A clubroot-resistant brassica napus gene bna c09g44020d and application thereof

By locating and applying the clubroot resistance gene BnaC09g44020D, the problem of scarce resistance resources in Brassica napus has been solved, the disease resistance and yield of rapeseed have been improved, and agricultural production and environmental protection have been promoted.

CN119331883BActive Publication Date: 2026-02-06NORTHWEST A & F UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411692966.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-25
Publication Date
2026-02-06
Estimated Expiration
2044-11-25

AI Technical Summary

Technical Problem

There is a scarcity of clubroot-resistant resources in Brassica napus, and the existing sources of resistance are limited and cannot meet the actual needs, leading to reduced yields or even crop failure.

Method used

By crossbreeding clubroot-resistant Chinese cabbage and kale, the resistance gene BnaC09g44020D was located. Using whole-genome resequencing, a clubroot-resistant rapeseed gene BnaC09g44020D and its application were provided. Combined with primer combination and gene extraction methods, its resistance in Arabidopsis thaliana was verified, and it was transferred into other cruciferous crops.

Benefits of technology

It provides new genetic resources, improves the resistance of rapeseed to clubroot, reduces yield loss, lowers breeding costs, increases crop yield and quality, reduces pesticide use, and promotes sustainable agricultural development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119331883B_ABST
    Figure CN119331883B_ABST
Patent Text Reader

Abstract

The application discloses a kind of clubroot-resistant brassica napus genes BnaC09g44020D and its application, it is related to gene screening and its application technical field, its technical points are: the nucleotide sequence of the clubroot-resistant brassica napus gene BnaC09g44020D is SEQ ID No.1;The application is identified and applied to clubroot-resistant brassica napus gene BnaC09g44020D, to solve the problem of brassica napus resource scarcity for solving clubroot-resistant brassica napus provides new way, the gene is located on C09 chromosome, can be positively regulated plant resistance to clubroot, this discovery has important significance for the breeding work of clubroot-resistant brassica napus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene screening and its application, and particularly relates to a Brassica napus gene BnaC09g44020D against clubroot and application thereof. BACKGROUND

[0002] Brassica napus L. accounts for 50% of domestic edible vegetable oil as the main source of domestic edible oil. However, clubroot (caused by Plasmodiophora brassicae) poses a serious threat to Brassica napus and other cruciferous crops, resulting in yield reduction or even complete loss.

[0003] Plasmodiophora brassicae mainly damages the root of the plant, forms a tumor, and affects the absorption of water and nutrients by the plant. The life cycle of Plasmodiophora brassicae includes three stages: the dormant spore stage, the root hair invasion stage, and the cortex invasion stage. Plasmodiophora brassicae invades plants under suitable soil temperature (18-25℃), humidity (60%-98%), and pH (5.4-6.5). The dormant spores of Plasmodiophora brassicae can survive in the soil for up to 20 years, and they are highly infectious, spread quickly, and have poor biological and chemical control effects. In addition, there is a lack of broad-spectrum antigen plants, making clubroot a global devastating soil-borne plant disease.

[0004] In terms of research on clubroot resistance genes, some clubroot-resistant genes / loci have been found in European turnip / Chinese cabbage, cabbage, black mustard, and radish. In Brassica napus, at least 28 QTLs related to clubroot resistance have been mapped to A01, A02, A03, A06, and A08 chromosomes of Chinese cabbage, of which 12 resistance QTLs are located on the A03 chromosome. The clubroot resistance in Brassica napus mainly comes from Chinese cabbage. However, the existing clubroot-resistant Brassica napus germplasm or varieties have a single source of resistance, mainly from the resistance loci on A03 and A08 chromosomes of Chinese cabbage, resulting in single disease resistance and failing to meet the actual demand.

[0005] Therefore, the present application aims to solve the problem of the scarcity of clubroot-resistant resources in Brassica napus by crossing clubroot-resistant Chinese cabbage and cabbage through distant hybridization, artificially synthesizing clubroot-resistant Brassica napus, and locating the disease-resistant gene BnaC09g44020D through whole-genome resequencing. This innovative method aims to solve the problem of the scarcity of clubroot-resistant resources in Brassica napus and cultivate excellent new varieties of Brassica napus with broad-spectrum resistance by aggregating different disease-resistant genes. This method aims to cope with the complexity and variability of Plasmodiophora brassicae, improve the yield and quality of Brassica napus, and ensure the safety of the national edible oil supply. SUMMARY

[0006] The application aims to solve the above problems, and provides an anti-plasmodiophora brassicae brassica gene BnaC09g44020D and an application thereof, so as to solve the problems of scarce anti-plasmodiophora brassicae brassica resources, single existing resistance source and inability to meet actual needs in brassica.

[0007] In order to achieve the above purpose, the technical scheme of the application is as follows: an anti-plasmodiophora brassicae brassica gene BnaC09g44020D, wherein the nucleotide sequence of the anti-plasmodiophora brassicae brassica gene BnaC09g44020D is SEQ ID No. 1.

[0008] Further provided in the application is that the gene is located on the C09 chromosome and can positively regulate the resistance of plants to the clubroot.

[0009] Further provided in the application is that the gene plays an important role in the breeding of anti-plasmodiophora brassicae brassica.

[0010] Another purpose of the application is to provide a primer combination for identifying the anti-plasmodiophora brassicae brassica gene BnaC09g44020D, wherein the primer combination comprises BnaC09g44020D-F and BnaC09g44020D-R, the sequence of the BnaC09g44020D-F is SEQ ID No. 2, and the sequence of the BnaC09g44020D-R is SEQ ID No. 3.

[0011] Still another purpose of the application is to provide a method for extracting the anti-plasmodiophora brassicae brassica gene BnaC09g44020D, comprising the following steps:

[0012] (a) extracting genomic DNA of brassica;

[0013] (b) using the genomic DNA as a template and performing PCR amplification by using specific primers to obtain a reaction product;

[0014] (c) purifying the reaction product to obtain a purified product;

[0015] (d) cloning the purified product, transforming it into an E. coli competent cell by using a heat shock method, and then culturing to obtain a bacterial liquid;

[0016] (e) identifying the bacterial liquid to confirm the presence of the gene.

[0017] Still another purpose of the application is to provide a method for cultivating anti-plasmodiophora brassicae brassica by using the gene BnaC09g44020D, comprising the following steps:

[0018] S1: Construct the CDS sequence of BnaC09g44020D in the disease-resistant parent into a 2*CaMV 35S overexpression vector;

[0019] S2: Infect wild-type Arabidopsis to obtain an Arabidopsis strain overexpressing BnaC09g44020D;

[0020] S3: Observe the resistance of the Arabidopsis overexpressing BnaC09g44020D to clubroot to verify the effect of the BnaC09g44020D gene on clubroot resistance.

[0021] Still another object of the present application is an application of using the BnaC09g44020D gene to improve the ability of plants to resist clubroot, by genetically engineering the BnaC09g44020D gene into other Brassicaceae crops to improve the resistance of these crops to clubroot.

[0022] The present application further provides that the Brassicaceae plant is Brassica napus, Arabidopsis thaliana, Chinese cabbage or cabbage.

[0023] Compared with the prior art, the present application has the beneficial effects that the BnaC09g44020D gene for resisting clubroot in Brassica napus and its application provided by the present application have significant beneficial effects, which not only enhance the disease resistance of Brassica napus itself, but also have a profound impact on agricultural production and food safety.

[0024] Firstly, by locating the BnaC09g44020D gene on chromosome C09, the present application provides a new genetic resource for Brassica napus, which helps to break the limitations of existing resistance resources. The discovery and application of this new gene can significantly improve the ability of Brassica napus to resist clubroot and reduce yield loss caused by diseases, thereby playing an important role in ensuring the safety of national edible oil supply.

[0025] Secondly, the primer combination and gene extraction method provided by the present application provide researchers and breeding experts with a fast and accurate tool for identifying and extracting the BnaC09g44020D gene. The standardization of this method helps to improve the efficiency of breeding work, speed up the development process of new varieties, and also reduces the cost of breeding.

[0026] Further, the present application verifies the potential of the BnaC09g44020D gene to express in different plants by transferring the BnaC09g44020D gene into Arabidopsis and testing its resistance. This method not only confirms the function of the BnaC09g44020D gene, but also demonstrates its application prospects in other Brassicaceae crops, providing the possibility for breeding a wider variety of clubroot-resistant crops.

[0027] Finally, the implementation of the present application helps to reduce the use of pesticides by improving the disease resistance of crops, which is of great significance to environmental protection and sustainable development of agriculture. At the same time, the cultivation of disease-resistant crops also helps to improve the economic benefits of farmers, as it reduces economic losses due to diseases and improves the overall yield and quality of crops.

[0028] In summary, the present application not only provides new resources of resistance to clubroot in science, but also has a positive impact on agricultural production, food safety, environmental protection and agricultural economy through improving the disease resistance of crops in practical application. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 is a schematic diagram of the positioning of the clubroot resistance site in the embodiment of the present application;

[0030] Figure 2 is a schematic diagram of the identification of the clubroot resistance of the BnaC09g44020D strain of Arabidopsis thaliana in the embodiment of the present application;

[0031] A: the clubroot symptoms of wild-type Arabidopsis thaliana 30 days after inoculation with Plasmodiophora brassicae; B and C: the clubroot symptoms of Arabidopsis thaliana overexpressing BnaC09g44020D 30 days after inoculation with Plasmodiophora brassicae; D: statistical data of disease index of different materials. DETAILED DESCRIPTION

[0032] In order to enable those skilled in the art to better understand the present application, the technical solutions of the present application will be further described in detail below with reference to the embodiments of the present application and the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor should belong to the scope of protection of the present application.

[0033] It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below with reference to the embodiments.

[0034] Embodiment 1: A clubroot-resistant Brassica napus gene BnaC09g44020D, the nucleotide sequence of the clubroot-resistant Brassica napus gene BnaC09g44020D is SEQ ID No. 1, the gene is located on chromosome C09, and can positively regulate the resistance of plants to clubroot.

[0035] I. Inoculation of Plasmodiophora brassicae

[0036] The seeds to be detected are placed on moist filter paper and allowed to germinate. After about three or four days, seedlings with uniform growth are selected and transplanted into a mixture of nutrient soil, perlite and vermiculite in a ratio of 3:1:1. When the seedlings reach the three-leaf stage, 5 ml of a root knot fungus suspension at a concentration of 1 x 10 7 spores / ml is injected into the base of the plant roots using a syringe.

[0037] The preparation process of the root knot fungus spore suspension is as follows: take the diseased root knot tissue, soak it in water overnight, then cut it into small pieces and crush it with a sample grinder. The crushed sample is filtered using eight layers of gauze to remove plant tissue, obtaining a liquid containing dormant spores of the root knot fungus. The supernatant is removed by centrifugation, leaving the precipitated dormant spores. The spores are resuspended with an appropriate amount of water according to the size of the root knot, the concentration of the spore solution is detected using a hemocytometer, and then diluted to a concentration of 1 x 10 7 spores / ml.

[0038] The inoculation method is the same for the resistant parent, F1 and F2 populations used in the experiment. After inoculation with the root knot fungus, a 40-day observation period is carried out, and the resistance phenotype is determined by checking whether root knots have formed on the roots of the plants. The observation results are usually displayed in the form of a chart, as shown in Figure 2 The above method provides an experimental procedure for evaluating the resistance of plants to root knot disease, which is helpful for the research and cultivation of plant varieties resistant to root knot disease.

[0039] II. Extraction of genomic DNA

[0040] 1) Take a fresh and tender plant leaf the size of a thumb, grind it thoroughly into powder in liquid nitrogen

[0041] 2) Move the powder into a 2 ml centrifuge tube, add 500 μl of preheated CTAB solution at 65°C, mix thoroughly, and incubate in a 65°C water bath for 1 h, shaking and mixing once every ten minutes

[0042] 3) After the water bath, add 500 μl of chloroform / isoamyl alcohol solution (24:1), mix gently, and stand at room temperature for 10 min, then centrifuge at 10,000 r / min for 10 min.

[0043] 4) Take the supernatant and add an equal volume of isopropanol, stand until a precipitate is formed, and centrifuge at 10,000 r / min for 10 min.

[0044] 5) After discarding the supernatant, rinse the precipitate with 70% ethanol for two to three times, then invert the centrifuge tube and air dry naturally, dissolve with an appropriate amount of ddH2O, and store in a -20°C refrigerator.

[0045] III. Vector construction

[0046] The sequence of the candidate gene was analyzed, and Primer Premier 5.0 was used to design the forward and reverse primers BnaC09g44020D-F / R which could cover the full length of the gene with a high score, wherein BnaC09g44020D-F: CTGACTCTAGCAGATCTATGGAAGGATATGATGG; BnaC09g44020D-R: TTGCCCATGGCTCTAGAAAAAGAAGAGTAGATTTGCA; the primers were amplified from the gene DNA as a template by using high-fidelity enzyme (Novagen, P505),

[0047] The reaction system was as follows: 2x Phanta Max Buffer (containing Mg 2+ , final concentration 2 mM): 25 μl,

[0048] dNTP Mix (10 mM each): 1 μl, 2 μl of forward and reverse primers,

[0049] Phanta Max Super-Fidelity DNA Polymerase: 1 μl,

[0050] Template DNA (concentration 50-100 ng / μl): 1 μl, ddH2O: 18 μl.

[0051] The reaction procedure was as follows: pre-denaturation 95 °C for 3 min, denaturation 95 °C for 15 s, annealing for 15 s, extension 72 °C for 30-60 sec / kb, and complete extension 72 °C for 5 min, 35 cycles from denaturation to extension.

[0052] The product after the reaction was determined by agarose gel electrophoresis, and then the target band was cut off and purified and recovered by using a gel recovery kit (Omega, D2500-01), and the approximate process was as follows: Binding Buffer (1 g / ml) was added to the gel block, and the gel block was completely dissolved in a 60 °C water bath, and then the liquid was transferred to a HiBindTM DNA column, and centrifuged at 10000xg for 1 min at room temperature; the waste liquid in the collection tube was discarded, and 300 μl of Binding Buffer HiBind was added, and centrifuged at 10000xg for 1 min at room temperature; after the waste liquid was discarded, 700 μl of SPW Wash buffer HiBind DNA column was added, and centrifuged at 10000xg for 1 min at room temperature, and repeated twice; the waste liquid was discarded, and the column was centrifuged at 10000xg for 1 min at room temperature; the column was placed in a new 1.5 ml centrifuge tube, 50 μl of eluent was added, and centrifuged at 10000xg for 1 min.

[0053] TA cloning of the purified product, using heat shock method to transform into E. coli competent cells: TA cloning product into E. coli competent on ice, 30 min after 42°C water bath 60 s, placed on ice 2 min, 500 μl of no-antibiotic LB liquid medium 37°C recovery 40 min, then pipette 200 μl of bacteria evenly coated in the LB solid medium with kanamycin, 37°C overnight culture, picking out the single colony grown in the liquid medium with kanamycin 37°C incubator 4-5 h, the bacteria liquid PCR identification of positive single colony, the positive single colony to the GenScript Corporation for first sequencing can get the sequence of the target gene.

[0054] Example 2: Plasmid extraction and Agrobacterium transformation

[0055] The positive recombinant vector obtained was extracted for plasmid extraction for long-term preservation. The plasmid extraction kit (Tiangen, DP103) was used. First, the bacteria liquid cultured at 37°C overnight was enriched, then Buffer P1, Buffer P2 and Buffer P3 were added to resuspend, lyse and precipitate the bacteria, the first step needed to be resuspended thoroughly, and the last two steps needed to be mixed slightly. The obtained liquid was transferred to the adsorption column, centrifuged at 10000 r / min for 1 min, the supernatant was discarded, 500 μl of deproteinization liquid PD was added and centrifuged at 10000 r / min for 1 min, the supernatant was discarded, 700 μl of rinse liquid was added and centrifuged at 10000 r / min for 1 min, the rinse was repeated twice, the supernatant was discarded, and the adsorption column was centrifuged at 10000 r / min for 2 min. 50 μl of ddH2O was added to the adsorption column and left for two minutes, then a new 1.5 ml centrifuge tube was used to collect the plasmid.

[0056] The freeze-thaw method was used for Agrobacterium transformation, and the basic steps were as follows: not more than 1 μg of plasmid was added to Agrobacterium competent cells GV3101 strain, and left on ice for 5 min, then quickly frozen in liquid nitrogen for 5 min, 37°C water bath for 5 min, and left on ice for 2 min. 500 μl of no-antibiotic YEP liquid medium was added and incubated at 28°C for 2-3 h, and 200 μl of uniform bacteria was coated on YEP solid medium with rifampicin, gentamicin and kanamycin resistance. After two days, single colonies were picked and subjected to bacteria liquid PCR identification, and the positive Agrobacterium was added with 50% glycerol (v:v, 2:1), mixed and stored at -80°C for standby use.

[0057] Example 3: Agrobacterium-mediated Arabidopsis transformation

[0058] The agrobacterium is cultured overnight at 28℃ in a shaker to a bacterial liquid OD value between 0.8-1.2, 5000xg centrifugal enrichment for 5min, then resuspended with 5% sucrose solution, add 2-5ppm surfactant (selwet-77), use gun head to suck the bacterial liquid and hit the unopened flower of Arabidopsis, after a few minutes, wipe the bacterial liquid and carry out 16-24h dark culture, and then obtain positive seeds after 20-30 days.

[0059] The above specific embodiments are only an explanation of the present application, and are not a limitation of the present application, and those skilled in the art can make modifications to the embodiments without creative contribution according to the needs after reading the specification, but as long as within the scope of the claims of the present application, it is protected by the patent law.

Claims

1. A method for improving the resistance of a plant to clubroot disease by using the gene BnaC09g44020D, characterized in that: The nucleotide sequence of the anti-clubroot brassica napus gene BnaC09g44020D is SEQ ID No. 1, and the method comprises the following steps: S1: Constructing the CDS sequence of BnaC09g44020D in the disease-resistant parent into a 2*CaMV 35S overexpression vector; S2: Infecting wild-type Arabidopsis thaliana to obtain Arabidopsis thaliana strains overexpressing BnaC09g44020D; S3: Observing the resistance of Arabidopsis thaliana overexpressing BnaC09g44020D to clubroot to verify the effect of BnaC09g44020D gene on the resistance to clubroot.

2. The use of overexpression of the BnaC09g44020D gene of claim 1 to improve the ability of a plant to resist clubroot disease, characterized by: By means of genetic engineering, BnaC09g44020D gene is transferred into other cruciferous crops to improve the resistance of these crops to clubroot, and the cruciferous plants are rape and Arabidopsis thaliana.

Citation Information

Patent Citations

  • Composition for inducing plant disease damage resistance or preventing plant disease damage

    CN111818802A

  • Anti-clubroot brassica napus gene Bna.BNT1 and application thereof

    CN118497221A