Rice HDA19 gene and its application in controlling the development of leaf sheath and leaf angle
By regulating the expression of the rice HDA19 gene and using RNAi technology to alter leaf pulvinus development and leaf angle, the problem of leaf shape control in existing technologies has been solved, thereby increasing rice yield.
Patent Information
- Application Number
- CN202411565334.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-05
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-11-05
AI Technical Summary
Existing technologies are insufficient to effectively control the development of rice leaf pillows and the size of leaf angles, which affects photosynthetic efficiency and yield improvement.
By regulating the expression level of the rice HDA19 gene, the characteristics of leaf pulvinus development and leaf angle can be altered by using RNAi technology to silence or overexpress the HDA19 gene.
It significantly alters the leaf angle, improves photosynthetic efficiency, enhances light-harvesting capacity, and promotes increased rice yield.
Smart Images

Figure CN119331880B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the rice HDA19 gene and its application in controlling leaf pulvinus development and leaf angle size. Background Technology
[0002] Rice (Oryza sativa) is one of the world's major food crops, with nearly half the population relying on it as their primary food source. China is not only a major rice producer but also a major consumer. With continued population growth and decreasing arable land, increasing grain yield per unit area has become a critical issue that urgently needs to be addressed. Significant progress has been made in national science and technology investment, providing support for the research and development of superior rice varieties. Simultaneously, by rationally controlling row and plant spacing, and making full use of limited land resources, reasonable dense planting can be achieved under different ecological environments, thereby increasing the leaf area index and significantly improving rice yield.
[0003] Leaf shape directly affects the efficiency of photosynthesis and light energy utilization; therefore, the growth and yield of rice are closely related to its morphological characteristics. A plant's leaf shape not only determines its plant structure but also influences crop yield to a certain extent, with leaf angle being a crucial factor. Leaf angle refers to the angle between the leaf blade and the stem, or the degree of curvature between the leaf blade and the leaf sheath. This agronomic trait has a significant impact on plant architecture and grain yield. An upright leaf morphology enhances the light-harvesting capacity for photosynthesis and increases planting density, thereby improving the leaf area index. These factors collectively contribute to increased rice yield. Therefore, optimizing rice leaf shape characteristics will provide an effective way to achieve high-yield goals. Summary of the Invention
[0004] The purpose of this invention is to provide the HDA19 gene and its application in controlling the development of rice leaf pillow and the size of leaf angle.
[0005] The rice HDA19 gene, wherein the polynucleotides of the HDA19 gene are shown in (a), (b), (c), or (d):
[0006] (a) a polynucleotide as shown in SEQ ID No: 1; or
[0007] (b) A polynucleotide whose complementary sequence to SEQ ID No: 1 can hybridize under strict hybridization conditions, and the protein encoded by the polynucleotide still has the function of controlling leaf pulvinus development and leaf angle.
[0008] (c) A polynucleotide having at least 90% or more homology with the polynucleotide shown in SEQ ID No: 1; or
[0009] (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, wherein the protein encoded by the polynucleotide mutant still has the function of controlling leaf pulvinus development and leaf angle.
[0010] Rice HDA19 protein, wherein the amino acid sequence of the HDA19 protein is shown in (a), (b), or (c):
[0011] (a) The amino acid sequence as shown in SEQ ID No: 2 of the sequence listing; or
[0012] (b) Amino acids that are at least 90% homologous to the amino acid shown in SEQ ID No: 2; or
[0013] (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids based on the protein shown in SEQ ID No: 2, and the protein still has the function of controlling leaf pulvinus development and leaf angle.
[0014] A vector containing the rice HDA19 gene.
[0015] Engineered bacteria containing the rice HDA19 gene vector.
[0016] Primers for amplifying any segment of the rice HDA19 gene.
[0017] The application of the rice HDA19 gene in controlling rice leaf pillow development and leaf angle size.
[0018] A method to increase the leaf angle in rice to reduce the expression level of HDA19 protein in rice.
[0019] A method to reduce the leaf angle in rice to increase the expression level of HDA19 protein in rice.
[0020] The beneficial effects of this invention are as follows: This invention is the first to identify that HDA19 gene expression can significantly control the development of the leaf pulvinus and the size of the leaf angle in rice. Mutations in the rice HDA19 protein increase the length of the leaf pulvinus, increase cell size, and increase the leaf angle; while overexpression of the rice HDA19 protein shortens the length of the leaf pulvinus, decreases cell size, and decreases the leaf angle. The protein and its encoding gene of this invention have important theoretical and practical significance for improving plant density and crop yield, and will play an important role in crop genetics and breeding, with broad application prospects. Attached Figure Description
[0021] Figure 1 Obtained as a rice HDA19 gene-silencing line;
[0022] In the figure, a represents the HDA19 gene silencing site; b represents the change in HDA19 gene expression level before and after silencing.
[0023] Figure 2 The expression level of HDA19 in the overexpression line.
[0024] Figure 3 The whole plant phenotype of rice mutants and overexpressing plants.
[0025] Figure 4 The leaf angle of rice mutants and overexpressing plants;
[0026] In the figure, a represents the phenotype; b represents the data statistics.
[0027] Figure 5 The dorsal lateral leaf phenotype of rice mutants and overexpressing plants.
[0028] Figure 6 The result is the measurement of the dorsal side length of the leaf bolus.
[0029] Figure 7 Longitudinal section of the dorsal side of the leaf pulvinus (a) and cell length analysis (b). Detailed Implementation
[0030] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0031] Example 1: Obtaining rice HDA19 gene-silenced lines
[0032] The 339-540bp and 651-667bp sequences of the HDA19 (Os06g38470) gene were selected as gene silencing sites (e.g., Figure 1 a) Design primers with specific restriction enzyme sites for PCR amplification of the sense and antisense strand fragments, namely HDA19-RNAi-F1(KpnI):
[0033] CGGGGTACCCCCCGTCTTCGACGGCCTCTA (SEQ ID No: 3), HDA19-RNAi-R1 (XbaI): TGCTCTAGACCTCCTCCACACCATCCCCATG (SEQ ID No: 4), HDA19-RNAi-F2 (PstI):
[0034] AAACTGCAGCCCCGTCTTCGACGGCCTCTA (SEQ ID No: 5), HDA19-RNAi-R2 (XbaI): TGCTCTAGACTGGTGGTATTTGAGGAGCTCGAG (SEQ ID No: 6). Specific experimental procedures were referenced from Baulcombe, D (Baulcombe, D. RNA silencing in plants. Nature 431, 356-363 (2004)). The constructed vector was transformed into Nippon Haru-Chung (contracted to the Institute of Crop Science, Chinese Academy of Agricultural Sciences) using Agrobacterium-mediated transgenic methods, resulting in three independent HDA19 gene-silencing lines. The gene silencing effect was evaluated by qRT-PCR using Intron-130-F: GTTCTCTCGCGCTGGAGAGC (SEQ ID No: 7), Intron-130-R: CCACACCATCCCCATGGTG (SEQ ID No: 8). Figure 1 b. The expression level of the HDA19 gene in the silenced rice lines was significantly lower than that in the wild type.
[0035] Example 2: Obtaining HDA19 overexpression materials
[0036] Using Nipponbare rice as the background material, the CDS sequence of HDA19 was cloned using PCR amplification technology. This sequence was then ligated into the pCAMBIA1300 vector via restriction enzyme digestion and ligation. The restriction enzyme sites were KpnI and SalI. The primers used were HDA19-CDS-F: CGGGGTACCATGGACGCCTCCGCCGGA (SEQ ID No: 9), and HDA19-CDS-R: CGCGTCGACTTATGTCTTCTGGTGCACCGATG (SEQ ID No: 10). After successful sequencing, transgenic plants were obtained using Agrobacterium-mediated transgenic methods (commissioned to the Institute of Crop Science, Chinese Academy of Agricultural Sciences). The rice lines identified as positive and exhibiting high gene expression levels were named HDA19-OE-1, HDA19-OE-2, and HDA19-OE-3, respectively. All HDA19-OE lines used in this example were homozygous transgenic lines. After 14 days of pot culture, RNA was extracted from the aboveground parts of rice plants where the HDA19 gene was silenced and reversed. The expression level of HDA19 was detected using primers: ACTIN-qRT-F: TGACGGAGCGTGGTTACTCAT (SEQ ID No: 11), ACTIN-qRT-R: GCATGCCAGGGAACATAGTG (SEQ ID No: 12), HDA19-qRT-F: AGAACACCAAGGGCACAGAA (SEQ ID No: 13), and HDA19-qRT-R: AGGGAGCCTGGTTCGTCTAT (SEQ ID No: 14). Figure 2 The results showed that the expression level of HDA19 in overexpressing plants was significantly higher than that in wild-type plants, with the highest relative expression level of HDA19 gene in HDA19-OE-1.
[0037] Example 3 Phenotypic Identification of Rice Mutants and Overexpression Materials
[0038] The obtained rice HDA19 gene silencing mutant and overexpressing plants were cultured in pots for 50 days, and their phenotypes were observed. The whole plant was compared with... Figure 3 Randomly select individual rice plants of various types for photography. Figure 4 a) with the pulvinus as the intersection point, and the leaf sheath and blade each as one side line ( Figure 4 (a) The white dashed line area was used, and the angle between the fourth leaf at the tip of the main tiller was measured and statistically analyzed using ImageJ software. Figure 4 (b) It was found that the HDA19 mutant material exhibited a significantly increased leaf angle phenotype compared to the wild type, while the material overexpressing the gene clearly showed a decreased leaf angle phenotype. This indicates that HDA19 can alter the leaf angle in rice.
[0039] Example 4: Observation of leaf pulvinus development in rice mutants and overexpression materials
[0040] The leaf pulvinus was cut from the rice seedling, and its length on the dorsal side was observed and measured under a microscope. Figure 5 (Position of the double-headed arrow), the analysis results are as follows: Figure 6 The mutants were found to have significantly longer leaf pulvinus lengths than the wild type, while the overexpressing plants had significantly shorter leaf pulvinus lengths than the wild type. Longitudinal sections of the dorsal side of the leaf pulvinus were prepared and cell morphology was observed under a UV microscope. Figure 7 a) Cell length was measured and analyzed using the software included with the microscope. Figure 7 b) It was found that the mutant cells were larger than the wild type, while the overexpression lines had more cells, smaller cells, and more compact arrangement compared to the wild type.
[0041] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A method of reducing leaf angle in rice, comprising, The application discloses a method for improving the expression level of HDA19 protein in rice, and the amino acid sequence of the HDA19 protein is shown as SEQ ID No: 2.
Citation Information
Patent Citations
Transgenic Plant With Increased Stress Tolerance And Yield
CN104450640A