SNP (Single Nucleotide Polymorphism) molecular marker related to low backfat thickness and high intramuscular fat content of pig on IL-15 (Interleukin-15) gene and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to low backfat thickness and high intramuscular fat content of a pig on an IL-15 (Interleukin-15) gene and application of the SNP molecular marker, and belongs to the field of molecular biology. According to the invention, an SNP site is screened, and the SNP site is located at the upstream 334bp of an initiation codon of an IL-15 gene, specifically G / A mutation. The research finds that the genotype of the SNP site is closely related to the backfat thickness and intramuscular fat content at the same time; the intramuscular fat content of GG genotype and GA genotype individuals is remarkably higher than that of AA genotype individuals, and the backfat thickness of the GG genotype individuals is remarkably lower than that of the AA genotype individuals. The invention provides an important molecular marker for the improvement and breeding of high-yield and high-quality pig breeds by using the SNP of the IL-15 gene, and provides certain help for the research of pig carcass traits and meat quality traits.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a molecular marker on an IL-15 gene associated with low backfat thickness and high intramuscular fat content in pigs and an application thereof. Background Art

[0002] With the increase in pork consumption, improving meat quality has become an important goal of the pig farming industry. Among them, intramuscular fat content is a key factor affecting pork quality. Studies have shown that intramuscular fat not only affects the taste and flavor of meat, but its nutritional value also has an important impact on consumers' health. Back fat thickness is directly related to the production efficiency and economic benefits of pigs.

[0003] In recent years, the rapid development of genomics has provided a new perspective for the genetic improvement of breeding pigs. Single nucleotide polymorphism (SNP), as the most common form of genetic variation, plays an important role in trait inheritance. This study found that the SNP of the IL-15 gene was significantly associated with the intramuscular fat content and backfat thickness of pigs. Specifically, the G / A mutation upstream of the start codon of the IL-15 gene may affect the carcass performance and meat quality characteristics of pigs by regulating biological pathways related to fat metabolism.

[0004] By analyzing different genotypes (such as GG, AG, and AA), we can better understand how these variations affect meat quality traits, thereby providing a scientific basis for breeding selection. In view of this, the development of a detection method based on IL-15 gene SNP will provide a new tool for genetic evaluation and breeding of pigs, which will be helpful to improve the overall quality and market competitiveness of meat products. Summary of the invention

[0005] The object of the present invention is to provide a molecular marker on the IL-15 gene that is simultaneously correlated with pig backfat thickness and intramuscular fat content and its application. In the present invention, we found that a SNP site of the IL-15 (interleukin-15) gene is significantly correlated with pig backfat thickness and intramuscular fat content. Therefore, it can be used as a molecular marker to improve breeding efficiency. The present invention uses this molecular marker to quickly predict the differences in backfat thickness and intramuscular fat content between pigs of different genotype groups at the same time. In breeding work, it can be used as a reliable marker to assist in the selection of individuals with low backfat thickness and high intramuscular fat content in pigs.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] In the first aspect, the present invention claims the use of a substance for detecting polymorphism or genotype of a SNP site on an IL-15 gene in a pig genome in any of the following:

[0008] (a1) Application in identifying or assisting in identifying pig backfat thickness and intramuscular fat content;

[0009] (a2) Application in the preparation of products for identifying or assisting in the detection of pig backfat thickness and intramuscular fat content;

[0010] (a3) Application in assisting the selection of pigs with low back fat thickness and high intramuscular fat content;

[0011] The SNP site is located 334 bp upstream of the start codon of the IL-15 gene, and its polymorphism is G or A. The genotype of the SNP site is GG, AG or AA. Therefore, the SNP site is named c.-334G>A.

[0012] Wherein, the IL-15 gene sequence is referred to Chromosome 8, NC_010450.4 (85740980-85666963). The region from 2208bp upstream of the start codon of the IL-15 gene to 298bp downstream of the start codon is listed in the sequence table (as shown in SEQ ID NO.1), wherein the wavy line marked sequence is the amplification region of the IL-15 primers IL-15-4F and IL-15-4R; the first bold underlined nucleotide "G" is the SNP site c.334G>A at 334bp upstream of the start codon. The second bold underlined nucleotide "ATG" is the start codon.

[0013] Furthermore, the substance is the following (b1) or (b2) or (b3):

[0014] (b1) PCR primers for amplifying a pig genomic DNA fragment containing the SNP site;

[0015] (b2) a PCR reagent containing the PCR primers described in (b1);

[0016] (b2) A kit containing the PCR primers described in (b1) or the PCR reagents described in (b2).

[0017] Furthermore, the PCR primers include an upstream primer IL-15-4F and a downstream primer IL-15-4R:

[0018] IL-15-4F: 5'-TCAATAACAAAGGGAATCAGA-3' (SEQ ID NO.3)

[0019] IL-15-4R: 5'-ACAACTTCAGGGAGTAGCG-3' (SEQ ID NO. 4).

[0020] Furthermore, the above application is to perform genotyping on the SNP loci. The intramuscular fat content of GG and GA type individuals is significantly higher than that of AA type individuals, and the back fat thickness of GG type individuals is significantly lower than that of AA type individuals.

[0021] In a second aspect, the present invention seeks to protect the use of the aforementioned PCR primers in the preparation of products for detecting the polymorphism or genotype of the aforementioned SNP sites.

[0022] In a third aspect, the present invention claims a product for genotyping the above-mentioned SNP site, the product comprising the above-mentioned substance for detecting polymorphism or genotype of the SNP site on the IL-15 gene in the pig genome or the above-mentioned PCR primer. In a specific embodiment of the present invention, the product is a kit.

[0023] In the fourth aspect, the present invention claims a method for identifying or assisting in identifying the back fat thickness and intramuscular fat content of pigs, detecting the polymorphism or genotype of the SNP site on the IL-15 gene in the above-mentioned pig genome; the intramuscular fat content of GG type and GA type individuals is significantly higher than that of AA type individuals, and the back fat thickness of GG type individuals is significantly lower than that of AA type individuals.

[0024] In the fifth aspect, the present invention claims protection for a method for breeding pigs with low back fat thickness and high intramuscular fat content, detecting the polymorphism or genotype of the SNP site on the IL-15 gene in the above-mentioned pig genome; retaining GG homozygous genotype individuals, eliminating GA heterozygous genotype individuals and AA homozygous genotype individuals, and breeding pigs with low back fat thickness and high intramuscular fat content from generation to generation.

[0025] Furthermore, in the above method, the method for detecting the SNP site polymorphism or genotype on the IL-15 gene in the pig genome is: using the pig genome DNA to be tested as a template, using the above-mentioned PCR primers or the above-mentioned products to perform PCR amplification; using the PCR-RFLP-SsiI method to perform enzyme digestion typing on the amplified fragment, and the enzyme digestion products of different genotypes will show different numbers of bands: the AA genotype has one band of 910 bp; the GG genotype has two bands of 213 and 697 bp; the GA genotype has three bands of 213, 697 and 910 bp.

[0026] In a specific implementation manner of the present invention, the above method specifically comprises the following steps:

[0027] 1) Extracting DNA from the pig tissue sample to be tested;

[0028] 2) using the above-mentioned PCR primer pair or the above-mentioned product (such as a kit) to perform PCR amplification on the DNA obtained in step 1) to obtain an amplified fragment;

[0029] 3) The amplified fragments were digested and typed by the PCR-RFLP-SsiI method. The digested products of different genotypes showed different numbers of bands: the GG genotype had two bands of 213 and 697 bp, the GA genotype had three bands of 213, 697 and 910 bp, and the AA genotype had one band of 910 bp;

[0030] 4) When the typing results are GG type and GA type, it is judged that the intramuscular fat content is higher than that of AA type individuals, while the back fat thickness of GG type individuals is significantly lower than that of AA type individuals.

[0031] Further preferred: in step 2), the PCR amplification reaction 25 μL system: 2×Es Taq MasterMix (Dye) 12.5 μL, 1 μL of upstream and downstream primers, 1 μL of DNA to be detected, 9.5 μL of ddH2O; PCR reaction program: 94°C, 2 min; 94°C, 30 s; 54°C, 30 s annealing; 72°C, 30 s; 35 cycles; 72°C, 2 min.

[0032] Further preferably, the reaction system of the PCR-RFLP-SsiI method is: 8 μL of the PCR amplification product to be detected, 0.2 μL of SsiI enzyme, 10×FastDigest TM Buffer 1μL, ddH2O 0.8μL; reaction conditions: 37℃, 10min.

[0033] In the sixth aspect, the present invention requests protection for a molecular marker containing the above-mentioned SNP site c.-334G>A, the nucleotide sequence of which is shown in SEQ ID NO.2, and the SNP site c.-334G>A is located 334bp upstream of the start codon of the IL-15 gene in the SEQ ID NO.2 sequence.

[0034] The room temperature described in the present invention is 25±10° C., but is not limited thereto.

[0035] Beneficial effects of the present invention:

[0036] The present invention studies the correlation between the important growth factor IL-15 in the organism and the traits of pig backfat thickness and intramuscular fat content, and screens out a SNP site related to both the pig backfat thickness and intramuscular fat content traits in the promoter region, thereby obtaining functional genes and molecular genetic markers related to both the pig backfat thickness and intramuscular fat content, laying a foundation for further genetic improvement of controlling pig backfat thickness and increasing intramuscular fat content at the same time, so as to directly perform genotype selection or marker-assisted selection on pigs, thereby accelerating the improvement and breeding of high-yield and high-quality pig breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the G>A mutation found by sequencing the porcine IL-15 gene in the present invention.

[0038] Figure 2 The schematic diagram of the electrophoresis results of three genotypes (GG, AG or AA) detected by PCR-RFLP-SsiI method at the SNP site c.-334G>A of the porcine IL-15 gene. Marker: 2000bp DNA molecular weight marker.

[0039] Figure 3 The correlation analysis was conducted between the genotype of SNP molecular markers and the backfat thickness and intramuscular fat content of Duchangda pigs. DETAILED DESCRIPTION

[0040] The present invention is further described below with reference to the examples. The experimental methods in the following examples without specifying specific conditions are generally carried out according to the well-known means in the art.

[0041] Example 1

[0042] 1. Experimental Materials

[0043] 1.1 Experimental animals

[0044] This study used 211 Duroc-Changda hybrid pigs. The experimental animals were from Jiangsu Changzhou Kangle Agriculture and Livestock Co., Ltd. and were raised under the same conditions. Liver tissue samples were collected for DNA extraction.

[0045] 1.2 Test reagents

[0046] (1) Conventional genomic DNA purification kit (including RNase A): Contains silica membrane centrifugal column, EB, BB2, LB2, WB2, Proteinase K and RNase A, purchased from Beijing Quanshijin Biotechnology Co., Ltd. and stored at room temperature.

[0047] (2) 2×Es Taq Master Mix (Dye): Contains 2×Es Taq Master Mix (Dye) and ddH2O, purchased from Nanjing Qingke Biotechnology Co., Ltd. and stored at -20°C.

[0048] (3) Goldview nucleic acid gel dye: purchased from Hunan Aikerui Biotechnology Co., Ltd. and stored at 4°C.

[0049] (4) DL2000 Marker: purchased from Nanjing Qingke Biotechnology Co., Ltd., stored at -20°C, and stored at 4°C after thawing.

[0050] (5) Anhydrous ethanol AR 500mL: purchased from Shanghai Sinopharm Chemical Reagent Co., Ltd.

[0051] (6) FastDigest SsiⅠ restriction endonuclease: Contains FastDigest restriction endonuclease, 10×FastDigest TM Green Buffer and 10×FastDigest TM Buffer was purchased from Nanjing Thermo Fisher Scientific Co., Ltd. and stored at -20℃.

[0052] (7) 1×TAE buffer: Prepare by yourself. To prepare 50 mL of the system, you need 12.1 g of Tris base, 2.855 mL of glacial acetic acid, and 5 mL of EDTA (0.5 M, pH 8.0).

[0053] (8) Agarose powder: purchased from Nanjing Qingke Biological Co., Ltd.

[0054] 1.3 Instruments and Equipment

[0055] (1) CF1524R desktop high-speed micro-refrigerated centrifuge: purchased from Shanghai SCILOGEX Technology Co., Ltd.

[0056] (2) NanoDrop 2000 ultra-micro-volume spectrophotometer: purchased from ThermoFisher Technology Company

[0057] (3) PCR instrument: purchased from Zhuhai Dark Horse Medical Instrument Co., Ltd.

[0058] (4) Gradient PCR instrument: purchased from Bio-Rad Life Sciences Products, Inc., USA

[0059] (5) Horizontal electrophoresis apparatus: purchased from Beijing Junyi Oriental Electrophoresis Equipment Co., Ltd.

[0060] (6) Tanon 3500 gel imaging system: purchased from Shanghai Tianneng Technology Co., Ltd.

[0061] (7) Mini metal bath instrument: purchased from Zhejiang Qunan Laboratory Instrument (JOANLAB) Co., Ltd.

[0062] (8) Double-hole constant temperature water bath: purchased from Zhejiang Qunan Laboratory Instrument (JOANLAB) Co., Ltd.

[0063] The amplified fragments were sequenced by Qingke (Nanjing) Biological Company.

[0064] 2. Experimental Methods

[0065] 2.1 Determination of carcass backfat thickness and intramuscular fat content

[0066] 2.1.1 Determination of carcass backfat thickness

[0067] After slaughtering the pigs, the back fat thickness was measured with a vernier caliper in cm. The measurement locations included the lumbar-sacral junction, the thickest part of the shoulder, the back fat thickness at the 3rd and 4th ribs, and the average back fat thickness at three points.

[0068] 2.1.2 Determination of intramuscular fat content of the longissimus dorsi muscle

[0069] (1) Place 9 cm medium-speed quantitative filter paper in a clean enamel dish and bake at 105°C for 2 h. Weigh the filter paper using a 1 / 10,000 balance and record the weight of the filter paper as W1;

[0070] (2) Take 2-3 g of the longissimus dorsi muscle sample, chop it into small pieces, wrap it with dried filter paper and weigh it. The wet weight of the paper bag is recorded as W2.

[0071] (3) Spread the paper bag on an enamel tray, being careful not to touch it, and bake it in an oven at 65°C for 15 h. Weigh the paper bag after drying and record it as W3. Bake it at 65°C for 2 h until constant weight;

[0072] (4) After drying, the paper bag is placed in a Soxhlet extractor, anhydrous ether is added and refluxed once, and the paper bag is soaked again overnight. The next day, a water bath is opened to start extraction, and refluxed at 70°C for more than 9 hours;

[0073] (5) Take out the paper bag, dry it in an enamel dish for 30 min to allow the ether to evaporate completely, and then dry it at 105°C for 2 h and weigh it. Repeat this process several times until the weight is constant. The weight of the paper bag is recorded as W4.

[0074] 6) In order to eliminate the error caused by the different water contents in the sample processing, the relative content of intramuscular fat is expressed as the percentage of the total amount of fat extracted to the final constant weight of the sample. The calculation formula is:

[0075]

[0076] 2.2 DNA extraction from liver tissue

[0077] (1) Prepare a 55°C water bath 30 minutes before the start of the test.

[0078] (2) Place ≤25 mg (mung bean size) of minced liver tissue in a sterile 1.5 ml centrifuge tube.

[0079] (3) Add 100ul LB2 solution and 20ul Proteinase K (make sure the tissue sample is completely immersed in the liquid).

[0080] (4) Incubate at 55°C until complete lysis (approximately 3 hours, depending on the tissue) and the lysate becomes viscous.

[0081] (5) If RNA removal is required, add 20ul RNase A to the sample and incubate at 25°C for 2 minutes.

[0082] (6) Place the centrifuge tube in a high-speed centrifuge and centrifuge at 12,000 x g for 5 minutes. After centrifugation, immediately transfer the supernatant to a sterile centrifuge tube.

[0083] (7) Add 500 μl of BB2 solution to the separated supernatant and immediately vortex for 5 seconds to confirm that the liquid is clear and free of obvious suspended matter. Incubate at room temperature for 10 minutes.

[0084] (8) Transfer the entire solution to a centrifuge column, centrifuge at 12,000 x g for 30 seconds, and discard the flow-through.

[0085] (9) Add 500 μl of CB2 solution to the centrifuge column (add 88 ml of anhydrous ethanol before first use), centrifuge at 12,000 x g for 30 seconds, and discard the flow-through.

[0086] (10) Add 500 μl of WB2 solution (add 88 ml of anhydrous ethanol before first use) to the centrifuge column, centrifuge at 12,000 x g for 30 seconds, and discard the flow-through.

[0087] (11) Repeat step (10) once.

[0088] (12) Centrifuge at 12,000 x g for 2 min to completely remove the residual WB2 solution in the centrifuge column.

[0089] (13) Place the centrifuge column in a clean centrifuge tube and add 50-200ul of preheated EB solution to the center of the column.

[0090] (60℃-70℃) or deionized water (pH>7.0), let stand at room temperature for 1 minute, centrifuge at 12,000xg for 1 minute to elute the DNA.

[0091] (14) To obtain more DNA, repeat step (13) and perform a second elution.

[0092] (15) Use a spectrophotometer to measure the concentration of the newly extracted DNA and store the DNA of qualified quality at -20°C.

[0093] 2.3 Primer design and synthesis

[0094] The full sequence gene information of Sus scrofa pig IL-15 was searched at the website NCBI (https: / / www.ncbi.nlm.nih.gov / ) (>NC_010450.4:c85740980-85665963Sus scrofa isolateTJ Tabasco breedDuroc chromosome 8,Sscrofa11.1,whole genome shotgun sequence), and the region from 2208 bp upstream of the start codon to 298 bp downstream of the start codon was used as the target sequence. Primers were designed using Premier 5.0, and the designed primer sequences were submitted to General Biotechnology (Anhui) Co., Ltd. for synthesis.

[0095] In this experiment, the above region was divided into four sections and four pairs of primers IL-15-1, IL-15-2, IL-15-3, and IL-15-4 were designed for amplification respectively. The primer sequence information is shown in Table 1.

[0096] Table 1 Primer design information of porcine IL-15 gene

[0097]

[0098] 2.4 PCR-RFLP reaction system and procedure

[0099] The PCR reaction system used in this experiment is shown in Table 2 and Table 3:

[0100] Table 2 PCR reaction system

[0101]

[0102] Table 3 Genotyping restriction enzyme reaction system

[0103]

[0104] PCR reaction procedure:

[0105] 94°C, 2 min;

[0106] 94°C, 30 s, 54°C, 30 s, 72°C, 30 s, 35 cycles;

[0107] 72℃, 2min; store at 4℃;

[0108] The amplified PCR product was digested with enzymes according to the system in Table 3. The reaction system was: 37°C, 10 min.

[0109] 2.6 Agarose gel electrophoresis detection

[0110] The amplified products and the digested products were electrophoresed with 2% agarose gel at a voltage of about 120V. After electrophoresis for about 30 minutes, the gel imaging system was used for observation. The PCR products obtained by successful amplification were digested. After the digestion reaction was completed, the digested products were subjected to agarose gel electrophoresis. Different genotypes corresponded to different numbers of bands. The genotype of the sample was determined based on the number of bands of each sample in the electrophoresis results.

[0111] 3. Experimental results

[0112] 3.1SNP screening

[0113] Samples with extreme IMF content were selected from the large sample, and 14 samples were selected from the high and low groups, and each DNA template was diluted to a concentration of 100ng / μL. The DNA of the high group samples was mixed into a high H group DNA pool, and the DNA of the low group samples was mixed into a low L group DNA pool. IL-15-1, IL-15-2, IL-15-3, and IL-15-4 were used to amplify the region from 2208bp upstream of the start codon of the IL-15 gene to 298bp downstream of the start codon (as shown in SEQ ID NO.1), respectively, to obtain a total of about 2500bp fragments in the porcine IL-15 gene, and then the PCR products were sequenced (provided by Qingke Biotechnology (Nanjing) Technology Co., Ltd.). The sequencing results found that there was a SNP site in the fragment amplified by the primer pair IL-15-4 (as shown in SEQ ID NO.2), located 334bp upstream of the start codon of the IL-15 gene, which was guanine G or adenine A, respectively, as shown in SEQ ID NO. Figure 1 As shown, the SNP was named c.-334G>A.

[0114] 3.2 PCR-RFLP genotyping

[0115] For the above SNP sites, primer IL-15-4 was used for PCR amplification, and the genotype was identified by digesting the PCR product with SsiⅠ restriction endonuclease. Through agarose gel electrophoresis, the digestion products of different genotypes will show different numbers of bands: the GG genotype has two bands of 213 and 697bp, the GA genotype has three bands of 213, 697 and 910bp, and the AA genotype has one band of 910bp. According to statistics, in the 211 Duchangda three-way hybrid population, there are 100 individuals with GG genotype, 21 individuals with AA genotype, and 90 AG heterozygous types. The digestion results of some PCR products are shown as follows: Figure 2 .

[0116] 3.3 Correlation between mutation sites and backfat thickness and intramuscular fat content

[0117] The correlation between different SNP genotypes and pig backfat thickness and intramuscular fat content was analyzed. The results showed that there was a significant correlation between genotype and backfat thickness and intramuscular fat content. The backfat thickness of AA type individuals (0.9882±0.2154cm) was the highest, followed by GA type individuals (0.8949±0.1874cm), and the backfat thickness of GG type individuals (0.8881±0.1804cm) was the lowest. The backfat thickness of AA type individuals was significantly higher than that of GG type individuals (P<0.05), and there was no significant difference in backfat thickness between GA type individuals and GG type individuals; in terms of intramuscular fat content, the intramuscular fat content of GG type and GA type individuals was significantly higher than that of AG type individuals (P<0.05). Figure 3 .

[0118] 4. Results Analysis

[0119] The mutation sites screened by the present invention are significantly correlated with pig backfat thickness and intramuscular fat content, and can be developed as SNP molecular markers and used to predict the differences in backfat thickness and intramuscular fat content between pigs of different genotype groups.

[0120] The present invention screened a SNP site that is simultaneously related to pig backfat thickness and intramuscular fat content upstream of the start codon of the IL-15 gene, thereby obtaining functional genes and molecular genetic markers related to pig backfat thickness and intramuscular fat content. Through the molecular markers provided by the present invention, pig backfat thickness and intramuscular fat content can be efficiently and accurately identified at the same time, and then the meat production performance of the pig can be judged, which has significant application value in the selection and breeding of breeding pigs, and provides a reliable reference for the improvement and breeding of high-yield and high-quality pig breeds.

[0121] It can be known that the above embodiments are only exemplary implementations used to illustrate the principles of the invention, but the present invention is not limited thereto. Those skilled in the art can make various improvements and changes without departing from the essence of the present invention, and these improvements and changes also fall within the scope of protection of the present invention.

[0122] SEQ ID NO.1

[0123] GCTTCACCCATGGCACACGTGGAAGTCCCTGGGCCAGGGATCGAACACCAGCTGCAGCAGTAACCAGAG CCACAGCAGTGATAATACCAGATCTTTAACCCACTGAGCTACCAGGAAACTCCTGGTTTAGATTTTTAA AGCCACACTCTGGCTACCATATTGAGAAAGACTGGGTGTGGGGAAGCACGGGCTTGGGGAAGCACGGGC TTGGGGAAATGAGCTGGGCGGAAAGTTGCTACAATAATCCAGGATAACAATAATGGAGATGGAGAGAAG GTTATGTTTT

[0124]

[0125] SEQ ID NO.2

[0126]

[0127]

Claims

1. Use of a substance for detecting SNP site polymorphism or genotype on the IL-15 gene in the pig genome in any of the following: (a1) Application in identifying or assisting in identifying pig backfat thickness and intramuscular fat content; (a2) Application in the preparation of products for identifying or assisting in the detection of pig backfat thickness and intramuscular fat content; (a3) Application in assisting the selection of pigs with low back fat thickness and high intramuscular fat content; The SNP site is located 334 bp upstream of the start codon of the IL-15 gene, and the genotype of the SNP site is GG, AG or AA.

2. The use according to claim 1, characterized in that: The substance is (b1) or (b2) or (b3) as follows: (b1) PCR primers for amplifying a pig genomic DNA fragment containing the SNP site; (b2) a PCR reagent containing the PCR primers described in (b1); (b2) A kit containing the PCR primers described in (b1) or the PCR reagents described in (b2).

3. The use according to claim 2, characterized in that: The PCR primers include an upstream primer IL-15-4F and a downstream primer IL-15-4R: IL-15-4F:5'-TCAATAACAAAGGGAATCAGA-3' IL-15-4R: 5'-ACAACTTCAGGGAGTAGCG-3'.

4. The use according to claim 1, characterized in that: The SNP loci were genotyped and the intramuscular fat content of GG and GA type individuals was significantly higher than that of AA type individuals. Meanwhile, the back fat thickness of GG type individuals was significantly lower than that of AA type individuals.

5. Use of the PCR primers described in claim 2 or 3 in the preparation of a product for detecting the polymorphism or genotype of the SNP site described in claim 1.

6. A product, characterized in that The product contains the substance described in claim 2 or the PCR primer described in claim 3.

7. A method for identifying or assisting in identifying pig backfat thickness and intramuscular fat content, characterized in that: Detect the polymorphism or genotype of the SNP site on the IL-15 gene in the pig genome of claim 1; the intramuscular fat content of GG and GA type individuals is significantly higher than that of AA type individuals, and the back fat thickness of GG type individuals is significantly lower than that of AA type individuals.

8. A method for breeding pigs with low back fat thickness and high intramuscular fat content, characterized in that: Detect the polymorphism or genotype of the SNP site on the IL-15 gene in the pig genome of claim 1; retain the GG homozygous genotype individuals, eliminate the GA heterozygous genotype individuals and the AA homozygous genotype individuals, and select the individuals with low back fat thickness and high intramuscular fat content in pigs from generation to generation.

9. The method according to claim 7 or 8, characterized in that: The method for detecting the polymorphism or genotype of the SNP site on the IL-15 gene in the pig genome is as follows: using the pig genome DNA to be tested as a template, and performing PCR amplification using the PCR primers described in claim 2 or 3 or the product described in claim 6; performing enzyme digestion typing on the amplified fragments by the PCR-RFLP-SsiI method, and the enzyme digestion products of different genotypes will present different numbers of bands: the AA genotype has one band of 910 bp; the GG genotype has two bands of 213 and 697 bp; and the GA genotype has three bands of 213, 697 and 910 bp.

10. A molecular marker comprising the SNP site according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.2, and the SNP site is located 334 bp upstream of the start codon of the IL-15 gene in the SEQ ID NO.2 sequence.

Images