Application of soybean COP9 signal complex subunit 5 protein gene GmCSN5B

Abstract

The invention discloses application of a soybean COP9 signal complex subunit 5 protein gene GmCSN5B or a promoter thereof, and relates to the technical field of gene engineering. The drought response gene GmCSN5B for coding COP9 signal complex subunit 5 protein is successfully screened by taking a cultivated soybean drought-resistant variety Dongnong 50 as a research material through transcriptomics analysis under the stress of simulated drought (8% PEG8000 water culture). Research finds that the soybean yield and the drought resistance can be improved by knocking out the gene. On one hand, the knockout GmCSN5B gene has the capabilities of improving the soybean yield and improving the drought resistance, and on the other hand, a foundation is laid for cultivation of high-yield drought-resistant soybean new germplasm and related breeding work of the high-yield drought-resistant soybean new germplasm.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a soybean COP9 signaling complex subunit 5 protein gene. GmCSN5B application. Background Art

[0002] In recent years, my country's demand for soybeans has shown an upward trend. In 2023, China's soybean consumption will be about 100 million tons, ranking first in the world, and demand is still increasing year by year. It is urgent to improve my country's soybean drought resistance, discover functional genes related to soybean drought resistance, and cultivate new drought-resistant and high-yield soybean germplasm.

[0003] The plant COP9 signaling complex (Constitutively photomorphogennic sig nalosome, CSN) and the 19S "lid" structure in the 26S proteasome have obvious similarities in amino acid sequence and three-dimensional structure. In recent years, CSN5, as the enzymatic activity center of the COP9 signaling complex, can regulate the activity of E3 ubiquitin ligases (CRLs), thereby precisely regulating plant physiological activities by regulating protein degradation, participating in hormone signal transduction and regulating organ development, ensuring the normal growth and development of plants and adapting to environmental changes. However, in soybean, the study of GmCSN5B is still in its initial stage, and many specific functions and mechanisms of action are not yet clear, which requires further in-depth exploration and research to reveal its more detailed role and regulatory network in plant life activities. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention discloses a soybean COP9 signaling complex subunit 5 protein gene GmCSN5B The inventor discovered that GmCSN5B Gene knockout soybean materials have improved soybean drought resistance and yield, laying the foundation for breeding new drought-resistant and high-yield soybean germplasm.

[0005] The technical solution of the present invention mainly includes the following contents: GmCSN5B Gene or GmCSN5B Application of gene promoter in regulating plant yield and / or drought resistance, the GmCSN5B The gene is derived from soybean "Dongnong 50", and its nucleotide sequence is the sequence shown in SEQ ID NO.1 or its complementary sequence and reverse sequence, and the promoter sequence is shown in SEQ ID No.2.

[0006] The plants include soybeans.

[0007] Furthermore, the application is to increase soybean yield and soybean drought resistance.

[0008] Further, the application is: by knocking out GmCSN5B Genes to improve soybean drought resistance and soybean yield.

[0009] Furthermore, the increasing soybean yield is: increasing soybean yield under normal conditions.

[0010] Furthermore, the present invention provides a method for cultivating high-yield soybean varieties, comprising the following steps: Using CRISPR-Cas9 technology to construct soybean GmCSN5B Gene knockout vector, soybean GmCSN5B The gene knockout vector was transformed into Agrobacterium, and the soybean was genetically transformed using the Agrobacterium-mediated method to obtain the knockout gene. GmCSN5B Genetic high-yield soybean variety; the soybean GmCSN5B The nucleotide sequence of the gene is the sequence shown in SEQ ID NO.1 or its complementary sequence or reverse sequence.

[0011] The present invention also provides a method for cultivating drought-resistant soybean varieties, comprising the following steps: Using CRISPR-Cas9 technology to construct soybean GmCSN5B Gene knockout vector, soybean GmCSN5B The gene knockout vector was transformed into Agrobacterium, and the soybean was genetically transformed using the Agrobacterium-mediated method to obtain the knockout gene. GmCSN5B Genetic drought-resistant soybean variety; the soybean GmCSN5B The nucleotide sequence of the gene is the sequence shown in SEQ ID NO.1 or its complementary sequence or reverse sequence.

[0012] Beneficial effects of the present invention: The present invention found soybean GmCSN5B The gene negatively regulates drought tolerance and yield in soybean. Compared with the wild type, the knockout GmCSN5B The drought tolerance and yield of genetically modified soybeans were significantly enhanced.

[0013] The present invention lays a foundation for cultivating new soybean germplasm with drought resistance and high yield and related breeding work, and is beneficial to promoting soybean variety improvement work. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :Soybean GmCSN5B PCR amplification results of the (1230bp) gene cDNA and promoter (1599bp) cloned fragments; wherein, A: GmCSN5B Gene cDNA cloning; B: GmCSN5B Gene promoter cloning.

[0015] Figure 2 : GmCSN5BGene expression analysis and promoter activity analysis; A: soybean CSNs Gene family tissue expression analysis; B: Overexpression GmCSN5B Identification of GUS activity of transgenic Arabidopsis thaliana promoter; C: 300 mMMannitol (mannitol) stress induced transgenesis at different time points GmCSN5B Gene promoter activity in Arabidopsis thaliana.

[0016] Figure 3 : Knockout GmCSN5B Editing status and expression level identification of transgenic soybean; A: knockout GmCSN5B Identification of genetically modified soybean genome editing, B: knockout GmCSN5B Identification of transgenic soybean expression levels.

[0017] Figure 4 : Knockout GmCSN5B Functional identification of drought resistance of transgenic soybeans with knockout gene under drought stress (pot height: 7 cm), NBT, DAB staining and yield determination; A: knockout GmCSN5B Phenotypic identification of transgenic soybean under drought stress; B: knockout GmCSN5B NBT staining of transgenic soybean with knockout gene; C: GmCSN5B DAB staining of transgenic soybeans.

[0018] Figure 5 :Knockout of potted plants during the whole growth period GmCSN5B Genetic soybean yield determination; A: full growth period potted phenotype; B: full growth period seed phenotype; C: full growth period potted knockout GmCSN5B Determination of 100-grain weight of transgenic soybeans with the gene; D: Knockout of potted plants during the whole growth period GmCSN5B Determination of single-plant grain weight of genetically modified soybeans. DETAILED DESCRIPTION

[0019] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0020] Example 1 Extraction of RNA and DNA from soybean "Dongnong 50" (1) Sowing soybean "Dongnong 50" into a culture pot, and when it grows to the R3-R4 period, taking the root, stem, leaf, and flower tissues of the growing soybeans, and extracting RNA from different soybean tissues. The extraction steps are as follows: 1) Pre-cool the mortar with liquid nitrogen, add the sample into the mortar, wear multiple layers of gloves, and grind continuously until the liquid nitrogen evaporates completely, repeat this process three times; 2) After adding 1 mL RNAiso plus (manufacturer: Takara) and homogenizing, let it stand at room temperature for 5 min, and centrifuge at 12000 g for 5 min at 4°C; 3) Transfer the supernatant to a new 1.5 mL centrifuge tube, add 200 mL of chloroform, let stand at room temperature for 5 min, and centrifuge at 12000g at 4°C for 15 min; 4) Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol, invert and mix, let stand at room temperature, and centrifuge at 12,000 g at 4°C for 10 min; 5) Add 1 mL of 75% ethanol to the precipitate to wash it, centrifuge at 12000 g for 5 min at 4°C, and discard the supernatant; 6) After opening and drying, dissolve in an appropriate amount of DEPC water and measure the concentration; 7) Dilute the RNA to a concentration of 100-200 ng / uL and run electrophoresis. Store the RNA in a -80℃ refrigerator.

[0021] (2) Sowing soybeans of "Dongnong 50" into culture pots, and when they grow to the R3-R4 period, taking leaves of the growing soybeans to extract soybean DNA, the extraction steps are as follows: 1) Take 0.2 g of leaves and put them into a 1.5 mL centrifuge tube, add 200 μL of TPS extract (100 mL formula: 1M Tris-HCl 10mL, 0.5M EDTA 2mL, 5M KCl 50mL, ddH2O 38mL), and crush them with a 1 mL pipette tip; 2) Place the crushed leaves in a 75°C water bath for 20 min, then centrifuge at 12,000 rpm for 10 min; 3) Take the supernatant and place it in a new centrifuge tube, add an equal volume of isopropanol, and centrifuge at 5000 rpm for 10 min; 4) Discard the supernatant, add 200 μl 70% ethanol to the precipitate, and centrifuge at 5000 rpm for 5 min; 5) Discard the supernatant, dry the precipitate, and add 40 μL of sterile water to dissolve the DNA.

[0022] Note: In order to precipitate DNA and dissolve impurities such as lipids and proteins, isopropanol / ethanol is added. Isopropanol has a stronger ability to precipitate DNA, but it is not as strong as ethanol in dissolving impurities. Therefore, adding isopropanol first and then ethanol is more effective. Tris-HCl provides a buffer environment to prevent nucleic acids from being damaged. EDTA: chelates Mg 2+ or Mn 2+ ions, inhibiting DNAase activity.

[0023] Example 2 Cloning of soybean GmCSN5B gene and promoter The RNA extracted from different tissues was reverse transcribed and quantified.

[0024] Table 1 Reverse transcription system (first step)

[0025] Table 2 Reverse transcription system (second step)

[0026] Note: The above 5× gDNA Eraser Buffer and other reagents are commercially available products.

[0027] The total volume of the first step reaction was 10 μL, and the conditions were: incubation at 42°C for 2 min or at room temperature for 5 min; the total volume of the second step reaction was 20 μL, and the conditions were: 37°C for 15 min, 85°C for 5 s, and 4°C. Storage: The cDNA obtained by reverse transcription was stored in a -20°C refrigerator.

[0028] Using cDNA from different tissues of soybean "Dongnong 50" as template, GmCSN5B The gene was cloned, and the cloning primers GmCSN5B-F: ATGCAAGGCAAAGAAATGGAA (SEQ ID NO.3), GmCSN5B-R: TCAACTTTCAATCATTGGTTCG (SEQ ID NO.4), the PCR system is shown in Table 3, and the PCR program is 95℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 30 s, a total of 35 cycles, and 72℃ post-extension for 8 min. After the PCR product was detected by agarose gel electrophoresis, it was connected to the cloning vector pEASY-T1 (purchased from Quanshijin Biotechnology Co., Ltd.) to generate pEASY-GmCSN5B and then sequenced. The sequencing results are shown in SEQ ID No.1.

[0029] Using the DNA of soybean "Dongnong 50" as a template, the soybean GmCSN5B The promoter of the gene (extension time 2 min) was cloned. The cloning primers were proGmCSN5B-F: GTGTGTATGAGGTTCAGCC (SEQ ID NO.5), proGmCSN5B-R: ATTGCAGCACTTGGACCAG (SEQ ID NO.6). The PCR product was detected by agarose gel electrophoresis and connected to the cloning vector pEASY-T1 (purchased from Quanshijin Biotechnology Co., Ltd.) to generate pEASY-proGmCSN5B, which was then sequenced. The sequencing results are shown in SEQ ID No.2.

[0030] Table 3 GmCSN5B Gene and promoter PCR system

[0031] Example 3 Soybean GmCSN5B Construction of gene expression vector and stable genetic transformation of soybean 3.1 Soybean GmCSN5B Construction of pCRISPR-Cas9 vector right GmCSN5B The gene was designed by sgRNA target site through http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR website, and the knockout vector pCRISPR was constructed through StuⅠ and XbaⅠ sites to obtain the plant expression vector of knockout pCRISPR-GmCSN5B, which was transformed into EHA105 Agrobacterium for stable genetic transformation of soybean to obtain the knockout GmCSN5B of genetically modified soybeans.

[0032] 3.2 Soybean GmCSN5B Construction of gene promoter pCAMBIA3301-proGmCSN5B-GUS vector The pEASY-proGmCSN5B cloning vector was used for subcloning after successful sequencing (system is shown in Table 3). After the PCR product was detected by agarose gel electrophoresis, it was connected to the plant expression vector pCAMBIA3301-GUS using homologous recombination technology to generate pCAMBIA3301-proGmCSN5B-GUS and then sequenced. The sequencing result was the same as SEQ ID No.2.

[0033] Example 4 Soybean GmCSN5B Genetic transformation of Arabidopsis thaliana mediated by gene promoter Arabidopsis seeds were vernalized in a dark refrigerator at 4 degrees for 3 days, and then planted in a vermiculite-to-soil ratio of 8:2. When they grew to the 2-4 leaf stage, they were selected and transplanted to the pots for infection. After transplanting, they were cultured in the dark for 1-2 days. When Arabidopsis grew to the flowering stage, the blooming flowers and seeds were removed, leaving the buds for infection. 1) First, the pCAMBIA3301-proGmCSN5B-GUS recombinant plasmid constructed in Example 3 was transferred into the EHA105 Agrobacterium tumefaciens competent cell, gently mixed, and allowed to stand in an ice water bath for 10 min, then quickly frozen in liquid nitrogen for 5 min, added with 800 μL of YEP liquid medium without antibiotics, cultured with shaking at 28-30°C for 2-3 h, and evenly spread on a YEP solid medium plate containing kanamycin and rifampicin antibiotics and cultured for 48 h. Finally, a single clone was picked for bacterial liquid PCR identification for subsequent Arabidopsis infection. 2) After inoculating Agrobacterium tumefaciens containing the pCAMBIA3301-proGmCSN5B-GUS recombinant plasmid in a small shaker (10 mL), inoculate the bacteria into a large shaker (35 mL) conical flask and culture at 28°C, 230 rpm for 20-24 hours. The final OD 600 The value reached 1.0-1.2; centrifuged at 4000rpm for 15 min; added Arabidopsis infection buffer (MS (Murshige and Skoog Basal Medium) salt: 4.3-4.4 g, sucrose: 100 g, B5 vitamin (1000X): 2 mL, 6-BA (1 mg / mL): 20 μL, SilwetL-77: 400 μL, 1M NaOH: 180 μL, dd H2O: 1950 mL) to dissolve the OD 600 Values ​​of 0.8–1.0 were used for infection of wild-type Arabidopsis thaliana; 3) Infect wild-type Arabidopsis thaliana with Agrobacterium tumefaciens culture medium containing the pCAMBIA3301-proGmCSN5B-GUS recombinant plasmid for 7 min, seal with plastic wrap to retain moisture, and keep in dark for 12 h overnight. Then tear off the plastic wrap, culture the Arabidopsis thaliana in low light conditions as usual, and harvest when mature.

[0034] 4) Place the harvested Arabidopsis in a dark place at 4°C for 3 days for vernalization, then plant in eight-row culture pots. When they grow to the four-leaf stage, use 1% glufosinate (Basta) to screen positive seedlings on the first, third, and fifth days.

[0035] 5) Transplant the still green seedlings into new pots. After they grow up, perform genome extraction and use pCAMBIA3301-proGmCSN5B-GUS identification primers to identify transgenic Arabidopsis thaliana. Screen out transgenic positive strains whose electrophoresis bands are consistent with the plasmid control. After maturity, collect T2 generation seeds and identify single-copy strains (satisfying the 3:1 separation ratio) for subsequent experiments.

[0036] Example 5: Under adversity stress GmCSN5B Promoter activity analysis and identification 1) The Arabidopsis thaliana transgenic with proGmCSN5B::GUS gene in Example 4 was germinated in MS medium, and at the 2-pair leaf stage, it was placed in 300 mM mannitol stress medium for 0 h, 3 h, 6 h, 9 h, 12 h, 24 h, 48 h and 72 h, with 3 replicates at each time point; 2) Take an appropriate amount of leaves or other tissues to be stained and add an appropriate amount of GUS staining solution (ready-to-use) (manufacturer: Bioss, item number: S0258) to make sure that the GUS staining solution completely immerses the tissue; 3) Incubate at 37°C for 1-24 h. As the incubation time increases, the blue color deepens. When the expression level is high, the site or locus of GUS activity appears blue or blue spots. 4) Remove the chlorophyll from the sample with 70% ethanol. Generally, the sample is immersed in ethanol for 7 hours until the negative control turns white. If the decolorization is not complete, repeat the decolorization step to completely remove the chlorophyll. The sample is stored in 70% ethanol and can be observed with the naked eye or under an optical microscope. The blue on the white background is the GUS expression site.

[0037] 5) The results show that as time goes by, soybean GmCSN5B The promoter (proGmCSN5B) was induced by drought stress and its expression increased, indicating that GmCSN5B The gene is induced by drought stress and may be related to plant drought resistance, which is a potential target for subsequent identification. GmCSN5B This lays the foundation for the drought resistance function of the gene.

[0038] Example 6 Knockout GmCSN5B Phenotypic characterization under drought stress Transgenic lines and WT (Dongnong 50) were subjected to drought stress: (1) Soybean seeds were sterilized overnight with chlorine gas after mixing sodium hypochlorite and concentrated hydrochloric acid in a volume ratio of 1:1; (2) Wash the soybeans with sterile water and plant them in nutrient soil sterilized by high temperature and high pressure, and moisturize them with 1 / 2 Hoagland solution (manufacturer: Coolable Product Number: Lot: NSP32132760); (3) Cultivate in an artificial climate chamber at 25°C and 16 h of light until the first pair of three-leaf compound leaves appear; then subject them to natural drought stress. Three days after all strains wilt for the first time, rehydrate (500 mL of 1 / 2 Hoagland solution per pot) and wait for the second stress to appear (36 days).

[0039] (4) Knockout under normal control conditions GmCSN5B The transgenic lines grew better than the WT lines and knocked out GmCSN5B The transgenic lines were more drought resistant than the WT lines. The drought resistance of the plants was tested by NBT (manufacturer: Biyuntian, catalog number: C3206) and DAB (manufacturer: Biyuntian, catalog number: P0203) for the normal control and the materials that produced phenotypes under drought stress conditions.

[0040] At the same time, this study measured the yield of various soybean potted plants cultivated under normal conditions throughout the growth period. The results showed that GmCSN5B The yield of the knockout soybean lines was significantly higher than that of wild-type soybean. GmCSN5B The gene has the important function of increasing soybean yield and regulating its drought resistance.

[0041] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. GmCSN5B Gene or GmCSN5B Application of gene promoter, GmCSN5B The nucleotide sequence of the gene is the sequence shown in SEQ ID NO.1 or its complementary sequence or reverse sequence, characterized in that: The application is: application in regulating soybean yield and / or soybean drought resistance.

2. The use according to claim 1, characterized in that: Said GmCSN5B The nucleotide sequence of the gene promoter is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that: The application is: application in improving soybean yield and / or soybean drought resistance.

4. The use according to claim 3, characterized in that: The application is: by knocking out GmCSN5B Genes to improve soybean yield and / or soybean drought resistance.

5. The use according to claim 3, characterized in that: The method of increasing soybean yield is to increase soybean yield under normal conditions.

6. A GmCSN5B The application of gene knockout vector in genetic breeding of high-yield and drought-resistant soybean is characterized in that: The gene knockout vector is constructed using CRISPR-Cas9 technology. GmCSN5B The nucleotide sequence of the gene is the sequence shown in SEQ ID NO.1 or its complementary sequence or reverse sequence.

7. A method for breeding high-yield soybean varieties, characterized in that: The following steps are involved: Constructed using CRISPR-Cas9 technology GmCSN5B Gene knockout vector GmCSN5B The gene knockout vector was transformed into Agrobacterium, and the soybean was genetically transformed using the Agrobacterium-mediated method to obtain the knockout gene. GmCSN5B Genetic high-yield soybean variety; GmCSN5B The nucleotide sequence of the gene is the sequence shown in SEQ ID NO.1 or its complementary sequence or reverse sequence.

8. A method for breeding drought-resistant soybean varieties, characterized in that: The following steps are involved: Constructed using CRISPR-Cas9 technology GmCSN5B Gene knockout vector GmCSN5B The gene knockout vector was transformed into Agrobacterium, and the soybean was genetically transformed using the Agrobacterium-mediated method to obtain the knockout gene. GmCSN5B Genetic drought-resistant soybean variety; GmCSN5B The nucleotide sequence of the gene is the sequence shown in SEQ ID NO.1 or its complementary sequence or reverse sequence.

Images