Preparation method and application of Escherichia coli bionic vesicle presentation H9 subtype avian influenza virus HA1 protein

Abstract

The invention belongs to the technical field of biology, and relates to a preparation method and application of Escherichia coli bionic vesicle presenting H9 subtype avian influenza virus HA1 protein, the yield of bionic vesicles is increased by constructing O78 serotype Escherichia coli deficient bacteria delta tolA-delta araD, the yield of the bionic vesicles is increased by L-arabinose induction and high-pressure homogenization technologies, and the Escherichia coli bionic vesicle presenting H9 subtype avian influenza virus HA1 protein is obtained. The presentation of the HA1 protein on the surface of the bionic vesicle is realized. The biomimetic vesicles derived from O78 serotype Escherichia coli are used for presenting the HA1 protein for the first time, the vesicle yield is increased, the soluble expression of the HA1 protein is increased, the cost is low, and the feasibility is high.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a preparation method for a high-yield bionic vesicle derived from O78 serotype Escherichia coli to stably present H9N2 subtype avian influenza virus (AIV) HA1 protein and its application in resisting H9 subtype avian influenza and avian E. coli disease. Background Art

[0002] In intensive poultry farms, mixed infection with multiple pathogens is common, causing huge economic losses. H9N2 subtype avian influenza virus (AIV) is one of the most prevalent pathogens in poultry in my country. When infected alone, it has low pathogenicity to poultry and usually does not cause direct death. However, in actual production, many production losses are directly related to it. Avian pathogenic E. coli (APEC), as one of the most common bacterial pathogens in poultry, often co-infects with H9N2 subtype AIV to produce synergistic effects, resulting in increased mortality, decreased production performance and the risk of foodborne transmission to humans.

[0003] Vaccination is one of the main strategies for the prevention and control of avian influenza and avian Escherichia coli disease. As a new type of vaccine, subunit vaccines stimulate immune responses by presenting specific antigenic components of pathogens. Compared with traditional vaccines, they have the advantages of higher safety and easier production. However, the immunogenicity of subunit vaccines is usually weak, and an effective carrier system is urgently needed to enhance their immune effects. In recent years, the study of outer membrane vesicles (OMVs) as subunit vaccine carriers has gradually attracted attention. Among them, OMVs of Escherichia coli have become one of the research hotspots because of their easy preparation, low cost and strong controllability. Several recent studies have shown that heterologous proteins can be targeted to OMVs by producing them in the outer membrane or periplasm. In addition, this targeting process can also be achieved by fusion expression of heterologous proteins with vesicle-related proteins, which opens up the possibility of displaying foreign proteins using OMVs as carriers. ClyA of Escherichia coli is a membrane-anchored protein that is transported to OMVs through the bacteria's own regulatory mechanism. However, the ability of OMVs to present foreign proteins is limited due to the inability of high-content ClyA to be localized to the outer membrane, which greatly limits the efficiency of ClyA anchored in the outer membrane to deliver antigens.

[0004] Traditional vaccines have limitations in dealing with pathogen diversity and variability, and the abuse of antibiotics has caused bacterial resistance. There are many APEC serotypes, among which O78 is one of the common serotypes in China. However, due to the unsatisfactory cross-protection between different APEC serotypes, the existing engineered E. coli OMVs expressing exogenous proteins can only produce immune responses against exogenous antigens. Therefore, the development of a two-in-one vaccine that can simultaneously target H9N2 AIV and O78 serotype APEC has become an urgent scientific research problem and practical need. Summary of the invention

[0005] In view of the above problems, the present invention improves the yield of bionic vesicles by constructing O78 serotype Escherichia coli defective bacteria ΔtolA-ΔaraD, realizes the presentation of HA1 protein on the surface of bionic vesicles through L-arabinose induction and high-pressure homogenization technology, and evaluates whether it can effectively protect chickens from infection by H9N2 subtype avian influenza virus and O78 serotype Escherichia coli as an immunogen.

[0006] The technical solution provided by the present invention is as follows:

[0007] A fusion protein is obtained by connecting a ClyA protein and a HA1 protein in series via a Linker; the sequences of the ClyA protein, the Linker and the HA1 protein are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0008] The present invention also provides a preparation method for Escherichia coli bionic vesicles presenting H9 subtype avian influenza virus HA1 protein, ClyA and H9N2 AIV HA1 protein are connected in series through Linker, and the fusion protein is expressed in a vesicle donor. The fusion protein ClyA-HA1 is presented on the surface of the bionic vesicle using high-pressure homogenization technology to obtain a recombinant bionic vesicle (BBV); the nucleotide sequences of the ClyA protein, Linker and HA1 protein are codon-optimized for Escherichia coli, as shown in SEQ ID NO.1, SEQID NO.2 and SEQ ID NO.3.

[0009] SEQ ID NO.1:

[0010] ATGACAGAAATAGTAGCTGACAAGACCGTTGAGGTGGTGAAAAACGCCATCGAAACCGCAGATGGTGCACTCGACCTGTATAACAAGTATCTGGACCAGGTGATTCCGTGGCAGACCTTTGATGAAACCATCAAGGAGCTGAGTCGTTTTAAACAAGAATACAGCCAAGCGGCGTCTGTTCTGGTTGGTGACATCAAGACTTTGCTTATGGATTCGCAAGATAAGTACTTCGAAGCGACGCAAACCGTTTATGAGTGGTGTGGTGTCGCTACCCAGCTGTTGGCGGCATATATTCTGTTATTCGACGAGTACAACGAAAAGAAAGCGAGCGCGCAGAAAGACATTCTGATCAAGGTGCTGGACGACGGCATTACCAAATTGAATGAGGCTCAAAAGTCTTTGTTGGTTTCATCCCAGAGCTTCAACAACGCGTCTGGAAAGTTGCTGGCGCTGGACAGCCAGCTGACCAATGATTTCAGCGAAAAGTCCAGCTATTTCCAGAGCCAAGTGGACAAAATCCGTAAAGAAGCCTACGCAGGCGCGGCCGCGGGTGTTGTAGCCGGTCCGTTTGGTCTGATCATCAGCTACAGCATTGCCGCAGGTGTCGTGGAAGGCAAGCTCATCCCGGAACTGAAGAACAAGCTGAAATCAGTCCAGAATTTCTTTACCACCCTGAGCAATACCGTGAAGCAGGCAAATAAAGATATTGATGCAGCGAAATTAAAGCTCACCACAGAGATCGCGGCGATTGGCGAAATTAAAACCGAGACGGAAACGACCCGTTTTTATGTTGACTACGATGACCTGATGCTGAGCCTGCTTAAGGAGGCGGCTAAAAAAATGATTAACACGTGCAACGAGTACCAGAAGCGCCATGGTAAAAAAACTCTGTTCGAGGTTCCGGAGGTG;

[0011] SEQ ID NO.2:

[0012] GGCTCCGGCTCTGGTGAAGGTTCCGGC;

[0013] SEQ ID NO.3:

[0014] GACAAAATCTGCATTGGTTATCAAAGCACGAACAGCACCGAAACCGTTGATACGCTGACTGAGAACAACGTGCCGGTTACACATGCGAAAGAACTGCTTCACACCGAGCACAACGGCATGCTGTGTGCGACCGGTTTGGGCCACCCGCTCATCCTGGATACGTGCACCATTGAAGGTCTGATCTACGGCAATCCGAGCTGCGACCTGTTGTTGGGTGGACGTGAATGGAGCTATATCGTGGAAAGACCATCCGCGGTTAACGGTCTGTGCTACCCGGGTAACGTGGAGAACCTGGAAGAGCTGCGCAGCCTTTTCAGTTCTGCGTCCTCCTACCAACGTATCCAAATCTTTCCGGATACCATCTGGAATGTGACGTACAGCGGCACCAGCAAGGCGTGTTCGGACAGCTTCTATCGTAGCATGCGTTGGCTGACCCAGAAAAATAACGCCTACCCGATTCAGGATGCTCAATATACCAACAACCAAGAAAAAAACATTCTGTTCATGTGGGGTATTAACCATCCGCCTACTGACACTGCCCAAACGAACCTGTACACCCGTACCGACACCACAACCTCCGTTGCGACCGAGGAGATCAACCGTACCTTTAAACCGTTGATTGGTCCGCGTCCGTTGGTTAATGGTTTACAGGGTCGCATCGATTATTACTGGTCAGTCCTGAAGCCGGGTCAGACCTTGCGCATTCGTTCTAATGGCAATTTAATTGCACCGTGGTATGGTCACATCCTGTCCGGCGAATCCCATGGTCGCATCCTGAAGACCGACCTGAAACGTGGTAGCTGCACGGTACAGTGTCAGACCGAGAAGGGCGGACTCAATACCACCCTGCCATTTCAGAATGTCAGCAAGTACGCGTTCGGCAACTGCTCTAAGTACATCGGGATTAAAAGCCTGAAGCTGGCAGTGGGTCTGCGTAATGTTCCGAGTCGCTCTAGCCGC。

[0015] Furthermore, ClyA and H9N2 AIV HA1 protein were concatenated via Linker, the ribosome binding site was fused to the N-terminus of the ClyA sequence to promote the expression of the fusion protein, the 6×his tag was fused to the C-terminus of the HA1 sequence, and the ClyA-HA1 sequence was inserted between the EcoRⅠ and HindⅢ restriction sites in the pBAD18-Cm vector using T4 ligase to construct the pBAD18-ClyA-HA1 recombinant plasmid; the ribosome binding site sequence is shown in SEQ ID NO.4.

[0016] Furthermore, the primers for constructing the pBAD18-ClyA-HA1 recombinant plasmid are shown in SEQ ID NOs. 11-14.

[0017] Furthermore, the vesicle donor is a defective bacterium ΔtolA-ΔaraD of Escherichia coli of serotype O78; the araD gene of the vesicle donor is knocked out by λ-Red homologous recombination technology.

[0018] Furthermore, the primers for the targeting fragment of araD gene knockout are shown in SEQ ID NOs. 5 and 6.

[0019] Furthermore, the identification primers for the O78 serotype Escherichia coli defective bacteria ΔtolA-ΔaraD are shown in SEQ ID NOs. 7 to 10.

[0020] The present invention also provides a recombinant bionic vesicle prepared by the above method.

[0021] The present invention also provides a recombinant expression vector, pBAD18-Cm optimized by RBS, which increases the expression amount of the fusion protein ClyA-HA1.

[0022] Furthermore, the RBS sequence is GAAGGAGATATACAT (SEQ ID NO. 4).

[0023] The present invention also provides a bionic vesicle donor, which contains the above-mentioned recombinant expression vector.

[0024] Furthermore, the bionic vesicle donor knocks out the araD gene through the λ-Red homologous recombination technology, thereby eliminating the metabolic decomposition of the L-arabinose inducer by the wild-type Escherichia coli and increasing the expression stability of the fusion protein ClyA-HA1.

[0025] The present invention also provides a method for presenting recombinant proteins by bionic vesicles, which uses high-pressure homogenization technology to quickly destroy bacterial membranes, force the release of intracellular fusion proteins and carry out plasma membrane reorganization, and effectively drive the bacterial membrane to produce recombinant bionic vesicles.

[0026] Furthermore, the pressure of the high-pressure homogenizer is set to 1000 bar and 4°C.

[0027] The present invention also provides the use of the above fusion protein, the above method or the above recombinant bionic vesicle in preparing an agent for preventing and treating H9 subtype avian influenza virus and O78 serotype Escherichia coli infection.

[0028] Furthermore, the recombinant bionic vesicles are used to inhibit the detoxification of H9 subtype avian influenza virus in the chicken larynx and cloaca, reduce the bacterial load in chickens infected with O78 serotype Escherichia coli, and reduce the degree of inflammation in the air sacs and heart.

[0029] Beneficial Effects

[0030] This invention is the first to use biomimetic vesicles derived from O78 serotype Escherichia coli to present HA1 protein, which not only improves the vesicle yield, but also increases the soluble expression of HA1 protein, with low cost and high feasibility. After BBVs (BBV-HA1) displaying HA1 protein were immunized in SPF chickens by intranasal drops, the level of specific sIgA against H9N2 AIV and outer membrane protein in the nasal cavity and trachea was significantly increased, the level of IgY against H9N2 AIV and outer membrane protein in the immune serum was significantly increased, the HI antibody titer reached 5.2±0.84 log2, and the in vitro bactericidal activity of the immune serum was significantly enhanced. CD4 + T cell immune activity is enhanced. Lymphocytes were stimulated with HA1 and outer membrane protein respectively, and BBV-HA1 could effectively proliferate compared with the PBS group. The immune protection results showed that BBV-HA1 could effectively reduce the bacterial load in chickens, reduce the degree of inflammation in the air sacs and heart, and promote the weight recovery of chickens; in addition, it could also provide partial protection against H9 subtype strain attacks. The recombinant bionic vesicles described in the present invention can provide effective protection against both H9N2 AIV and O78 serotype APEC, providing support for the development of bivalent vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 PCR verification of araD gene knockout in J11 strain; A. PCR amplification results using homology arm primers F1 / R1, M: DL 2000, 1-3 represent strains that have not been successfully mutated, and 4 represents strains that have been successfully mutated; B. PCR amplification results using araD gene specific primers F2 / R2, M: DL 2000, 1-3 represent strains that have not been successfully mutated, and 4 represents strains that have been successfully mutated;

[0032] Figure 2 Schematic diagram for constructing recombinant biomimetic vesicles;

[0033] Figure 3Characterization of recombinant bionic vesicles; A. Electron microscopic characterization of recombinant bionic vesicles, the scale is 100 nm; B. Particle size characterization of recombinant bionic vesicles;

[0034] Figure 4 The results of successful construction of biomimetic vesicles presenting HA1 protein; A. SDS-PAGE analysis of biomimetic vesicles presenting ClyA-HA1 recombinant protein; B. Western Blot identification of biomimetic vesicles presenting ClyA-HA1 recombinant protein; C. Localization analysis of biomimetic vesicles presenting ClyA-HA1 recombinant protein; 1 represents uninduced lysis supernatant, 2 represents induced lysis supernatant, and 3 represents BBV-ClyA-HA;

[0035] Figure 5 The amount of protein presented by biomimetic vesicles; A. The total amount of vesicles was determined by BCA method; B. The amount of recombinant protein was determined by BSA gradient concentration;

[0036] Figure 6 is the level of sIgA antibody against TX; A. ​​The level of anti-TX specific sIgA antibody in the nasal cavity; B. The level of anti-TX specific sIgA antibody in the trachea; OD 450 Value representation;

[0037] Figure 7 is the level of IgY antibodies against TX; A. ​​The level of specific IgY antibodies against TX in serum, expressed as OD 450 Values ​​indicate; B. HI antibody titer;

[0038] Figure 8 is the level of sIgA antibody against Omps; A. the level of anti-TX specific sIgA antibody in the nasal cavity; B. the level of anti-TX specific sIgA antibody in the trachea; OD 450 Value representation;

[0039] Fig. 9 is the level of IgY against Omps in serum and its bactericidal activity; A. The level of specific IgY antibody against Omps in serum, expressed as OD 450 Values ​​indicate; B. Bactericidal activity of immune serum;

[0040] Fig.10 The results of lymphocyte proliferation are shown in Figure 2. A. Proliferation results for HA1 protein; B. Proliferation results for Omps;

[0041] Fig.11 Immune protection of recombinant biomimetic vesicles against APEC serotype O78 infection in chickens; A. Body weight changes; B. Pathological changes in the heart and air sacs; C. Lesion score; D. Bacterial load in the blood; E. Bacterial load in various tissues and organs. DETAILED DESCRIPTION

[0042] Example 1

[0043] Construction of ΔtolA ΔaraD J11 strain

[0044] The araD gene was knocked out using λ-Red homologous recombination technology. The targeting fragment primers (araD-DF / R) were designed based on the E. coli araD gene sequence published in GenBank. The sequence is shown in Table 1.

[0045]

[0046] Using the pKD3 plasmid as a template and araD-DF and araD-DR in Table 1 as primers, the chloramphenicol resistance gene containing the homology arms was amplified and recovered after identification by 1% gel electrophoresis. Subsequently, the ΔtolA J11 strain carrying the pKD46 plasmid was cultured in LB medium supplemented with ampicillin and 0.2% L-arabinose until the OD reached 0.04 at 30 °C. 600 = 0.5. Then the bacterial cells were collected, washed three times with ice-cold 10% glycerol, and electrotransformation competent cells were prepared. Then the target DNA fragment was electrotransformed into competent cells, and CmR-positive single colonies were screened at 37°C. The positive strains were prepared into electrotransformation competent cells, and the pCP20 plasmid was transferred. The cells were cultured at 30°C for 12-16 h, and AmR-positive single colonies were picked and screened. The positive strains were cultured at 42°C to eliminate the pCP20 plasmid, and then cultured at 37°C to become the knockout strain ΔtolA ΔaraD J11 without resistance. PCR identification was performed using the homologous arm primers on both sides (F2 / R2). The band size of the ΔtolA J11 strain was 797 bp, and the ΔtolA ΔaraD J11 double gene mutant was 1122 bp. After the resistance gene was knocked out, the araD gene-specific primers (F1 / R1) showed that the band size of the ΔtolA J11 strain was 696 bp, and the araD gene was not amplified in the ΔtolA ΔaraD J11 mutant strain ( Figure 1 ), indicating that the gene mutant strain was successfully constructed.

[0047] Example 2

[0048] ΔtolA ΔaraD J11 biomimetic vesicles present H9 subtype AIV HA1 recombinant protein

[0049] Recombinant biomimetic vesicle construction strategies Figure 2As shown. ClyA (GenBank: AF240780.1) and HA1 (GenBank: JN653620.1) were codon-optimized and synthesized by Nanjing GenScript for E. coli. First, ClyA and HA1 were concatenated by Linker using Overlap PCR, and the ribosome binding site (RBS) was fused to the N-terminus of the ClyA sequence in primer design to promote the expression of the fusion protein, and the 6×his tag was fused to the C-terminus of the HA1 sequence to facilitate the verification of protein expression. The ClyA-HA1 sequence was inserted between the EcoRⅠ and HindⅢ restriction sites in the pBAD18-Cm vector using T4 ligase to construct the pBAD18-ClyA-HA1 recombinant plasmid. The primers are shown in Table 2.

[0050]

[0051] Note: The underline indicates the restriction site, the bold indicates the ribosome binding site, and the italic indicates the 6×his tag.

[0052] The recombinant plasmid pBAD18-ClyA-HA1 was electroporated into ΔtolA ΔaraD J11 competent cells, and then single clones were randomly selected and cultured in 5 mL CmR LB medium at 37 °C and 220 rpm for 12 h. The bacterial solution was then identified by PCR, and the recombinant plasmid identified correctly by PCR was sent to Sangon Biotech for sequencing.

[0053] The ΔtolA ΔaraD J11 strain carrying pBAD18-ClyA-HA1 was inoculated into liquid LB containing chloramphenicol resistance at a dilution of 1:100 and cultured at 37°C with shaking at 220 rpm until OD 600The value was set to about 0.5, and L-arabinose with a final concentration of 0.2% was added. The cells were induced at 25 ℃ and 220 rpm for 12 hours, and the cells were collected and resuspended in PBS. The ΔtolA ΔaraD J11 cells expressing the ClyA-HA1 recombinant protein were resuspended in PBS buffer (pH 7.4). BBVs were isolated as follows: The bacteria were broken under high pressure (1000 bar, 4 ℃) using a high-pressure homogenizer (AH-E). The high-pressure homogenized sample was collected and centrifuged at 6,000×g for 30 min at 4 ℃ to precipitate impurities, and the supernatant was collected. The supernatant was filtered with a 0.45μm filter membrane and concentrated using a 100kDa ultrafiltration tube. Then ultracentrifugation was performed (150000 g, 1 h, 4 ℃), and the precipitate was resuspended in sterile PBS (pH 7.4), which was the enriched biomimetic vesicles. We observed the isolated BBVs and BBV-ClyA-HA1 by electron microscopy and particle size analysis. We detected the self-assembly of BBVs by transmission electron microscopy and found that the recombinant BBVs could maintain a nanoscale spherical structure, indicating that the expression of ClyA-HA1 recombinant protein did not affect the morphology of BBVs. The particle size analysis using Malvern particle analyzer (ES90 Nano) found that the particle size of BBV was 205.77 ± 1.76 nm, while the particle size of BBV-ClyA-HA1 was 233.70 ± 3.99 nm ( Figure 3 ).

[0054] Subsequently, SDS-PAGE electrophoresis was performed. The results showed that compared with the uninduced bacterial solution, an overexpression band of about 70 kDa was present in both the supernatant and BBVs after induction ( Figure 4 A). Western Blot verification was performed using H9N2 AIV TX polyclonal antibody as the primary antibody. The results showed that a specific band of about 70 kDa appeared in the supernatant and BBVs after induction ( Figure 4 B), which is consistent with the theoretical molecular weight of ClyA-HA1, proving that the recombinant protein can be correctly expressed in the supernatant and BBVs. In addition, we tried to detect the localization of the recombinant protein in BBVs. BBVs expressing ClyA-HA1 recombinant protein were incubated with proteinase K at 37 °C in the presence or absence of 1% SDS. The samples were then analyzed by Western Blot using 6×His monoclonal antibody as the primary antibody. The data showed that proteinase K was able to directly degrade ClyA-HA1 protein regardless of whether the structure of BBVs was destroyed by SDS, indicating that the HA1 protein was localized on the surface of BBVs ( Figure 4 C).

[0055] The total amount of protein in outer membrane vesicles and biomimetic vesicles was determined by the BCA method, and it was found that the amount of naturally produced outer membrane vesicles per 1L of culture was 2.24 mg, while that of biomimetic vesicles was 9.66 mg. In addition, we used the Coomassie Brilliant Blue method to preliminarily estimate the amount of recombinant protein. The biomimetic vesicles and bovine serum albumin (BSA) standards of known concentrations were subjected to SDS-PAGE analysis and stained with Coomassie Brilliant Blue. The loading of recombinant protein in the biomimetic vesicles was preliminarily analyzed based on the gray value of the BSA protein band. It was found that every 9.66 mg of biomimetic vesicles contained 3.26 mg of recombinant protein, and the amount of recombinant protein accounted for 33.74% of the content of the biomimetic vesicles ( Figure 5 ).

[0056] Example 3

[0057] Immune protection test of recombinant biomimetic vesicles

[0058] One-week-old SPF chickens were randomly divided into 9 groups. H9N2 AIV TX was inactivated with formaldehyde at a final concentration of 2‰ for 24 h at 4°C, and the Escherichia coli J11 strain was heat-inactivated for later use. The immunization groups are shown in Table 3. The TX inactivated vaccine and the J11 inactivated vaccine were mixed with the adjuvant at a ratio of 1:1 and inoculated by subcutaneous multi-point injection, once every two weeks, for a total of 2 immunizations. The BBV, HA1, BBV+HA1 and BBV-HA1 groups were immunized by intranasal drops, once every week, for a total of 3 immunizations.

[0059]

[0060] The levels of specific IgY against Omps and TX in serum and specific sIgA antibodies in nasal and tracheal lavage fluids were determined by indirect ELISA. Briefly, the ELISA plate was incubated with 50 ng of purified Omps or TX whole virus in 100 μL of coating buffer (15.9 mM Na2CO3, 29.7 mM NaHCO3, pH 9.6) at 4 °C overnight. The plate was then washed three times with phosphate-buffered saline (PBST) containing 0.05% Tween-20 for 10 min each time. The plate was blocked with PBST containing 5% skim milk at 37 °C for 2 h. Serum samples were diluted 1:6400, and nasal and tracheal lavage fluids were diluted 1:5. 100 μL of the diluted sample to be tested was added to each well and incubated at 37 °C for 1 h. Then, 100 μL of rabbit anti-chicken IgY-HRP (H+L) or rabbit anti-chicken sIgA-HRP (H+L) antibody (1:8000 dilution) was added and incubated at 37 °C for 1 h. 100 μL of TMB was added to react in the dark for 15 min, and then 50 μL of 2M H2SO4 was added to terminate the reaction. Finally, the OD was measured in an ELISA reader. 450 Optical density value at nm.

[0061] Determination of immune serum HI antibody level: According to the results of the HA test of the TX strain, 4 units of antigen were prepared. Use a 96-well V-shaped microplate, add 25 μL PBS to each well from 1 to 11, and add 50 μL PBS to the 12th well. Add 25 μL of the serum to be tested to the 1st well, mix thoroughly, and then transfer 25 μL to the 2nd well. Dilute it to the 10th well in turn, discard 25 μL from the 10th well, set the 11th well as the virus control, and the 12th well as the red blood cell control. Add 25 μL of 4 units of antigen to each well from 1 to 11, tap the reaction plate to mix, and let it stand at 37 ° C for 15 min. Then add 25 μL of 1% chicken red blood cell suspension to each well from right to left. Place the reaction plate on a microplate oscillator and shake it slightly. Observe the results after standing at 37 ° C for 15 min. The results can be determined when the red blood cells in the red blood cell control well show obvious precipitation.

[0062] To determine the bactericidal capacity of antibodies in serum samples in vitro, we used a modified serum bactericidal activity assay. The APEC O78 strain was cultured to the logarithmic growth phase and then suspended in PBS to a concentration of 10 6 CFU / mL for subsequent determination. The immune serum was diluted 1:10 with LB medium. In a round-bottom 96-well plate, 90 μL of diluted serum was mixed with 10 μL of adjusted bacteria and incubated at 37 °C, 100 rpm, shaking for 1 h. The reaction mixture was serially diluted 10-fold and incubated overnight at 37 °C to count viable colonies. To calculate the survival rate of O78 in different serum samples, the number of serum-treated bacteria was divided by the number of original bacteria. All serum samples were tested three times independently.

[0063] 3.1 Evaluation of mucosal immunity against H9N2 AIV after vaccination

[0064] One week after each immunization, the nasal and tracheal lavage fluids of the chickens were collected and coated with purified H9N2 AIV TX, and the levels of specific sIgA antibodies against TX produced by the vaccine-induced chickens were determined using the indirect ELISA method. The results showed that after the first and second immunizations, no high levels of sIgA antibodies were found in the trachea and nasal cavity of all groups of immunized chickens. After the third booster immunization, the antibody levels in the nasal cavity and trachea of ​​the BBV-HA1 immunized group were significantly higher than those of the PBS group, while there was no significant difference in the antibody levels between the inactivated vaccine group (TX-inactive) and other immunized groups and the PBS group ( Figure 6 ). This indicates that only by using BBV as a carrier to present HA1 protein can the body's mucosal immune response be stimulated and the body be induced to produce specific mucosal immunity against H9N2 AIV TX.

[0065] 3.2 Evaluation of humoral immunity against H9N2 AIV after vaccination

[0066] One week after each immunization, blood was collected from the chickens and serum was separated. The humoral immune response of each immunization group against H9N2 AIV TX was determined by indirect ELISA test and HI test, respectively. The results of the indirect ELISA test showed that one week after the first immunization, the IgY antibody level in the serum of each group of immunized chickens did not increase. One week after the second booster immunization, only the IgY antibody level of the TX-inactive immunization group increased significantly. One week after the third immunization, the serum IgY levels of the TX-inactive and BBV-HA1 immunization groups increased significantly. The results of the HI test showed that one week after the first immunization, the HI antibody level of the chickens in the TX-inactive immunization group increased, reaching an average of 2.4±1.52 log2. One week after the second booster immunization, the HI antibody titer of the BBV-HA1 immunization group increased slightly, reaching 2 log2, and the HI antibody titer of the TX-inactive immunization group increased significantly, reaching 8.6±0.86 log2. One week after the third immunization, the HI antibody titers of TX-inactive, BBV+HA1, and BBV-HA1 all increased significantly, with BBV+HA1 reaching 3±0.71 log2, BBV-HA1 reaching 5.2±0.84 log2, and TX-inactive reaching 10.8±0.45 log2 ( Figure 7 ). In addition to the TX-inactive immunization group that can induce the highest antibody level, the BBV-HA1 immunization group can also effectively stimulate the body to produce a high antibody level, while the antibody level produced by the immunization group with HA1 protein alone or BBV as an HA1 protein adjuvant is significantly lower than that of BBV-HA1. This shows that the HA1 protein presented by BBV has improved immunogenicity and can be better recognized by the body, thereby producing a stronger specific humoral immune response.

[0067] 3.3 Evaluation of APEC mucosal immunity after vaccination

[0068] One week after each immunization, the nasal and tracheal lavage fluids of the chickens were collected, and the levels of specific sIgA antibodies against APEC induced by the vaccine in the chickens were determined by indirect ELISA method by coating the purified Omps protein. The results showed that after the first immunization, no high levels of sIgA antibodies were shown in the trachea and nasal cavity of the immunized chickens in each group. After the second booster immunization, the antibody levels of BBV, BBV+HA1 and BBV-HA1 were all increased. After the third booster immunization, the antibody levels of BBV, BBV+HA1 and BBV-HA1 increased further, and were significantly different from the antibody levels of the PBS group. However, the antibody levels of the HA1 and J11-inactive groups were not significantly different from those of the PBS group ( Figure 8 ). This indicates that BBV can induce the body to produce specific mucosal immunity against APECOmps.

[0069] 3.4 Evaluation of humoral immunity against APEC after vaccination

[0070] One week after each immunization, the blood of the chickens was collected and the serum was separated. The humoral immune response against APEC in each immunization group was determined by indirect ELISA test and serum bactericidal test. The results showed that after the first immunization, the IgY antibody level in the serum of each group of immunized chickens did not increase. After the second and third booster immunizations, the anti-Omps IgY antibody levels in the J11-inactive, BBV, BBV+HA1 and BBV-HA1 immunization groups increased significantly, which were significantly different from the PBS and HA1 immunization groups. Among them, the J11-inactive group had the highest antibody level, and there was no significant difference between the BBV, BBV+HA1 and BBV-HA1 immunization groups ( Fig. 9 A). In addition, we tested the bactericidal activity of each group of immune sera. The freshly isolated immune sera were incubated with APEC in vitro, cultured at 37 °C for 1 h, and then diluted and plated to count the number of surviving colonies. The results showed that after the third booster immunization, BBV, BBV+HA1, BBV-HA1 and J11-inactive immune sera effectively inhibited bacterial survival, while PBS and HA1 immune sera failed to inhibit bacterial survival ( Fig. 9 B). This indicates that BBVs can effectively stimulate the body's specific humoral immune response and produce specific antibodies against APEC.

[0071] PBMC cell proliferation

[0072] After three immunizations, we isolated PMBCs from chickens, stimulated lymphocytes with HA1 protein and Omps protein, and evaluated cell proliferation using the CCK-8 method. The details were as follows: PMBCs were isolated and counted, and then cultured in RPMI1640 medium containing 10% FBS at 10% per well.6 Each well was inoculated with 10 μL of CCK-8 solution and incubated at 37°C in the dark for 1 h. The optical density (OD) was then measured at 450 nm using a microplate reader. 450 The stimulation index (SI) was calculated as the OD of Omps-stimulated cells. 450 Value / OD of unstimulated cells 450 The results showed that after stimulation with HA1 protein, the lymphocyte proliferation index of HA1, BBV+HA1, BBV-HA1 and TX inactivated vaccine groups was significantly higher than that of PBS group (p≤0.01), among which the lymphocyte proliferation index of BBV-HA1 group was the highest ( Fig.10 A); Under the stimulation of Omps protein, the proliferation of BBV, BBV+HA1, BBV-HA1 and J11 inactivated vaccine groups was extremely significant compared with the PBS group (p≤0.01) ( Fig.10 B).

[0073] Example 4

[0074] Results of the challenge protection test

[0075] 4.1 Protection against H9N2 virus

[0076] After immunization of SPF chickens according to the above immunization schedule, H9N2 AIV TX was used for nasal challenge. Laryngeal and cloacal swabs were collected on the 3rd, 5th and 7th days after challenge. The vaccine protection of SPF from H9N2 AIV attack was determined according to the real-time fluorescence quantitative RT-PCR based on the M gene of H9N2 AIV probe method previously established in our laboratory. The details are as follows: Primers and probes were analyzed and designed using PCR primer design software Primer 5.0 and Lasergene 7.1 software, and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers are shown in Table 4.

[0077]

[0078] In order to accurately determine the detoxification of chickens, cDNA was extracted from the collected laryngeal and cloacal swabs, and absolute fluorescence quantitative PCR detection was performed according to the following system: in a total volume of 20 μL, 10 μL of 2×PerfectStart IIProbe qPCR SuperMix UDG, 0.4 μL of 10 μM upstream and downstream primers, 0.4 μL of probe, and 2 μL of reverse transcription product were added, and finally the system was completed with 6.8 μL of ddH2O.

[0079] The reaction conditions were set as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 5 s, annealing at 60 °C for 30 s, and collecting fluorescence signals at the end of annealing, for 40 cycles.

[0080] The results showed that no cloacal excretion was detected in any group of SPF chickens at 3, 5 and 7 days after the virus attack, but the excretion of the larynx was different. The TX inactivated vaccine group was able to completely inhibit the excretion of the larynx (0 / 8), while the other immunization groups failed to completely inhibit the excretion of the larynx. Among them, BBV-HA1 had the best protection effect, with only 2 chickens excreting the larynx on the 7th day. Five chickens still excreted the larynx after simple immunization with HA1 protein, and 5 chickens in both the BBV and BBV+HA1 groups excreted the larynx. These results show that when HA1 protein is presented to BBV, it can provide better immune protection (Table 5).

[0081]

[0082] 4.2 Protection against APEC serotype O78

[0083] SPF chickens were immunized according to the above immunization schedule and then immunized with APEC serotype O78 (10 7 CFU / hen) were challenged by air balloon injection and observed for 7 days. In order to evaluate the effect of immunization on the weight gain of SPF chickens after challenge, the chickens in each group were weighed every day. The results showed that the weight of SPF chickens in each group continued to decrease within 4 days after challenge, and then gradually increased from the 5th day after challenge. Compared with the Blank healthy control group, on the 7th day after challenge, the weight difference between SPF chickens in BBV, BBV+HA1, BBV-HA1 and J11 inactivated vaccine groups disappeared (p>0.05), while the weight of SPF chickens in PBS and HA1 groups was still significantly different from that in the Blank group (p<0.001)( Fig.11 A).

[0084] In order to evaluate the effect of immunization on infection in SPF chickens after challenge, the chickens were killed 7 days after challenge, and the lesions of the heart and air sac were recorded and analyzed, and the lesion scores were performed. The results showed that the heart of the chickens in the PBS and HA1 groups was dysplastic, the pericardium was thickened, and there was a large amount of fibrinous exudate, and the air sac was thickened and turbid. However, there was no significant difference between the heart and air sac of the chickens in the BBV, BBV+HA1, BBV-HA1 and J11 inactivated vaccine groups and the Blank group ( Fig.11 B, C).

[0085] In addition, we evaluated the dynamic distribution and content of bacteria in SPF chickens. Three chickens in each group were randomly killed 24 hours after bacterial challenge, and the liver, spleen, lung and kidney tissues were obtained, ground with sterile PBS and then counted for colony counts. In addition, blood samples were collected 24 hours and 96 hours after challenge for the determination of bacterial load. The samples were diluted 10 times in sterile PBS and finally spread on MacConkey medium to calculate the number of colonies. Through colony counting, we found that the bacterial load in the blood of chickens immunized with BBV, BBV+HA1, BBV-HA1 and J11 inactivated vaccine groups was significantly reduced compared with the PBS group 72 hours after challenge (p < 0.05). Except for the trachea, the bacterial load in the liver, spleen, lungs and kidneys of the BBV, BBV+HA1, BBV-HA1 and J11 inactivated vaccine groups was significantly lower than that of the PBS group (p < 0.05) APEC ( Fig.11 D, E).

Claims

1. A fusion protein, wherein the fusion protein is obtained by connecting a ClyA protein and a HA1 protein in series via a linker; the sequences of the ClyA protein, the linker and the HA1 protein are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

2. A method for preparing Escherichia coli biomimetic vesicles presenting H9 subtype avian influenza virus HA1 protein, characterized in that: ClyA and H9N2 AIV HA1 proteins are connected in series through Linker, and the fusion protein is expressed in a vesicle donor. The fusion protein ClyA-HA1 is presented on the surface of the bionic vesicle using high-pressure homogenization technology to obtain a recombinant bionic vesicle; the sequences of the ClyA protein, Linker and HA1 protein are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

3. The method for preparing the Escherichia coli biomimetic vesicle presenting H9 subtype avian influenza virus HA1 protein according to claim 2, characterized in that: ClyA and H9N2 AIV HA1 protein were connected in series through Linker, the ribosome binding site was fused to the N-terminus of the ClyA sequence to promote the expression of the fusion protein, the 6×his tag was fused to the C-terminus of the HA1 sequence, and the ClyA-HA1 sequence was inserted between the EcoRⅠ and HindⅢ restriction sites in the pBAD18-Cm vector using T4 ligase to construct the pBAD18-ClyA-HA1 recombinant plasmid; the ribosome binding site sequence is shown in SEQ ID NO.

4.

4. The method for preparing the Escherichia coli biomimetic vesicle presenting H9 subtype avian influenza virus HA1 protein according to claim 3, characterized in that: The primers for constructing the pBAD18-ClyA-HA1 recombinant plasmid are shown in SEQ ID NOs. 11 to 14.

5. The method for preparing the Escherichia coli biomimetic vesicle presenting H9 subtype avian influenza virus HA1 protein according to claim 2, characterized in that: The vesicle donor is a defective bacterium ΔtolA-ΔaraD of Escherichia coli of serotype O78; the araD gene of the vesicle donor is knocked out by λ-Red homologous recombination technology.

6. The method for preparing the Escherichia coli biomimetic vesicle presenting H9 subtype avian influenza virus HA1 protein according to claim 5, characterized in that: The primers for the targeting fragment for knocking out the araD gene are shown in SEQ ID NOs. 5 and 6.

7. The method for preparing the Escherichia coli biomimetic vesicle presenting H9 subtype avian influenza virus HA1 protein according to claim 5, characterized in that: The identification primers of the O78 serotype Escherichia coli defective bacteria ΔtolA-ΔaraD are shown in SEQ ID NOs. 7 to 10.

8. A recombinant biomimetic vesicle, characterized in that: Prepared by the method described in claims 2 to 7.

9. Use of the fusion protein according to claim 1, the methods according to claims 2 to 7, or the recombinant biomimetic vesicle according to claim 8 in preparing an agent for preventing and treating H9 subtype avian influenza virus and O78 serotype Escherichia coli infection.

10. The use according to claim 9, characterized in that: The recombinant bionic vesicle is used to inhibit the detoxification of H9 subtype avian influenza virus in the chicken larynx and cloaca, reduce the bacterial load in the chicken infected with O78 serotype Escherichia coli, and alleviate the degree of inflammation of the air sac and heart.

Images