Molecular markers, primers and their applications for identifying the fruit color of Actinidia arguta

Abstract

The present invention discloses a molecular marker, primer and application thereof for identifying the color of Actinidia arguta fruit. The molecular marker of the present invention is located at 495bp upstream of the start codon of the AaLDOX gene promoter region of Actinidia arguta, which is a 29bp Indel variation. Utilizing the molecular marker and method of the present invention, the fruit color can be quickly and accurately identified in the childhood stage of Actinidia arguta by conventional molecular test detection, and the red and green Actinidia arguta germplasm resources can be efficiently distinguished. The method can be used for parent selection and seedling identification of offspring, greatly improving the efficiency and accuracy of selective breeding. The method of the present invention can be detected in each tissue, organ and each developmental stage of the plant, and has the advantages of being convenient and fast, having good specificity, high accuracy, and being unaffected by climate and environment. It can be applied to the precise, directional and efficient breeding of red Actinidia arguta, and has a large application value.

Description

Technical Field

[0001] The invention belongs to the technical field of artificial cultivation and molecular markers of kiwifruit, and particularly relates to a molecular marker, a primer, an application thereof and a kit for identifying the fruit color of Actinidia arguta. The molecular marker and the primer of the invention can be used for the identification of the fruit color and variety cultivation of Actinidia arguta. Background Art

[0002] Kiwifruit is an important fruit tree originating in my country, ranking first in the world in both cultivated area and yield. Appearance is a key quality trait of kiwifruit. With rising living standards, the market urgently needs new kiwifruit varieties that are "attractive, delicious, and healthy." Red soft-fleshed kiwifruit, with its vibrant appearance and rich content of antioxidants such as anthocyanins, is highly sought after by consumers. However, due to limitations in breeding methods and techniques, the number of currently cultivated red soft-fleshed kiwifruit varieties is limited, failing to meet the growing market demand. Furthermore, in actual cultivation, most red soft-fleshed kiwifruit suffer from poor coloration. Therefore, the selection and breeding of new red soft-fleshed kiwifruit varieties is crucial for promoting the rapid, high-quality, and efficient development of the kiwifruit industry.

[0003] Kiwifruit is a perennial fruit tree, requiring a long juvenile period from seeding to fruiting. Therefore, conventional hybrid breeding is time-consuming and labor-intensive, with a long offspring selection cycle and low efficiency. Furthermore, kiwifruit is a dioecious tree, making paternal selection relatively unpredictable, further complicating cultivar selection. With the advancement of biotechnology, molecular marker-assisted breeding has become an effective means of improving breeding efficiency. However, to date, efficient molecular markers are lacking for the selection of new red kiwifruit varieties. Summary of the Invention

[0004] In order to solve the problem that traditional breeding methods and conventional hybrid breeding methods are difficult to quickly and accurately identify the color of the fruit skin of soft-fleshed kiwifruit before the kiwifruit bears fruit, and to improve the breeding efficiency of soft-fleshed kiwifruit, the present invention has developed a new and effective molecular marker and related primers for identifying the color of soft-fleshed kiwifruit fruit, and provides a molecular marker detection kit for identifying the color of soft-fleshed kiwifruit fruit. The molecular marker and detection kit of the present invention can be applied to the precise, targeted and efficient breeding of red soft-fleshed kiwifruit.

[0005] In the present invention, based on extensive genetic breeding research conducted previously on kiwifruit, the inventors used transcriptome technology to analyze the expression profile data of all structural gene transcripts in the anthocyanin biosynthesis pathway of Actinidia arguta fruit. They discovered a transcript c120031_g1 / g3 that is closely associated with fruit color. The gene function is annotated as leucoanthocyanidin dioxygenase (LDOX), which catalyzes the synthesis of leucoanthocyanidins into colored anthocyanidins. By splicing the c120031_g1 / g3 / g4 / g5 coding sequences from the transcriptome data and removing the overlapping sequences before and after, we finally obtained a 1068bp coding region sequence, namely the AaLDOX gene sequence. Considering that most gene expression differences originate from transcriptional regulation in the upstream promoter region, we designed a haplotype analysis experiment for the AaLDOX gene promoter structure. The results showed that there is a rich Indel variation segment upstream of AaLDOX, among which an Indel variation at position -495 upstream of the initial codon is closely associated with fruit color traits. Furthermore, we verified through cultivated varieties, selected lines and natural populations that this Indel can effectively distinguish the red and green traits of fruits.

[0006] Based on the existing distribution of soft-fleshed kiwifruit resources, red soft-fleshed kiwifruit is mostly distributed in central Henan Province, while green soft-fleshed kiwifruit is mostly distributed in Northeast my country. Low temperature is an important environmental induction factor that promotes species formation. Therefore, we speculate that red soft-fleshed kiwifruit was induced by low temperature during its northward migration, and Indel mutation occurred in the AaLDOX promoter region, forming green soft-fleshed kiwifruit. During this process, some individual materials did not have time to complete the evolution from molecular to phenotypic, thus forming some intermediate types of fruits with red skin and green flesh.

[0007] Specifically, in the first aspect, the present invention provides a molecular marker for identifying the fruit color of Actinidia arguta. The molecular marker is located -495bp upstream of the start codon in the promoter region of the AaLDOX gene of Actinidia arguta. It is a 29bp Indel variation, and its sequence is shown in SEQ ID NO: 6. The molecular marker is used to identify the fruit color of Actinidia arguta.

[0008] Furthermore, the gene sequence of AaLDOX where the above molecular marker is located is shown in SEQ ID NO: 5, and the method for obtaining it is as follows:

[0009] The transcript sequences of the colorless anthocyanin dioxygenase encoding gene in the transcriptome data of Actinidia arguta were analyzed, and four differentially expressed transcripts were screened out, namely c120031_g1, whose sequence is shown in SEQ ID NO: 1, c120031_g3, whose sequence is shown in SEQ ID NO: 2, c120031_g4, whose sequence is shown in SEQ ID NO: 3, and c120031_g5, whose sequence is shown in SEQ ID NO: 4. The AaLDOX gene sequence was then obtained by splicing the c120031_g1 / g3 / g4 / g5 coding sequences in the transcriptome data and removing the overlapping regions at the front and back ends.

[0010] Furthermore, the upstream primer sequence of the above molecular marker is F-GGCCTTTTCATGGCC TTATATAA, which is shown in SEQ ID NO: 7; the downstream primer sequence is R-GCTAGTTGGG TATATCGGTACCAA, which is shown in SEQ ID NO: 8.

[0011] In addition, the present invention also relates to the application of the above-mentioned molecular marker detection reagent in the breeding of red-skin Actinidia arguta varieties.

[0012] In a second aspect, the present invention provides a molecular marker detection kit for identifying the color of Actinidia arguta fruit, wherein the detection kit comprises a detection reagent for the aforementioned molecular marker.

[0013] Furthermore, the above detection kit contains the following primer pairs:

[0014] Upstream primer: F-GGCCTTTTCATGGCCTTATATAA,

[0015] Downstream primer: R-GCTAGTTGGGTATATCGGTACCAA.

[0016] In a third aspect, the present invention provides a molecular marker detection method for identifying the color of Actinidia arguta fruit, comprising the following steps:

[0017] (1) DNA extraction

[0018] The genomic DNA was extracted from fresh leaves of Actinidia arguta using a genomic DNA extraction kit;

[0019] (2) PCR amplification

[0020] a. The reaction system includes:

[0021] Genomic DNA template, 1 μL,

[0022] 2×T5 Super Mix(PAGE), 12.5μL,

[0023] Upstream primer, F-GGCCTTTTCATGGCCTTATATAA, 1 μL,

[0024] Downstream primer, R-GCTAGTTGGGTATATCGGTACCAA, 1 μL,

[0025] Sterile water, 9.5 μL;

[0026] b. The reaction procedure is:

[0027] Pre-denaturation 94℃, 3min,

[0028] Denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 30s, for a total of 35 cycles, final extension at 72°C for 10min,

[0029] After the PCR amplification process is completed, store it in a 4°C environment;

[0030] (3) Electrophoresis pattern analysis

[0031] The target bands obtained by PCR amplification were analyzed by polyacrylamide gel electrophoresis. The materials and dosage of the large-plate gel for polyacrylamide gel electrophoresis were as follows: 61.4 mL of water, 28 mL of 30% gel preparation solution, 10 mL of 10×TBE solution, 66 μL of TEMED gel promoter, and 700 μL of 10% APS. The sample volume per well was 1.2 μL. The electrophoresis was set to a constant voltage of 160 V for 2 hours and 10 minutes. The marker used was 600 bp, and from bottom to top, it was 50, 100, 150, 200, 300, 400, 500, and 600 bp. The steps of silver staining included: fixing with 500 mL of water for 5 seconds, and then staining with 500 mL of water for 5 seconds. The fruit was infiltrated with 0.2% silver nitrate aqueous solution for 8 minutes, then rinsed twice with 500 mL of water, each time for 1 minute, and finally developed with 500 mL of water + 8 g of sodium hydroxide + 4 mL of formaldehyde solution until the bands were clear. The identification results showed that the homozygous fruit was red Actinidia arguta, and the heterozygous fruit was green Actinidia arguta.

[0032] In addition, the present invention also provides a molecular marker detection method for identifying the color of Actinidia arguta fruit, which includes the step of detecting the aforementioned molecular markers.

[0033] In summary, the present invention proposes for the first time a new molecular marker and related primers for identifying the fruit color of Actinidia arguta, and provides a molecular marker detection kit for identifying the fruit color of Actinidia arguta. The molecular marker and detection kit of the present invention can be applied to the precise, targeted, and efficient breeding of red Actinidia arguta. Utilizing the molecular markers and methods of the present invention, the fruit color of Actinidia arguta can be quickly and accurately identified during the juvenile stage through conventional molecular testing, effectively distinguishing between red and green Actinidia arguta germplasm resources, which can be used for parent selection and seedling identification of offspring, greatly improving the efficiency and accuracy of selective breeding. In comparison, in traditional breeding methods, the fruit color of Actinidia arguta cannot be determined before the fruit is harvested. Due to the long breeding cycle and low screening efficiency, the breeding cost of red Actinidia arguta is high. However, by detecting molecular markers linked to fruit color through the method of the present invention, detection can be performed in various tissues, organs, and developmental stages of the plant, not only saving production costs but also greatly improving selection efficiency. In addition, the molecular marker detection method of the present invention also has the advantages of being convenient and fast, having good specificity, high accuracy, and being unaffected by the climatic environment, and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0035] Figure 1 The results of anthocyanin biosynthesis gene expression profiling are shown in the figure: (A) S1: Early color change, 70 days after full flowering, the fruit is green; S2: Color change, 100 days after full flowering, the fruit is light red; S3: Late color change, 130 days after full flowering, the fruit is dark red. The red and blue colors in the heat map indicate the expression levels of transcripts, with red indicating high expression and blue indicating low expression. The solid red arrows indicate two specific transcripts, c120031_g1 and c120031_g3, that are highly expressed during the color change and late color change periods. The purple box represents all LDOX transcripts. (B) Anthocyanin biosynthesis pathway, in which LDOX is a late synthesis gene.

[0036] Figure 2This figure shows the results of haplotype analysis of the AaLDOX promoter indels in Actinidia arguta. Red Actinidia arguta varieties include 'HBSX', 'SDW', 'NDY', 'RB-4', 'ZG', 'RB-3', 'LC-2', 'YF-1', and '11-19'; green Actinidia arguta varieties include 'KL', 'CJ-1', 'HY-1', 'WC18-02', and 'YF-5'. Indel-Hap represents haplotypes classified based on indel mutations, which can be divided into 13 different haplotypes.

[0037] Figure 3 Figure 1 shows fruit types and indel validation results for Actinidia arguta. (A) Actinidia arguta is divided into three types based on coloring; (B) Indel validation results in developed varieties and candidate lines; first row: 10 red varieties, 6 green varieties; second row: 9 red candidate lines; (C) Indel validation results in 108 natural populations.

[0038] Figure 4 This is a diagram showing the results of identifying male Actinidia arguta plants using the molecular markers of the present invention.

[0039] Figure 5 Schematic diagram of the speculated evolutionary route. DETAILED DESCRIPTION

[0040] In order to make the purpose and technical solution of the present invention more clearly understood, the present invention is further described in detail below with reference to specific embodiments. Those skilled in the art can easily understand other advantages of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0041] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific embodiments rather than for limiting the scope of protection of the present invention.

[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art. In the present invention, unless otherwise specified, all instruments, reagents, and raw materials are commercially available or commonly used in the art. The methods described in the following examples are conventional methods in the art unless otherwise specified.

[0043] Example 1: Experiment on obtaining molecular markers for identifying the color of Actinidia arguta fruit

[0044] (1) Analysis of the structural gene expression profile of anthocyanin synthesis pathway in Actinidia arguta fruit

[0045] Based on extensive genetic breeding research conducted in the early stages of kiwifruit, the inventors performed high-throughput transcriptome sequencing using fruit samples from the red kiwifruit 'Tianyuanhong' at the three coloring stages of S1, S2, and S3. Three biological replicates were performed for each stage. The red color of kiwifruit fruit originates from the synthesis of anthocyanins. By analyzing the expression levels of all anthocyanin synthesis gene transcripts in the transcriptome, we found that during the fruit coloring process, only c120031_g1 / g3 was lowly expressed in green fruit and highly expressed in red fruit, indicating that c120031_g1 / g3 was closely related to the fruit coloring result, while the other gene transcripts were at lower expression levels ( Figure 1 A). Gene functional annotation: c120031_g1 / g3 is a gene encoding leucoanthocyanidin dioxygenase, which catalyzes the synthesis of leucoanthocyanidins into colored anthocyanidins and is a key structural gene in the anthocyanidin biosynthesis pathway ( Figure 1 B).

[0046] (2) AaLDOX full-length transcript splicing

[0047] Analysis of the c120031_g1 transcript sequence in the transcriptome data revealed four differentially expressed transcripts: c120031_g1 (SEQ ID NO: 1), c120031_g3 (SEQ ID NO: 2), c120031_g4 (SEQ ID NO: 3), and c120031_g5 (SEQ ID NO: 4). The complete AaLDOX sequence (SEQ ID NO: 5) was obtained by splicing the overlapping regions at the front and back ends. The sequence is 1068 bp long.

[0048] (3) Indel haplotype analysis of the AaLDOX promoter region

[0049] Differential gene expression often results from regulation of the promoter region upstream of the ATG. Therefore, we collected 14 accessions (9 red and 5 green) of the red and green Actinidia arguta kiwifruit cultivars from the National Horticultural Germplasm Resource Bank, Kiwifruit Branch (Zhengzhou) for promoter cloning and analysis. Genomic DNA was first extracted from young leaves using a genomic DNA extraction kit (Huayueyang Company, Beijing). The promoter region upstream of the ATG was amplified using homologous cloning. The primers used were: F-GGATGGGATTGAACATGAGGA, R-GTTCCGACCACTGTTGCCA. The amplification system consisted of 25 μL of high-fidelity enzyme mix, 5 μL of genomic DNA template, 2 μL of upstream primer, 2 μL of downstream primer, and 16 μL of sterile water. The PCR protocol was: 94°C for 5 min, 94°C for 30 s, 60°C for 30 s, and 72°C for 45 s, for 32 cycles, and 72°C for 5 min. After 1% agarose gel electrophoresis, a single bright band was excised and recovered using the Thermo Fisher gel extraction kit. The fragment was then ligated to a T-vector (Novagen T-vector). 4 μL of the recovered product was added to 1 μL of the mix, for a total of 5 μL, and incubated at 37°C for 5 min. DH5α competent E. coli cells were then transformed, plated on LB plates containing ampicillin, and cultured overnight. Single clones were selected for Sanger sequencing. Analysis of sequencing results from different single clones revealed a high abundance of indel variants in the AaLDOX promoter region, primarily including the following seven types: T / CAACATTTCC, GAAATCGAACAAATTCAAGTTG, AACTAAGAGA, TTTGGCCTTGTTATGTTGTTGTGAATACT / TC, TTCTTGTTCTGATTGTAAT, TAAAGTTGGGGCATATACAGTGAGTGGG, and TCTCACATAATTGTCACAAA / G. According to the chromosomal distribution of the above 7 indels on different Actinidia arguta, the promoter region can be divided into 13 different indel haplotypes. Through association analysis between fruit color phenotype and indels, we found a 29bp indel variant (i.e., TTTGGCCTTGTTATGTTGTTGTGAATACT / TC, SEQ ID NO: 6) in the -495bp region upstream of the AaLDOX start codon. This indel was homozygous in all 9 red Actinidia arguta and heterozygous in all 5 green Actinidia arguta ( Figure 2 ), indicating that this Indel is closely related to the red and green traits of Actinidia arguta fruit.

[0050] (4) Population verification of indel mutations

[0051] Soft-fruited kiwifruit can be divided into three categories according to the different coloring parts: red skin and red flesh (i.e. all red), red skin and green flesh (i.e. intermediate type, very few), green skin and green flesh (i.e. all green) ( Figure 3 A). Generally, the red and green kiwifruit we refer to are mostly all-red and all-green varieties; intermediate varieties are very rare. To verify the accuracy of this indel, we selected 135 accessions, including 18 cultivated varieties, 9 selected lines, and 108 natural populations. Primers were designed at both ends of the indel variant: F-GGCCTTTTCATGGCCTT ATATAA (SEQ ID NO: 7) and R-GCTAGTTGGGTATATCGGTACCAA (SEQ ID NO: 8), respectively. The PCR system consisted of 12.5 μL of 2× T5 Super Mix (PAGE), 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of genomic DNA template, and 9.5 μL of sterile water, for a total of 25 μL. The PCR program was as follows: 94°C for 3 min, 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s, for a total of 35 cycles, followed by 72°C for 10 min. The following materials and amounts of polyacrylamide gel electrophoresis were used: 61.4 mL of water, 28 mL of 30% gel preparation solution, 10 mL of 10× TBE, 66 μL of TEMED (gelling agent), and 700 μL of 10% APS. The sample volume per well was 1.2 μL. Electrophoresis was performed at a constant voltage of 160 V for 2 hours and 10 minutes. The markers used were 600 bp, with the following markers from bottom to top: 50, 100, 150, 200, 300, 400, 500, and 600 bp. The specific process of silver staining is: fixation, penetration, rinsing and color development, that is, fixation with 500 mL of water for about 5 seconds, penetration with 0.2% silver nitrate aqueous solution (500 mL of water + 1 g of silver nitrate) for 8 minutes, rinsing twice with 500 mL of water for 1 minute, and color development with 500 mL of water + 8 g of sodium hydroxide + 4 mL of formaldehyde solution until the bands are clear. From the identification results, it can be seen that the 10 red varieties of the bred varieties are all homozygous, the 8 green varieties are all heterozygous, and the 9 red superior lines are all homozygous ( Figure 3 B). The 108 natural populations included 52 red kiwifruits and 56 green kiwifruits. The typing results showed that among the 52 red kiwifruits, 42 were homozygous and 10 were heterozygous. Among the 56 green kiwifruits, 43 were heterozygous and 13 were homozygous. That is, most red ones were homozygous and most green ones were heterozygous. Figure 3C) After integrating all identification results, a total of 135 accessions were found, of which 112 matched the indel typing criteria and 23 did not, for an accuracy rate of 82.97%. In fact, among the 108 natural populations, the non-matching red types were mostly intermediate types with red skin and green flesh, such as Actinidia arguta (6-2-31), 6-17-64, 6-20-24, 6-22-47, 6-22-76, and 6-23-73. If these intermediate types were manually removed, the accuracy of the indel markers would reach 87.4%.

[0052] Example 2: Application of the molecular markers of the present invention in kiwifruit breeding

[0053] Application Example 1: Male Plant Identification

[0054] Kiwifruit is a dioecious fruit tree, and male plants only bloom but do not bear fruit. Therefore, in hybrid breeding, the selection of male plants is often blind. For example, in red breeding, it is usually necessary to select a red female parent and a red male parent as hybrid parents. However, since the fruit traits of the male parent are unknown, the selection of the male parent is often random and blind, and then reversed through the hybrid offspring, which consumes a lot of time and energy and has low breeding efficiency. The Indel we developed can be used to identify the red and green of existing male plants in advance to determine their fruit color traits. We used this Indel to conduct red and green identification on the male plants of Actinidia arguta in the National Horticultural Germplasm Resource Bank-Kiwifruit Branch, and determined that among the 17 male plants, there were 12 red male plants and 5 green male plants ( Figure 4 During the flowering period of the second year, red or green pollen will be collected and hybrid combinations will be prepared.

[0055] Application Example 2: Offspring Selection

[0056] In the spring of 2022, we selected three directional hybrid combinations: CJ-1×11-17, HY1×11-17, and WC18-02×11-17. The female and male parents of these hybrid combinations had been pre-selected using an indel marker. The female parents were all heterozygous for green Actinidia chinensis, while the male parents were homozygous for red Actinidia chinensis. Before transplanting the hybrid seedlings to the garden in the spring of 2023, we will use this indel marker to select for their progeny, eliminating the green progeny and retaining only the red progeny. This will ensure that all transplanted kiwifruit are red, greatly accelerating the breeding process for red Actinidia chinensis.

[0057] Presumed evolutionary path

[0058] Based on the existing distribution of Actinidia arguta resources, red Actinidia arguta is mostly distributed in central Henan, while green Actinidia arguta is mostly distributed in Northeast my country. Low temperature is an important environmental induction factor that promotes speciation. Therefore, we speculate that during the process of northward migration, red Actinidia arguta was induced by low temperature, and Indel mutation occurred in the AaLDOX promoter region, forming green Actinidia arguta. During this process, some individual materials did not have time to complete the molecular to phenotypic evolution, forming some intermediate types of fruits with red skin and green flesh ( Figure 5 ).

[0059] The preferred specific implementation modes and embodiments of the present invention are described in detail above, but the present invention is not limited to the above implementation modes and embodiments. Various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the concept of the present invention.

Claims

1. A molecular marker detection method for identifying the fruit color of Actinidia arguta, characterized in that: The molecular marker is located at -495 bp upstream of the start codon in the promoter region of the AaLDOX gene of Actinidia arguta, and is a 29 bp Indel mutation, the sequence of which is shown in SEQ ID NO: 6; The method comprises the following steps: (1) DNA extraction The genomic DNA was extracted from fresh leaves of Actinidia arguta using a genomic DNA extraction kit; (2) PCR amplification a. The reaction system includes: Genomic DNA template, 1 μL, 2×T5 Super Mix (PAGE), 12.5μL, Upstream primer, F-GGCCTTTTCATGGCCTTATATAA, 1 μL, Downstream primer, R-GCTAGTTGGGTATATCGGTACCAA, 1 μL, Sterile water, 9.5 μL; b. The reaction procedure is: Pre-denaturation 94℃, 3min, Denaturation at 94°C for 30s, annealing at 58°C for 30s, and extension at 72°C for 30s, for a total of 35 cycles. Final extension at 72°C for 10 min. After the PCR amplification process is completed, store it in a 4°C environment; (3) Electrophoresis pattern analysis The target bands obtained by PCR amplification were analyzed by polyacrylamide gel electrophoresis. The materials and dosage of the large-plate gel for polyacrylamide gel electrophoresis were as follows: 61.4 mL of water, 28 mL of 30% gel preparation solution, 10 mL of 10×TBE solution, 66 μL of TEMED gel promoter, and 700 μL of 10% APS. The sample volume per well was 1.2 μL. The electrophoresis was set to a constant voltage of 160 V for 2 hours and 10 minutes. The marker used was 600 bp, and from bottom to top, it was 50, 100, 150, 200, 300, 400, 500, and 600 bp. The steps of silver staining included: fixing with 500 mL of water for 5 seconds, and then staining with 500 mL of water for 1 second. The fruit was infiltrated with 0.2% silver nitrate aqueous solution for 8 minutes, then rinsed twice with 500 mL of water, each time for 1 minute, and finally developed with 500 mL of water + 8 g of sodium hydroxide + 4 mL of formaldehyde solution until the bands were clear. The identification results showed that the homozygous fruit was red Actinidia arguta, and the heterozygous fruit was green Actinidia arguta.

Images