Method for removing ribosomal RNA (rRNA) in total RNA and kit thereof

Abstract

The invention provides a construction method of a ribosome-removed RNA sequencing library. The construction method comprises the following steps: S1, extracting total RNA from a sample; s2, establishing a library by using the total RNA to obtain a library; and S3, carrying out specific cleavage of a sequence derived from the rRNA by using a CRISPR system.

Description

Technical Field

[0001] The present invention relates to the field of gene sequencing, and in particular to a method for removing ribosomal RNA (rRNA) from total RNA. Background Art

[0002] Transcriptome sequencing or RNA sequencing is a powerful tool that is widely used in life science research today. However, RNA sequencing currently faces great challenges. Ribosomal RNA, or rRNA, is the most abundant type of RNA in cells, accounting for more than 80% of total RNA. Its presence makes it difficult to study other target RNAs (such as mRNA or LncRNA) in total RNA (for example, in pathogen detection, human rRNA sequences and bacterial rRNA sequences account for the vast majority of reads, and the proportion of reads that can be used for mNGS species identification is very small). If it is not removed, it will consume a lot of valuable sequencing resources. Therefore, when performing RNA sequencing, rRNA is generally removed from the total RNA before sequencing and analysis.

[0003] There are two methods for removing rRNA for transcriptome library construction in existing kits: 1. Probe capture: RNA probe combined with streptavidin magnetic beads to remove rRNA, such as Illumina's Stranded Total RNA LT-(withRibo-Zero TM Plant).Ribo-ZeroHuman / Mouse / Rat (Illumina), Ribo-MinusTM (ThermoFisher Scientific) and other commercial kits. 2. Use RNase H enzyme to specifically degrade rRNA in the rRNA-DNA probe hybrid double strand, such as rRNA Depletion Kit v2 (Human / Mouse / Rat) kit, and the methods described in patents CN 111518870A, CN 111534513A, and CN 113122533A.

[0004] However, in the above-mentioned method 1 (probe capture), there are problems of high cost, complicated operation, long process time, and high requirements for RNA starting amount and integrity. In the above-mentioned method 2 (RNase H), the operation is also complicated and the process is long (probe / primer hybridization, RNase H digestion, DNaseI digestion, RNA recovery). When using these two methods to remove rRNA, it basically takes at least 2 hours, so the time required to obtain the RNA library with rRNA removed is the general process time for library construction plus at least 2 hours. Summary of the invention

[0005] In view of the above technical problems, the present invention provides a method for removing ribosomal RNA from total RNA and a method for constructing a ribosomal RNA sequencing library. Specifically, the present invention includes the following aspects: BRIEF DESCRIPTION OF THE DRAWINGS

[0006] Figure 1 : Schematic diagram of the strategy of a specific embodiment of the present invention. DETAILED DESCRIPTION

[0007] The following describes various aspects of the present application in detail. It should be noted that the following description is not limiting, and those skilled in the art can make any modifications and substitutions based on the following description and the technical common sense in the art without significantly hindering the technical effect of the present application.

[0008] The practice of the present application will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA techniques, genetics, immunology and cell biology, which are within the skill of the art. Descriptions of these methods can be found in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition, 2001); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd edition, 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Transcription and Translation (B. Hames & S. Higgins, Eds., 1984); Perbal, A Practical Guide to Molecular Cloning (1984); Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998) Current Protocols in Immunology (Q. E. Coligan, AM Kruisbeek, DH Margulies, E M Shevach and W. Strober, eds., 1991); Annual Review of Immunology; and journal monographs such as Advances in Immunology.

[0009] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of this application, the following terms are defined below.

[0010] In the present invention, the term "nucleotide" refers to the monomeric unit of the DNA or RNA composed of a sugar moiety (pentose), phosphoric acid and nitrogenous heterocyclic bases in this article. The base is connected to the sugar moiety via a glycosidic carbon (1' carbon of pentose) and this combination of base and sugar is a nucleoside. When a nucleoside contains a phosphate group bonded to the 3' or 5' position of a pentose, it is referred to as a nucleotide. The sequence of polymerizable operably connected nucleotides is generally referred to as "base sequence", "nucleotide sequence" or nucleic acid or polynucleotide "chain" in this article and is represented by the chemical formula in the conventional direction of the 5' end to the 3' end by its left to right direction in this article, and the 5' end and the 3' end refer to the terminal 5' phosphate group and the terminal 3' hydroxyl at the "5'" and "3'" ends of the polymer sequence respectively.

[0011] In the present invention, the terms "oligonucleotide", "polynucleotide" and "nucleic acid" herein refer to a molecule comprising two or more, preferably more than three, deoxyribonucleotides and / or ribonucleotides. Its exact size depends on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. Oligonucleotides can be synthesized or obtained by cloning or from natural (e.g., genomic) sources. As used herein, the term "polynucleotide" refers to a polymer molecule composed of nucleotide monomers covalently bonded in a chain. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are examples of polynucleotides.

[0012] In the present invention, the term "primer" refers to an oligonucleotide herein, whether naturally occurring or synthetically produced, which can serve as a starting point for nucleic acid synthesis when placed under conditions that induce the synthesis of primer extension products complementary to a nucleic acid chain, for example, in the presence of four different nucleotide triphosphates and a polymerase such as a thermostable enzyme, in an appropriate buffer ("buffer" includes pH, ionic strength, cofactors, etc.) and at a suitable temperature. In order to obtain maximum efficiency in amplification, the primer is preferably single-stranded, but alternatively double-stranded. If it is double-stranded, the primer is first treated to separate its strands and then used to prepare an extension product. Preferably, the primer is an oligodeoxynucleotide. The primer must be long enough to initiate the synthesis of the extension product in the presence of a polymerase such as a thermostable polymerase. The exact length of the primer depends on many factors, including temperature, primer source, and method of use. For example, depending on the complexity of the target sequence, an oligonucleotide primer typically contains 15-25 nucleotides, but it may contain more or less nucleotides. Short primer molecules generally require colder temperatures to form sufficiently stable hybrid complexes with the template.

[0013] In the present invention, the term "total RNA" refers to messenger RNA ("mRNA", RNA that carries information from DNA to the ribosome site of protein synthesis in the cell where the mRNA is translated into protein), transfer RNA ("tRNA", a small RNA chain that transfers specific amino acids to the growing polypeptide chain during protein translation), ribosomal RNA ("rRNA"), and non-coding RNA (also known as RNA genes or small RNA, meaning genes that encode RNA that is not translated into protein).

[0014] In the present invention, the term "ribosomal RNA" or "rRNA" refers to the central component of the ribosome (the protein-making machine of all living cells). These machines self-assemble into two complex folded structures (large and small subunits) in the presence of a variety of ribosomal proteins. In bacteria, archaea, mitochondria and chloroplasts, the small ribosomal subunit contains 16S rRNA, where the S in 16S represents the Svedberg unit; the large ribosomal subunit contains two rRNA species (5S and 23S rRNAs). Bacterial 16S, 23S and 5S rRNA genes are usually assembled into a co-transcribed operon. There may be one or more copies of the operon dispersed in the genome. Eukaryotic cells usually have multiple copies of rRNA genes assembled in tandem repeats. The 18SrRNA in most eukaryotes is located in the small ribosomal subunit, and the large subunit contains three rRNA species (5S, 5.8S and 25S / 28SrRNAs).

[0015] In the present invention, the term "core sequence" refers to the 20 nt "core sequence" on the sgRNA used to recognize the target sequence, and other sequences are structural sequences and do not participate in sequence recognition.

[0016] In the present invention, as used herein, the term "CRISPR-Cas system" refers to nucleic acids and / or proteins involved in the expression of CRISPR effectors or directing their activity, including sequences encoding CRISPR effectors, RNA guides, and other sequences and transcripts from the CRISPR locus.

[0017] In the present invention, "RNA fragmentation" herein refers to breaking RNA or RNA to be detected, which can fragment long RNA into relatively short RNA chains;

[0018] In the present invention, "DNA fragmentation" refers to breaking double-stranded DNA or double-stranded DNA to be detected, which can fragment long double-stranded DNA into relatively short double-stranded DNA;

[0019] "Fragmented DNA", "DNA fragments" or "interrupted DNA fragments" contain protruding ends, that is, there is some single-stranded DNA at the end of the double-stranded DNA fragment. Any method known in the art can be used to blunt the protruding ends of the double-stranded DNA, but it does not rule out that some interrupted double-stranded DNA fragments have blunt ends.

[0020] In the present invention, the term "sequencing adapter" or "adapter" refers to an oligonucleotide that binds to the 5' and 3' ends of each DNA fragment in a sequencing library. The adapter contains a platform-dependent sequence that allows amplification of the fragment and a sequence that triggers the sequencing reaction. The adapter may also contain a unique sequence, called a barcode or index, which is used to identify the sample source of each fragment. The adapter may contain a region that serves as a primer binding site for other enzymatic reactions (e.g., amplification by PCR).

[0021] In the present invention, the term "linker ligation reagent" refers to a reagent that connects fragmented double-stranded DNA to a linker. The linker ligation reagent herein can connect one linker to the 5' end of the two strands of the fragmented double-stranded DNA, while the corresponding other linker is connected to the 3' end of the two strands of the fragmented double-stranded DNA, and the above two connections can be completed at one time in one system.

[0022] In the present invention, the term "library" herein refers to some or more template molecules that share a common sequence at their 5' end and share a common sequence at their 3' end, that is, a target DNA duplex. The use of the term "library" to refer to some or more template molecules should not be understood as implying that the templates constituting the library are obtained from a specific source, or that the "library" has a specific composition. For example, the use of the term "library" should not be understood as implying that the individual templates within the library must have different nucleotide sequences or that the templates must be related in terms of sequence and / or source.

[0023] In the present invention, the term "next generation sequencing (NGS)" herein refers to a sequencing method that allows massively parallel sequencing of clonal amplification and single nucleic acid molecules, during which multiple, e.g., millions of nucleic acid fragments from a single sample or from multiple different samples are sequenced simultaneously. Non-limiting examples of NGS include synthesis sequencing, ligation sequencing, real-time sequencing, and nanopore sequencing.

[0024] In the present invention, the term "end repair" refers to an enzymatic reaction in vitro to blunt the 5' and / or 3' overhangs of DNA. Blunt ends can be obtained by filling in missing bases of the chain in the 5' to 3' direction using a polymerase and removing 3' overhangs using an exonuclease. For example, T4 polymerase and / or Klenow DNA polymerase can be used for DNA end repair.

[0025] In one embodiment of the present invention, a method for constructing a ribosomal RNA sequencing library is provided, wherein:

[0026] The method comprises the following steps: S1. extracting total RNA from a sample; S2. using the total RNA to construct a library to obtain a library; and S3. using the CRISPR system to perform specific cutting of sequences derived from rRNA.

[0027] Among them, as far as the S1 step is concerned, as long as the total RNA of the sample can be extracted, there is no special limitation, for example, it can be carried out by the method of extracting total RNA by the Trizol method. As far as S2 is concerned, the "library construction" here means that as far as the implementation method of the S2 step is concerned, as long as the library can be obtained, there is no special limitation, for example, in one embodiment of the present invention, the S2 step includes the following steps, wherein step (a) is optional: (a) RNA fragmentation; (b) one-strand reverse transcription; (c) two-strand synthesis; (d) DNA end repair plus A; (e) adapter connection. Among them, step (a) RNA fragmentation refers to, for example, it can be carried out in a manner. Step (b) one-strand reverse transcription refers to, for example, it can be carried out in a manner. Step (c) two-strand synthesis refers to, for example, it can be carried out in a manner. Step (d) DNA end repair plus A refers to, for example, it can be carried out in a manner. For example, it can be carried out in a manner. Step (e) adapter connection refers to, for example, it can be carried out in a manner.

[0028] In one embodiment, the method for constructing a de-ribosomal RNA sequencing library according to claim 1 further comprises the following steps: S4. Amplifying the library. In other words, in one embodiment, the method for constructing a de-ribosomal RNA sequencing library is used for RNA sequencing, and therefore, the present invention also provides an RNA sequencing method. The RNA sequencing method includes the method for constructing a de-ribosomal RNA sequencing library. The implementation method of step S4 is not particularly limited, and for example, it can be performed by PCR.

[0029] In one embodiment, in the S3 step, the CRISPR system can specifically remove cDNA derived from ribosomal RNA by designing sgRNA according to the sequence of ribosomal RNA. Here, the CRISPR system refers to a complex of Cas9 protein + sgRNA.

[0030] Here, designing sgRNA according to the sequence of ribosomal RNA means designing an sgRNA sequence capable of targeting ribosomal RNA according to the principle of complementary base pairing.

[0031] In one embodiment, the sample used in the method for constructing the ribosomal RNA sequencing library is not particularly limited and can be derived from any organism or tissue, for example, can be derived from: human body fluid samples, such as alveolar lavage fluid, sputum, blood, etc. In one embodiment, the sample is derived from humans, bacteria, fungi, or a combination thereof.

[0032] In one embodiment, as far as the S3 step is concerned, as long as the specific cleavage of the sequence derived from rRNA can be performed by the CRISPR system, there is no particular limitation. In one embodiment, the S3 step specifically comprises the following steps: (i) preparing a mixture of Cas9 protein and sgRNA designed for rRNA; (ii) using the mixture of Cas9 protein and sgRNA to treat the library obtained in step S2. Here, designing sgRNA for rRNA refers to designing an sgRNA sequence that can target ribosomal RNA according to the principle of base complementary pairing. For example, in one embodiment, when the rRNA sgRNA core sequence (20nt) is designed according to human rRNA 5S, 5.8S, 18S and 28S sequences (note that the core sequence is followed by NGG (PAM sequence)), an sgRNA containing a sequence as shown in SEQ ID NO: 1 can be designed. As far as the step (i) is concerned, as long as an active Cas9 protein / sgRNA complex can be formed, the implementation conditions are not particularly limited. For example, in one embodiment, step (i) is performed at 20°C to 30°C, preferably 25°C. As for step (ii), as long as the specific cleavage of the sequence derived from rRNA can be achieved and the reads caused by it during sequencing can be reduced, the specific implementation method is not particularly limited. For example, in one embodiment, step (ii) is performed under the following conditions: 37°C for 30 minutes, 65°C for 5 minutes.

[0033] In one embodiment, the present invention also provides a de-ribosomal RNA library construction kit, which can implement the method for constructing a de-ribosomal RNA sequencing library according to claim 1.

[0034] In one embodiment, the present invention also provides a sequencing method, which uses a sequencing library obtained by the method for constructing a ribosomal RNA sequencing library according to claim 1.

[0035] Example

[0036] Example 1. Preparation of a mixture of Cas9 and human rRNA sgRNA

[0037] 1. Preparation of human rRNA sgRNA:

[0038] The rRNA sgRNA core sequence (20 nt) is designed based on the human rRNA 5S, 5.8S, 18S and 28S sequences, and the core sequence is followed by NGG (PAM sequence). There are two methods for preparing sgRNA:

[0039] a. Chemical synthesis of sgRNA:

[0040] The purple part in the following sequence is the 20nt core sequence, i.e., the target-specific sequence (different sgRNAs are modified according to the design), and the rest is the backbone sequence that remains unchanged.

[0041] mC*mG*mU*rCrGrUrArUrCrGrCrUrGrUrUrGrUrUrGrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArU rArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU

[0042] The sequence list was sent to Shanghai Bioengineering. The sequence powder was reversed and diluted to 10 μM with nuclease-free water.

[0043] b. In vitro transcription of sgRNA:

[0044] The purple part in the following sequence is the 20nt core sequence (different sgRNAs are modified according to the design) and the rest is the backbone sequence that remains unchanged.

[0045] TTCTAATACGACTCACTATAGACGACACCGCGCCACACCAG GTTTTAGAGCTAGA(SEQ ID NO:1)

[0046] The sgRNA was obtained by in vitro transcription using EnGen sgRNA sythesis kit (NEB E3322) and dissolved in nuclease-free water and diluted to 10 μM.

[0047] 2. Preparation of Cas9 and human rRNA sgRNA mixture

[0048] Cas9 protein (20 μM) was ordered from NEB.

[0049] Total system 100μl Nuclease-free water 78.25μl 10*NEB buffer r3.1 10μl Cas9 protein (20 μM) 2.35μl sgRNA (10 μM) 9.4μl

[0050] After mixing, let it combine at room temperature (25°C) for 15 minutes; then store the mixture at 4°C.

[0051] Example 2. Construction of human transcriptome library

[0052] 1. Take the cultured 293T cells and extract total RNA. Take 1 μg of total RNA for subsequent library construction (the kit uses VAHTS Stranded mRNA-seq Library Prep Kit for Illumina V2).

[0053] 2. Resuspend the total RNA in Frag / Prime Buffer, take 18.5 μl to the PCR tube, and use a pipette to gently pipette 10 times to mix thoroughly. Place the sample in a PCR instrument at 94°C for 6 minutes:

[0054] 3. Prepare a chain system:

[0055] Components System (μl) Fragmented RNA 18.5μl 1st Strand Buffer 2 6μl 1st Strand Enzyme Mix 2 2μl

[0056] Use a pipette to gently pipette up and down 10 times to mix thoroughly. Place the sample in a PCR instrument: 25℃ for 10 min, 42℃ for 15 min, 70℃ for 15 min; hold at 4℃.

[0057] 4. Prepare the two-chain system:

[0058] Components System (μl) 1st Strand cDNA 25μl 2nd Strand Marking Buffer 2 25μl 2nd Strand Enzyme Super Mix 15μl

[0059] Use a pipette to gently pipette up and down 10 times to mix thoroughly. Place the sample in a PCR instrument: 16℃ for 30min, 65℃ for 15min, and hold at 4℃.

[0060] 5. Prepare the joint connection system:

[0061]

[0062]

[0063] Use a pipette to gently pipette up and down 10 times to mix thoroughly. Place the sample in a PCR instrument: 20℃ for 15min, 4℃ hold.

[0064] Purify DNA using magnetic beads: let stand at room temperature for 5 minutes, use a magnet (magnetic stand) to hold the magnetic beads, remove the clarified liquid, and add 80% ethanol to wash twice; after drying the ethanol, add 0.1x TE, invert and mix thoroughly, let stand at room temperature for 5 minutes, use a magnet (magnetic stand) to hold the magnetic beads, and absorb the clarified liquid.

[0065] 6.CRISPR cutting system:

[0066] Components System (μl) The above library 12μl Cas9 and rRNA sgRNA mixture 8μl

[0067] Use a pipette to gently pipette 10 times to mix thoroughly. Place the sample in a PCR instrument: 37℃ for 30min, 65℃ for 5min.

[0068] 7. Prepare library amplification system:

[0069] Components System (μl) The above library 20μl PCR Primer Mix 3 5μl VAHTS HiFi Amplification Mix 25μl Nuclease-free water to 50μl

[0070] Use a pipette to gently pipette 10 times to mix thoroughly. Place the sample in a PCR instrument: 95℃ for 15min, 12 cycles (98℃ for 20sec, 60℃ for 15sec, 72℃ for 30sec), 72℃ for 5min, 4℃ hold.

[0071] The above steps can achieve the construction of ribosomal-free RNA library by adding 35 minutes to the original RNA library construction, greatly shortening the library construction time.

[0072] Example 3. Construction of macrotranscriptome library

[0073] 1. Extract total RNA from bronchoalveolar lavage fluid samples.

[0074] 2. Reverse transcription and second-strand synthesis:

[0075] RNA reverse transcription and second-strand synthesis were performed using NEB modules ( Ultra TM II RNA FirstStrand Synthesis Module E7771 and Ultra TM II RNA Second StrandSynthesis Module E6111).

[0076] Prepare the reverse transcription and double-strand cDNA synthesis system according to the table

[0077]

[0078] 3. Use Zymo DNA Clean & Concentrator Kits to purify the product and elute with nuclease-free water. Use Novozyme DNA Library Prep Kit V2 for Illumina to build the library and add adapters.

[0079] 4.CRISPR cutting system:

[0080] Components System (μl) The above library 12μl Cas9 and rRNA sgRNA mixture 8μl

[0081] Use a pipette to gently pipette 10 times to mix thoroughly. Place the sample in a PCR instrument: 37℃ for 30min, 65℃ for 5min.

[0082] 5. Prepare library amplification system:

[0083] Components System (μl) The above library 20μl PCR Primer Mix 3 5μl VAHTS HiFi Amplification Mix 25μl Nuclease-free water to 50μl

[0084] Use a pipette to gently pipette 10 times to mix thoroughly. Place the sample in a PCR instrument: 95℃ for 15min, 12 cycles (98℃ for 20sec, 60℃ for 15sec, 72℃ for 30sec), 72℃ for 5min, 4℃ hold.

[0085] The above steps can achieve the construction of ribosomal-free RNA library by adding 35 minutes to the original RNA library construction, greatly shortening the library construction time.

Claims

1. A method for constructing a ribosomal RNA sequencing library, comprising the following steps: S1. Extract total RNA from samples; S2. using the total RNA to construct a library to obtain a library; S3. Use the CRISPR system to specifically cleave sequences derived from rRNA.

2. The method for constructing a ribosomal RNA sequencing library according to claim 1, further comprising the following steps: S4. Amplify the library.

3. The method for constructing a ribosomal RNA sequencing library according to claim 1 or 2, wherein: The CRISPR system can specifically remove cDNA derived from ribosomal RNA by designing sgRNA according to the sequence of ribosomal RNA.

4. The method for constructing a ribosomal RNA sequencing library according to any one of claims 1 to 3, wherein: The sample is derived from humans, bacteria, fungi or a combination thereof.

5. The method for constructing a ribosomal RNA sequencing library according to any one of claims 1 to 4, wherein: Step S2 comprises the following steps, wherein step (a) is optional: (a) RNA fragmentation; (b) single-strand reverse transcription; (c) second-strand synthesis; (d) DNA end repair with A addition; (e) Connector connection.

6. The method for constructing a ribosomal RNA sequencing library according to any one of claims 1 to 5, wherein: The S3 step includes the following steps: (i) preparing a mixture of Cas9 protein and sgRNA designed for rRNA; (ii) using the mixture of Cas9 protein and sgRNA to treat the library obtained in step S2.

7. The method for constructing a ribosomal RNA sequencing library according to claim 6, wherein: The sgRNA comprises the sequence shown in SEQ ID NO:

1.

8. The method for constructing a ribosomal RNA sequencing library according to claim 6 or 7, wherein: Step (i) is carried out at 20°C to 30°C, preferably 25°C.

9. The method for constructing a ribosomal RNA sequencing library according to any one of claims 6 to 8, wherein: Step (ii) was carried out under the following conditions: 37°C for 30 min, 65°C for 5 min. 10 . A kit for constructing a de-ribosomal RNA library, which can implement the method for constructing a de-ribosomal RNA sequencing library according to any one of claims 1 to 9. 11 . A sequencing method, comprising performing sequencing using a library obtained by the method for constructing a ribosomal RNA sequencing library according to any one of claims 1 to 9.

Images