 strain. TCID 50 The titers of FJ strain in three single gene knockout and WT cells were detected 12, 24, 36, 48, and 60 hours after inoculation.

[0140] result: Figure 3 Middle B shows that FCGRT-KO, B2M-KO, and CD163-KO cells have no CPE and PRRSV N protein expression; Figure 3 Middle C shows that there is no PRRSV N protein expression in the supernatants and cell lysates of FCGRT-KO, B2M-KO, and CD163-KO cells; Figure 3 Middle D shows that the copy numbers of PRRSV ORF7 gene in FCGRT-KO, B2M-KO, and CD163-KO cells were significantly lower than those in WT cells; Figure 3 Middle E shows that there is no expression of N protein of PRRSV XJ strain, JXA1-R strain, and R98 strain in FCGRT-KO, B2M-KO, and CD163-KO cells; Figure 3 Figure F shows that PRRSV FJ strain had no obvious proliferation in FCGRT-KO, B2M-KO, and CD163-KO cells. These results indicate that knocking out the gene for FcRn protein can make MARC-145 cells resistant to PRRSV infection, and also confirm that PRRSV-infected cells require intact FcRn molecules.

[0141] Example 4: Effect of FcRn complementation on PRRSV proliferation

[0142] 1. Construction of gene complementation cell lines

[0143] Because the three single-gene knockout cells stably expressed Cas9 protein and target sgRNA, the PAM sequences in the CDS of green monkey FCGRT and B2M were subjected to synonymous mutations; the PAM sequences in the CDS of synthesized FCGRT of multiple species [human (GenBank Accession No.: U12255.1), mouse (GenBank Accession No.: BC003786.1), rat (GenBank Accession No.: BC061975.1), cattle (GenBank Accession No.: BC102159.1), and dog (GenBank Accession No.: XM_005616309.4)] were also subjected to synonymous mutations.

[0144] Construction of recombinant lentiviral plasmid: Primers were designed to perform synonymous mutations in FCGRT and B2M CDS PAM sequences by Overlap PCR. The primer sequences are shown in Table 5.

[0145] Cell preparation: Prepare 6-well plates of FCGRT-KO and B2M-KO cells that are growing vigorously and in good condition.

[0146] Lentiviral transduction of CDS with mutated PAM sequence: Aspirate the cell culture medium, wash twice with PBS, add 1 mL of cell growth medium, add the recombinant lentiviral solution to the corresponding gene knockout cells, infect for 48 hours, and set cells without recombinant lentiviral solution as control.

[0147] Drug screening: 48 hours after lentiviral infection, discard the cell supernatant, wash twice with PBS, add 2 mL of cell growth medium containing a final concentration of 1000 μg / mL Hygromycin B (Beyotime, ST1389), and continue culturing for 3-5 days. Observe the cell status every day. When all the cells in the control group die, proceed to the next step of the experiment.

[0148] Detection of complement genes: Western Blot was used to detect the expression of FCGRT and B2M proteins in the complement cell lines, and then the cells were expanded and cultured and preserved.

[0149] Table 5 Primers used to mutate FCGRT and B2M PAM sequences

[0150]

[0151] result: Figure 4 Middle A shows that the complemented FCGRT and B2M were successfully expressed in FCGRT-KO and B2M-KO cells; Figure 4 D in the middle shows that FCGRT from different species was successfully expressed in FCGRT-KO cells. These results indicate that cells with FCGRT or B2M complementation were successfully constructed, and FCGRT-KO+mkFCGRT, FCGRT-KO+mkB2M, FCGR T-KO+pFCGRT, FCGRT-KO+hFCGRT, FCGRT-KO+mFCGRT, FCGRT-KO+rFCGRT, FC GRT-KO+bFCGRT, and FCGRT-KO+dFCGRT complementation cells were obtained.

[0152] 2. Effect of FcRn complementation on PRRSV proliferation

[0153] Cell preparation: prepare FCGRT-KO, B2M-KO, FCGRT-KO+mkFCGRT, FCGRT-KO+mkB2M, FCGRT-KO+pFCGRT, FCGRT-KO+hFCGRT, FCGRT-KO+mFCGRT, FCGRT-KO+rFCGRT, FCGRT-KO+bFCGRT, FCGRT-KO+dFCGRT and WT MA RC-145 cells that are growing vigorously and in good condition, and set up FCGRT-KO+Vector cells as controls.

[0154] Virus inoculation: PRRSV FJ strain was inoculated into the above cells at a dose of 1 MOI, and samples were collected 30 hours after inoculation.

[0155] Sample collection and detection: Collect cell supernatant and use TCID50 Detect virus titer; collect cell lysate, and detect the expression of PRRSV N protein by Western blot.

[0156] result: Figure 4 Middle B shows that complementation of FCGRT and B2M in FCGRT-KO and B2M-KO cells, respectively, can restore PRRSV N protein expression; Figure 4 Middle C shows that the PRRSV titer in the cell supernatant can be restored by replenishing FCGRT and B2M in FCGRT-KO and B2M-KO cells, respectively; Figure 4 Middle D shows that in FCGRT-KO cells, complementation of pig, green monkey, human, and bovine FCGRT can completely restore the expression of PRRSV N protein, complementation of mouse and rat FCGRT can partially restore the expression of PRRSV N protein, while complementation of dog FCGRT cannot restore the expression of PRRSV N protein; Figure 4 Middle E shows that in FCGRT-KO cells, supplementation of pig, green monkey, human, and bovine FCGRT can completely restore the supernatant PRRSV titer, supplementation of mouse and rat FCGRT can partially restore the supernatant PRRSV titer, while supplementation of dog FCGRT cannot restore the supernatant PRRSV titer. These results indicate that supplementation of FcRn can restore PRRSV proliferation, further confirming that Fc Rn is required for PRRSV infection of cells.

[0157] Example 5: Effect of knocking out FcRn on PRRSV uncoating

[0158] 1. Effect of FcRn knockout on PRRSV cell adsorption

[0159] Cell precooling: Precool the 12-well plate WT, mkFCGRT-KO, mkB2M-KO or confocal dish WT, mkFCG RT-KO cells in a 4°C refrigerator for 1 hour.

[0160] Virus adsorption: Wash three times with cold PBS, inoculate cells with PRRSV FJ strain (MOI=1) and place in a 4°C refrigerator for 2 h to allow virus adsorption.

[0161] Sample collection and detection: Wash with cold PBS three times to remove unadsorbed viruses, extract total RNA with Trizol, and detect the content of PRRSV ORF7 by qPCR; or fix the cells with 4% paraformaldehyde, observe the amount of PRRSV on the cell surface with a confocal fluorescence microscope, and then use ImageJ software to quantify the fluorescence intensity.

[0162] result: Figure 5 Middle A shows that knocking out FcRn does not affect the abundance of PRRSV ORF7 gene on the cell surface; Figure 5B shows that knocking out FcRn does not affect the abundance of PRRSV N protein on the cell surface. These results indicate that knocking out FcRn does not affect the adsorption of PRRSV.

[0163] 2. Effect of FcRn knockout on PRRSV internalization into cells

[0164] Cell precooling: Precool the 12-well plate WT, mkFCGRT-KO, mkB2M-KO or confocal dish WT, mkFCG RT-KO cells in a 4°C refrigerator for 1 hour.

[0165] Virus adsorption: Wash three times with cold PBS, inoculate cells with PRRSV FJ strain (MOI=1) and place in a 4°C refrigerator for 1 h to allow virus adsorption and limit internalization.

[0166] Virus internalization: Wash three times with PBS to remove unadsorbed viruses, add 1 mL of cell maintenance medium and place the cells at 37°C for 30 min to allow virus internalization.

[0167] Sample collection and detection: Wash with PBS three times to remove uninternalized viruses, extract total RNA after sampling with Trizol, and detect the content of PRRSV ORF7 by qPCR; or fix the cells with 4% paraformaldehyde, observe the amount of PRRSV in the cells under a confocal fluorescence microscope, and then use ImageJ software to quantify the fluorescence intensity.

[0168] result: Figure 5 Middle C shows that knocking out FcRn does not affect the abundance of PRRSV ORF7 gene in cells; Figure 5 Middle B shows that knocking out FcRn does not affect the abundance of PRRSV N protein in cells. These results indicate that knocking out FcRn does not affect the internalization of PRRSV.

[0169] 3. Effect of FcRn knockout on the formation of PRRSV replication transcription complexes (RTCs)

[0170] nsp2 is usually used as a marker for PRRSV RTCs, and the formation of RTCs is a sign that the virus begins to replicate.

[0171] Cell preparation: Prepare FCGRT-KO, B2M-KO, CD163-KO and WTMARC-145 cells that are growing vigorously and in good condition.

[0172] Virus inoculation: PRRSV-2FJ strain was inoculated into three single gene knockout and WT cells at a dose of 1 MOI, and samples were collected 24 h after inoculation.

[0173] Sample collection and detection: IFA was used to detect whether PRRSV nsp2 was expressed in the cells.

[0174] result: Figure 5 Middle E shows that the expression of PRRSV nsp2 was not detected in FcRn-KO cells. The results indicate that knocking out FcRn prevents the release of PRRSV genomic RNA.

[0175] The above results indicate that FcRn is involved in the uncoating of PRRSV.

[0176] Example 6: Interaction between FcRn and PRRSV

[0177] 1. Subcellular localization of FcRn and PRRSV

[0178] First, the PRRSV FJ strain (MOI=1) was inoculated into MARC-145 cells, and the cells were placed at 4°C for 1 h to allow full adsorption of the virus. The cells were then transferred to 37°C and infected at 37°C for 30 min to allow PRRSV internalization and then the samples were collected. Finally, confocal microscopy was used to detect the subcellular localization of FcRn, PRRSV particles and the early endosomal marker protein EEA1.

[0179] result: Figure 6 A in the middle shows that FcRn, EEA1, and PRRSV co-localize. The results indicate that the internalized PRRSV enters the FcRn-positive early endosome.

[0180] 2. Co-localization of FcRn and CD163

[0181] First, PRRSV FJ strain (MOI = 1) was inoculated into MARC-145 cells, and the cells were placed at 4°C for 1 h to allow sufficient virus adsorption. The cells were then transferred to 37°C and infected at 37°C for 30 min to allow PRRSV internalization before sampling. Finally, the localization of FcRn, PRRSV particles and CD163 was detected using a confocal microscope.

[0182] result: Figure 6 B in the middle shows that FcRn, CD163, and PRRSV co-localize. The results indicate that the internalized PRRSV enters the CD163-positive and FcRn-positive early endosomes.

[0183] 3. Interaction of FcRn with PRRSV and CD163

[0184] PRRSV FJ strain (MOI=5) was inoculated into MARC-145 cells and PAMs, and samples were collected for detection after 0.5 h of virus infection at 37°C. pFCGRT, pB2M, and PRRSV-N plasmids were co-transfected into HEK-293T cells, and samples were collected for detection of protein interactions 48 h after transfection.

[0185] result: Figure 6Center C shows that FcRn interacts with PRRSV M and N proteins, and the interaction at pH 6.0 is stronger than that at pH 7.4, but FcRn does not interact with GP3 and GP5; Figure 6 Figures D and E show the interaction of green monkey FcRn (6D) and porcine FcRn (6E) with PRRSV M and N proteins at pH 6.0, respectively; Figure 6 Middle F shows the interaction between porcine FcRn and PRRSV N protein in HEK-293T; Figure 6 Middle G shows that FcRn does not interact with CD163 regardless of PRRSV infection. These results indicate that FcRn interacts with PRRSV in the early endosome.

Claims

1. Use of an animal FcRn protein blocker or expression inhibitor in the preparation of a drug for resisting porcine reproductive and respiratory syndrome virus infection, wherein the FcRn protein is a neonatal Fc receptor protein.

2. The use according to claim 1, wherein the animal FcRn protein blocker comprises: Animal FcRn protein antibody or animal IgG.

3. The use according to claim 1, wherein the animal comprises pig IgG, rabbit IgG and / or mouse IgG.

4. The use according to claim 1, wherein the inhibitor of animal FcRn protein expression targets an inhibitor of a gene encoding a heavy chain and / or a light chain of an animal FcRn protein.

5. The use according to claim 1, wherein the inhibitor is a gRNA, antisense RNA or small interfering RNA targeting the heavy chain and / or light chain encoding gene of the animal FcRn protein.

6. The use according to claim 5, wherein the animal is a pig or a green monkey.

7. The use according to claim 6, when the animal is a pig, the inhibitor of the gene encoding the heavy chain of the pig FcRn protein is shRNA: GGAACAAGCAGAAGCTCTTTC, GCGAGGAGTTTATGAAGTTCG, GGTCGTCGCTAACAGTCAAGA and GCTTCCTACTGCTCTTGATCG.

8. The use according to claim 6, when the animal is a green monkey, the inhibitor of the heavy chain encoding gene of the green monkey FcRn protein is sgRNA: CCTGAGCTACGATAGCCTG and / or the light chain encoding gene sgRNA: ACCCAGACACATAGCAATTC.

9. A method for preparing cells resistant to porcine reproductive and respiratory syndrome virus infection, comprising knocking out or inhibiting the heavy chain and / or light chain encoding gene of FcRn protein in the cells.

10. A method for preparing cells susceptible to porcine reproductive and respiratory syndrome virus, comprising overexpressing animal FcRn protein in the cells.

Images