A SNP molecular marker associated with pig backfat thickness and eye muscle area traits and application thereof
By discovering and verifying the C>A mutation SNP site in the 7061028-7062011 segment of pig chromosome 1, SNP molecular markers related to pig backfat thickness and eye muscle area were screened out, solving the problem of difficulty in efficiently screening excellent traits in existing technologies and achieving a significant improvement in pork production performance.
Patent Information
- Application Number
- CN202411722516.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-27
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-11-27
AI Technical Summary
Existing technologies make it difficult to efficiently screen out excellent trait genes related to pig backfat thickness and eye muscle area, which affects the breeding process of pork meat production performance.
By cloning the gene sequence of the 7061028-7062011 segment of pig chromosome 1, the C>A mutation SNP site located at base 7061212 was discovered and verified. Primer pairs were designed for PCR amplification and sequencing, and SNP molecular markers related to pig backfat thickness and eye muscle area were screened. Association analysis was performed using high-throughput sequencing, and the AA genotype was determined to be a favorable genotype for improving meat production performance.
Scientific and efficient screening of pig backfat thickness and eye muscle area traits has been achieved. Individuals with the AA genotype show thinner backfat thickness and larger eye muscle area, which significantly improves the meat production performance of pigs.
Smart Images

Figure CN119331989B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biotechnology and molecular marker technology, and specifically relates to a SNP molecular marker related to pig backfat thickness and eye muscle area and its breeding application. The molecular marker is cloned from base 7061212 of pig chromosome 1, and the site is located at 84bp in the first exon region of LOC106508795. Background Art
[0002] my country is the world's largest producer and consumer of live pigs, and the live pig industry is one of the key pillar industries of agriculture. [1] Breeding pig breeds with excellent traits is particularly important for ensuring the rapid development of the pig industry. In the past few decades of development, my country's pig industry has achieved excellent results, its independent innovation capabilities have been continuously improved, and the supply capacity of high-quality breeding pigs has been continuously enhanced, laying a solid foundation for the stable development of the pig industry and greatly satisfying the public's demand for pork-related meat products. [2] .
[0003] The rapid development of molecular biology and high-throughput sequencing technologies has made it possible to efficiently obtain gene sequences, enabling rapid screening of individuals with mutations for advantageous traits by comparing them to wild-type genotypes. This molecular approach accelerates the development of high-quality breeding pig herds, swiftly achieving the high-quality development of pork-related agricultural products, and significantly boosting the nation's meat supply. Research on desirable livestock traits has focused on areas such as pig backfat thickness and loin eye area. Using these techniques, many key genes influencing these traits have been identified, such as LOC106508795, a long noncoding RNA (lncRNA) over 200 nucleotides in length that exhibits powerful regulatory power over gene expression. Numerous studies have demonstrated that single-nucleotide polymorphisms (SNPs) within lncRNAs alter lncRNA function, thereby influencing gene regulation and trait expression. By identifying SNP markers associated with muscle development in pigs and conducting association analysis with these traits, we can identify more advantageous genotypes and accelerate pig breeding efforts.
[0004] In light of this, the present invention aims to provide a SNP marker associated with pig backfat thickness and eye loin area, and its application in breeding. By detecting SNPs in the exon region of lncRNA-LOC106508795, the present invention screens for SNP molecular markers associated with pig muscle development, advancing animal genetic breeding in a more scientific and efficient manner and providing a new approach to resolving difficult breeding issues.
[0005] Main references
[0006] [1] Zhang H, Chen R, Chen N, et al. Development of China's pig industry in 2022 and trends in 2023[J]. China Swine, 2023, 18(02): 13-18.
[0007] [2] Li M. Improve the pig industry chain and lay a solid foundation for the development of the pig industry[J]. China Swine, 2021, 16(01): 43-45. SUMMARY
[0008] The purpose of the present application is to provide a SNP molecular marker related to pig back fat thickness and eye muscle area traits, and to screen genetic markers associated with pig muscle development. By cloning the gene sequence of the 7061028-7062011 segment of pig chromosome 1, and using high-throughput sequencing method to find SNP sites and genotyping method, the correlation with pig back fat thickness and eye muscle area traits is analyzed, thereby providing a new marker site for improving pig meat efficiency.
[0009] The present application is based on the above-mentioned SNP molecular marker, and proposes new breeding applications to accelerate the improvement of pork meat performance. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, and there is a C>A base mutation at position 800 of the sequence. The three genotypes show significant changes in live back fat thickness and eye muscle area at 100 kg body weight. The results prove that the AA genotype of the SNP site is a favorable genotype for improving pig meat efficiency.
[0010] The present application is realized by the following technical solutions:
[0011] A SNP molecular marker related to pig back fat thickness and eye muscle area traits, the site of the SNP molecular marker corresponds to the gene sequence of the 7061028-7062011 segment of pig chromosome 1, the fragment length is 984 bp, and the nucleotide sequence is as shown in SEQ ID NO. 1. By BLAST comparison on the NCBI website, it is found that there is a nucleotide polymorphism (SNP) site in the amplified fragment, specifically as shown in Figure 3 The mutation of the SNP site is at the 7061212th base of chromosome 1, and the base changes from C to A. According to the naming rules of Ensembl database, the mutation site is named as rs325246183.
[0012] The primer pair is designed according to the pig gene sequence (NC_010443.5) published by NCBI database. The sequence of the primer pair is as follows:
[0013] Forward primer (SEQ ID NO. 2): 5'-ACTCGGGCTGCGAAAGTTTA-3';
[0014] Reverse primer (SEQ ID NO. 3): 5'-CTTGAATCACCTGGGCCACT-3'.
[0015] The above primer pair can detect and type the SNP sites in the gene region of the 7061028-7062011 segment of pig chromosome 1.
[0016] After PCR amplification using the above primer pair, purification of the PCR product, cloning and sequencing, and sequence comparison analysis, a genetic marker associated with pig meat production was screened. The nucleotide sequence of this genetic marker is shown below as SEQ ID NO. 1, where the mutation site is located at position 800 of the sequence.
[0017] ACTCGGGCTGCGAAAGTTTAACTTTCCCAATATTGCTTCACCTGGGGTGAAGCTAATGCACACAGTCTATTTAGGCCTCTACTGAGCTTGACAATCTTTTTTTTTTTTGCCATTTCTAGGGCCACTCCCGCGGCATATGGAGGTTCCCAGGTTAGGGGTCTAATCGGATCTGTAGCCGCCGGCCTACACCACAGCCACAGCAACGCAGAGTCCAAGCCATGTCAGTGACCTACACCACAGCTCACAGCAACGTCGGATCCTTAACCCACTGAGCAAGGCCAGGTTTCCAACCCGCAACCTCATGGTTCCTAGTCGGATTCGTTAACCACTGTGCCACGACCAGAACTCCTAGCTTAACACCCTTAAGTTAGAGCACAGTGGTTAATGTCCTACCTAACAGTGTAGAATCATTATGTAAGCTAAAATAATTTATTATCAAAACGTCTTTAAGTCCAGTAGACTCATACGTTTTCCACGATTCAAATTATGTTAATAAAATGTCCATCTTTTCCCCAAATGGGTCACAGCACGTTATAGCCTCATCGTCATGAAAGAAAGCAAGATTGGTCAAATTAAGTTTAAAGGGCCTCTCAATTTTGTTGATTCTGTACTTTCCCCTGGCTTCGGGCTAGAACGACGGGTAGTTCAGGCTTTAAAACTCCTACATCAGAGTTCAATAATATTCGGGAATGGCCTCTAGTTGTGAAATAAGAACTCAAAACCCACCTCTCTCCTGGCTATGAATTCCTGTCTGTAAACCAACCAGCAAAATGTACGGGTGGGAACCCATCGTCCTGGGM(C / A)GGGATCTCCTCCAGAATTGCCAGGAGTTGAAGCACTGTGTGTGCAGAATTCACAGGAACAGAGCGTGCGGGGGAGGAGGAGGCGGTGCCACCATGAGGGGCCCAGCGACCCGGTGCGTTTCCCGTCCTTTCACGTCGCCCCGGCTTTCTCTCCTCCCCTCACCTAGTGGCCCAGGTGATTCAAG
[0018] A SNP marker method for improving pig meat production performance comprises the following steps:
[0019] 1. Extract genomic DNA from the blood of Large White pigs;
[0020] 2. Primers were designed based on the genomic sequence from -799 bp upstream to 184 bp downstream of the site. The above primers were used to amplify porcine genomic DNA by PCR, and the nucleotide sequence from -799 bp upstream to 184 bp downstream of the site was obtained by direct sequencing (see SEQ ID NO. 1 for details). This sequence contains one SNP site;
[0021] 3. This mutation site can be used as a genetic marker to conduct association analysis on the meat production traits of Large White pigs.
[0022] The present invention provides a genotyping method for detecting SNP sites in the above sequence.
[0023] Another technical purpose of the present invention is to provide the application of the SNP molecular marker in the pig backfat thickness and eye muscle area traits, using high-throughput sequencing to determine the association between individuals with different genotypes and traits, comprising the following steps:
[0024] 1. To determine the correlation between SNPs in the 7061028-7062011 region of porcine chromosome 1 and backfat thickness and eye muscle area, Large White pigs were selected as experimental materials;
[0025] 2. High-throughput sequencing was used to detect polymorphisms and analyze the correlation between polymorphic loci and pig backfat thickness and eye muscle area. Mixed linear models (Mixed) in SAS statistical software were used to analyze the association between the three genotypes and meat production phenotypes.
[0026] Compared with the prior art, the present invention has the following advantages and effects:
[0027] The present invention studies and determines that the SNP that affects the pig backfat thickness and eye muscle area traits is located at base 7061212 of pig chromosome 1. Among them, the M at position 800 in the nucleotide sequence of the SNP molecular marker is an allele replacement. The base replacement causes a functional change in lncRNA-LOC106508795, which in turn leads to changes in traits related to meat production performance: in the backfat thickness trait of living bodies with a body weight of 100 kg, individuals with the AA genotype at this SNP site have thinner backfat thickness; in the eye muscle area trait of living bodies with a body weight of 100 kg, individuals with the AA genotype at this SNP site have larger eye muscle area. Therefore, the AA genotype at this SNP site changes in two key traits related to meat production efficiency, which indeed proves that it is beneficial to improving meat production performance. The purpose of the present invention is to explore SNP sites related to the pig backfat thickness and eye muscle area traits, and then provide applications for pig genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 : The present invention clones the detection results of the pig chromosome 1 segment 7061028-7062011; the agarose gel concentration is 1%; wherein: lane 1: PCR amplification product, lane M: DL2000Maker;
[0029] Figure 2 : Sequencing map of the genetic marker sequence C>A of the present invention;
[0030] Figure 3 : The nucleotide sequence of the 7061028-7062011 segment of porcine chromosome 1; the mutation site marked in red in the sequence is the specific site that causes the polymorphism in this segment. DETAILED DESCRIPTION
[0031] Example 1: Amplification of DNA fragments in the region 7061028-7062011 of porcine chromosome 1 and establishment of a SNP detection method
[0032] 1. Primer pairs were designed based on the genomic sequence of porcine chromosome 1, segment 7061028-7062011. The specific sequences are as follows:
[0033] Forward primer (SEQ ID NO. 2): 5'-ACTCGGGCTGCGAAAGTTTA-3'.
[0034] Reverse primer (SEQ ID NO. 3): 5'-CTTGAATCACCTGGGCCACT-3'.
[0035] 2. Use the above primers to perform PCR amplification on the genomic DNA of the experimental group of pigs.
[0036] The PCR reaction system is shown in Table 1.
[0037] Table 1 PCR reaction system
[0038]
[0039] The PCR reaction conditions are shown in Table 2.
[0040] Table 2 PCR reaction conditions
[0041]
[0042] The resulting PCR product was purified and cloned, and then sequenced by Wuhan Aoke Biotechnology Co., Ltd. BLAST analysis revealed a C / A mutation at base 800 of the sequence.
[0043] Example 2: Association analysis between the genetic markers of the present invention and pig backfat thickness and eye muscle area traits
[0044] 1. In order to determine the correlation between SNPs in the 7061028-7062011 region of porcine chromosome 1 and pig trait differences, this experiment selected Large White pigs (435 heads) as experimental materials.
[0045] 2. SNP detection was performed by high-throughput sequencing, and the correlation between SNP and pig muscle development was analyzed. The association between genotype and phenotype values was analyzed using a mixed linear model (Mixed) in SAS statistical software. The analysis model is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm , where Y ijkl is the observed value of the trait; u is the total average value of the trait; G i is the genotype effect; F j 、S k 、B l are fixed effects, namely family, gender, and batch effects; ε ijklm is a random error, assuming that it obeys N(0, σ 2 )distributed.
[0046] 3. Gene sequence polymorphism analysis of the rs325246183 locus in the 7061028-7062011 region of porcine chromosome 1 revealed three genotypes in the aforementioned populations. The genotype frequencies and distributions are shown in Table 3.
[0047] Table 3 Genotype and allele frequencies of polymorphic site rs325246183
[0048]
[0049] From Table 3, it can be concluded that the frequency of A allele of polymorphic site rs325246183 is higher than that of C allele in the Large White pig population. The Hardy-Weinberg equilibrium test results show that (χ 2 =2.911, P=0.088>0.05), the genotype distribution of the polymorphic site rs325246183 was consistent with the genetic equilibrium state.
[0050] Table 4 Association analysis between the polymorphic site rs325246183 and backfat thickness and eye muscle area traits
[0051]
[0052] Note: The above values are least squares means ± standard errors. In each pig breed, the same letters in the same column indicate no significant difference (P>0.05). If the letters are different, lowercase letters indicate significant difference (P<0.05), uppercase letters indicate extremely significant difference (P<0.01), and unmarked ones indicate no significant difference (P>0.05). The numbers in brackets indicate the number of pigs.
[0053] The association analysis results in Table 4 revealed that the polymorphism rs325246183 was significantly associated with both backfat thickness and eye muscle area at 100 kg in Large White pigs. In particular, backfat thickness was significantly lower in Large White pigs with the AA genotype than in those with the CC genotype (P < 0.05). For the eye muscle area trait at 100 kg, those with the AA genotype were significantly larger than those with the CA genotype (P < 0.05). In summary, the homozygous AA genotype is the optimal choice for improving pig meat production efficiency. Based on phenotype, genetic testing should be narrowed down to identify pigs expressing the AA genotype at this SNP. Herds of pigs with this genotype should be monitored in real time to observe other traits, such as feed conversion rate and daily gain. Pigs with excellent performance in multiple traits should be selected for breeding. In addition to considering the influence of genetic factors on heritability, environmental factors should also be considered. These measures can include optimizing the farm environment, implementing intensive feeding practices, and conducting routine quarantine. Using molecular markers to assist in the selection of dominant genotypes can fundamentally alter traits, while strengthening the daily management of breeding pigs can further accelerate the genetic breeding process. Based on the above results, the present invention speculates that the polymorphic site rs325246183 may serve as a potential genetic marker for improving pig muscle development. The application of this genetic marker and the new breeding strategy proposed based on it can accelerate the expansion of breeding pigs with dominant traits, gradually achieve the cultivation of high-quality commercial pig lines, and ultimately maximize the economic benefits of China's pig industry.
Claims
1. An application of a SNP molecular marker associated with pig backfat thickness and eye muscle area traits in improving pig meat production performance, characterized in that: The SNP molecular marker is shown in SEQ ID NO. 1, wherein the site is located at position 800 of the sequence, and the application comprises the following steps: 1) Extracting genomic DNA from the blood of Large White pigs; 2) designing primers based on the genomic sequence from -799 bp upstream to 184 bp downstream of the SNP site; using the primers, PCR amplifying porcine genomic DNA, and obtaining a nucleotide sequence from -799 bp upstream to 184 bp downstream of the site by direct sequencing, which contains the SNP site; 3) The mutation site was used as a genetic marker for association analysis of meat production traits in Large White pigs; the meat production-related traits were backfat thickness and eye muscle area at a body weight of 100 kg; the C>A mutation at position 800 in the nucleotide sequence of the SNP molecular marker: in the backfat thickness trait at a body weight of 100 kg, individuals with the AA genotype at this SNP site had thinner backfat thickness in the body weight of 100 kg; and in the eye muscle area trait at a body weight of 100 kg, individuals with the AA genotype at this SNP site had larger eye muscle area.
Citation Information
Patent Citations
Method for evaluating back fat thickness and eye muscle area of pig and application thereof
CN112941199A
Single nucleotide polymorphism (SNP) markers associated with backfat thickness trait in pig and their methods for evaluation
KR1020110139010A