SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 4 and related to waistline and application of SNP molecular marker

Abstract

The invention discloses a waistline-related SNP molecular marker located on a pig chromosome 4 and application of the SNP molecular marker, the site of the SNP molecular marker is located at the 134 site from the 5'terminal of a nucleotide sequence shown in SEQ ID NO: 1 and corresponds to the 22721111bp site on the chromosome 4 of the international pig reference genome version 11.1, and Cgt exists at the site; t mutation. The SNP molecular marker provided by the invention is remarkably related to the waistline character of the pig, the identification of the waistline character of the pig can be realized by identifying the genotype of the SNP molecular marker, and the breeding process of the pig can be accelerated and the genetic improvement of the pig can be realized by breeding the pig with the genotype of the SNP molecular marker CC.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology and relates to a SNP molecular marker associated with pig waist circumference and an application thereof. The SNP molecular marker is located on pig chromosome 4. Background Art

[0002] At present, pig breeding is mainly based on large-weight lean pigs, and lean pigs suitable for large-weight listing are the main breeding target. Waist circumference phenotype is an important indicator for selecting and retaining large-weight lean pigs. In actual production, pigs with large waist circumference often have higher growth performance and better economic benefits. For decades, people have used traditional breeding methods to obtain excellent breeding pigs with higher market weight. However, waist circumference is a complex quantitative trait that is regulated by multiple genes. And the waist circumference trait needs to meet the measurement requirements after the pig grows to a certain age. Therefore, it is impossible to achieve early selection and retention by improving quantitative traits through traditional breeding methods, which is time-consuming and has little effect. Summary of the invention

[0003] The purpose of the present invention is to provide a SNP molecular marker located on pig chromosome 4 and related to waist circumference and application thereof.

[0004] According to one aspect of the present invention, a SNP molecular marker related to waist circumference and located on pig chromosome 4 is provided, wherein the site is located at the 134th position from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to the 22721111bp on chromosome 4 of the international pig reference genome version 11.1, and there is a C>T mutation (single base mutation, named: g.22721111C>T) at this site, the nucleotide type is C or T, and the genotype of the SNP molecular marker is CC, CT or TT.

[0005] The SNP molecular marker provided by the present invention is significantly correlated with the waist circumference trait of pigs, wherein the waist circumference of pigs with genotype CC is significantly greater than the waist circumference of pigs with genotype CT and genotype TT. By identifying the single nucleotide polymorphism of the SNP molecular marker and / or the genotype of the SNP molecular marker, the waist circumference trait of pigs can be identified, and by breeding pigs with the SNP molecular marker genotype CC, the breeding process of pigs can be accelerated to achieve genetic improvement of pigs.

[0006] Therefore, the SNP molecular markers related to waist circumference on pig chromosome 4 provided by the present invention can be applied to:

[0007] (1) Identification of pig waist circumference traits;

[0008] (2) preparing products for identifying pig waistline traits;

[0009] (3) Pig genetic improvement, based on the selection of pigs with SNP molecular marker genotype CC to achieve pig genetic improvement;

[0010] (4) Prepare a product for assisting pig genetic improvement, wherein the product assists pig genetic improvement based on identifying pig SNP molecular marker genotypes.

[0011] In some embodiments, the pig is preferably a Duroc strain and its synthetic strains.

[0012] According to another aspect of the present invention, a primer pair is provided, which can specifically amplify an amplified fragment containing the 134th single nucleotide polymorphism from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0013] The primer pair provided by the present invention can specifically amplify an amplified fragment containing the SNP molecular marker related to waist circumference located on pig chromosome 4 provided by the present invention, and can be used to identify whether the 134th single nucleotide from the 5' end in the nucleotide sequence shown in SEQ ID NO: 1 is C or T. Therefore, the primer pair provided by the present invention can be used to identify the genotype of the SNP molecular marker related to waist circumference located on pig chromosome 4 and / or to prepare a product for identifying the genotype related to waist circumference located on pig chromosome 4.

[0014] According to a third aspect of the present invention, a kit is provided, comprising a primer pair having nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0015] Applications of the primer pairs and kits provided by the present invention include but are not limited to:

[0016] (1) Identify the genotype of the SNP molecular markers on porcine chromosome 4 that are associated with waist circumference;

[0017] (2) preparing a product for identifying the genotype of a SNP molecular marker located on porcine chromosome 4 and associated with waist circumference;

[0018] (3) Identifying the waist circumference trait of pigs, based on identifying the genotype of a SNP molecular marker associated with waist circumference located on chromosome 4 of pigs;

[0019] (4) preparing a product for identifying the waist circumference trait of pigs, wherein the product is based on identifying the genotype of a SNP molecular marker associated with waist circumference located on chromosome 4 of pigs to achieve identification of the waist circumference trait of pigs;

[0020] (5) Pig genetic improvement, based on breeding pigs with CC genotype of SNP molecular marker associated with waist circumference on chromosome 4;

[0021] (6) Prepare a product for assisting pig genetic improvement, wherein the product assists pig genetic improvement based on identifying the SNP molecular marker genotype associated with waist circumference located on chromosome 4 of the pig.

[0022] In some embodiments, the kit provided by the present invention may also include: dNTPs, DNA polymerase, Mg 2+ The components of conventional PCR reaction systems such as PCR reaction buffer and PCR reaction buffer can be directly referenced or used for the relevant components of conventional commercially available PCR amplification kits.

[0023] According to a fourth aspect of the present invention, there is provided a method for genetic improvement of pigs, comprising the following steps:

[0024] (1) Determine the genotype of the SNP molecular marker associated with waist circumference located on chromosome 4 of pigs;

[0025] (2) Select individuals with the CC genotype of the SNP molecular marker and eliminate individuals with the CT and TT genotypes, thereby increasing the frequency of the allele C at this site generation by generation; thereby improving the waist circumference of future generations of pigs and increasing the meat production of future generations of pigs.

[0026] In some embodiments, in step (1), the method for determining the genotype of a SNP molecular marker associated with waist circumference located on chromosome 4 of a pig comprises the following steps:

[0027] The whole genome DNA of the pig is extracted, PCR amplification is performed using the primer pair with nucleotide sequences such as SEQ ID NO: 2 and SEQ ID NO: 3, the amplified product is sequenced, and the genotype of the SNP molecular marker related to waist circumference located on chromosome 4 of the pig is determined based on the sequencing results.

[0028] In some embodiments, the pig is a Canadian Duroc and its synthetic line. Duroc, as the terminal paternal parent of Duroc × Landrace × Large White commercial pigs, is directly related to the economic benefits of pig farming companies. Therefore, improving the waist circumference of the core group Duroc pigs can largely pass on the advantages obtained from the improvement to the offspring of commercial pigs, enhance the production competitiveness of commercial pigs, and thus improve the economic benefits of the farm.

[0029] Compared with the prior art, the beneficial effects of the present invention include:

[0030] (1) The present invention provides a SNP molecular marker related to waist circumference located on the nucleotide sequence of pig chromosome 4, and verifies its effect on the waist circumference trait of pigs, which is helpful to establish a molecular marker-assisted selection breeding technology for rapid improvement of pig waist circumference traits, improve the breeding process of Duroc and its synthetic lines, so as to meet the needs of the breeding pig market, increase the price of breeding pigs, and reduce breeding costs.

[0031] (2) The present invention provides a primer pair that can be used to identify SNP molecular markers related to waist circumference located on chromosome 4 of pigs. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits and accelerate the breeding process.

[0032] (3) The present invention provides a method for pig genetic improvement by preferentially selecting the dominant allele of a SNP molecular marker related to waist circumference located on chromosome 4 of the pig. By preferentially selecting the dominant allele of the SNP, the frequency of the dominant allele can be increased from generation to generation, thereby increasing the waist circumference of the breeding pigs and indirectly increasing the weight of the breeding pigs, accelerating the progress of pig genetic improvement, and thus effectively improving the economic benefits of breeding pigs. Specifically, all TT-type or CT-type individuals with SNP molecular markers that affect the waist circumference trait of pigs are selected and bred into CC-type individuals. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a genome-wide association study (GWAS) analysis of waist circumference on chromosome 4 in the Canadian Duroc line;

[0034] Figure 2 This is the analysis of the waist circumference phenotype ratio of pigs with different genotypes, where ns means P>0.05; ** indicates P < 0.01; *** Indicates P<0.001. DETAILED DESCRIPTION

[0035] The present invention is further described in detail below in conjunction with the embodiments. The examples are only for explanation and are not intended to limit the present invention in any way. Unless otherwise specified, the raw materials and reagents used in the examples are conventional products that can be obtained commercially; the experimental methods in the examples where specific conditions are not specified are usually carried out according to conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0036] Example 1 Identification and verification of SNP loci associated with pig waist circumference

[0037] (1) Experimental pig herd

[0038] The experimental pig population used in the present invention is a purebred Canadian Duroc pig from the pig breeding branch of Wen's Food Group Co., Ltd., which is the core group of the pig breeding branch, and the herd pedigree is recorded in detail. In this experiment, a total of 2080 Canadian Duroc pigs from the resource group were selected, and the pigs were free to eat and drink water, and the entire feeding method, feeding conditions, etc. were always kept consistent, which is a conventional method.

[0039] Phenotypic measurement: The phenotypic measurement of the pig waist circumference of the present invention is accurately measured with a soft tape measure according to the method, with an accuracy of cm. When the live weight of the pig reaches 100±5kg, it is fasted for 24 hours. The pig needs to be restrained before measurement, and the pig is naturally standing, and the soft tape measure is gently pressed against the body surface for measurement. The measurement method is as follows:

[0040] Waist circumference: The vertical circumference measured at the waist (front edge of the hind leg area).

[0041] (2) Extraction of pig genomic DNA

[0042] The ear tissues or tail-docked tissues of the above 2080 Canadian Duroc pigs were collected, immersed in an ethanol solution with a volume fraction of 75%, and stored in a -20°C refrigerator for later use.

[0043] The whole genome DNA of pigs was extracted by the standard phenol-chloroform method, and the concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined by Nanodrop2000 / 2000C nucleic acid protein detector. The qualified DNA samples were tested by NanoDrop2000 / 2000C nucleic acid protein detector, and the DNA was diluted to about 50ng / μL according to the tested concentration. Then 6μL of the extracted DNA sample to be tested was mixed with 2μL Loading Buffer, loaded into a 1% agarose gel with a mass volume ratio, electrophoresed at 150V for 25min, and observed and photographed under a UV spectrophotometer and gel imaging equipment to observe the integrity of the DNA.

[0044] (3) 50K SNP genotype detection of the whole pig genome

[0045] The DNA samples were sent to Neogen Biotech (Shanghai) Co., Ltd., and the genotype was determined using the porcine whole genome 50K SNP chip (Illumina, USA) on the Illumina Beadstration platform according to the company's standard procedures.

[0046] In order to increase the SNP marker density and improve the success rate of identifying key mutation sites of waist circumference traits, the present invention uses the SWIM website (http: / / 192.168.142.36:9088 / # / home) to fill the above-mentioned Canadian Duroc pig genome 50K SNP chip. The PLINK software is used to perform quality control on the genotype filling data of all samples of 50K chip, and the individual detection rate is less than 90%, the family Mendelian error rate is higher than 0.1, the minimum allele frequency is less than 0.01, and the Hardy-Weinberg equilibrium significance level is less than 10 -6 Finally, valid genotype data of 11,388,559 SNPs were obtained.

[0047] (4) Genome-wide association study (GWAS)

[0048] In order to eliminate the population stratification effect, the present invention uses linear mixed model single point regression analysis combined with R language GenABEL software package to perform GWAS analysis. The similarity of the genome between individuals is used to correct the stratification effect in the analysis model. In view of the assumption that the number of independent haplotype boxes of pigs and humans is basically the same in the genome, the present invention refers to the significance threshold of the human genome and sets the significance threshold of the association between SNP and waist circumference traits to 1×10 -6 .

[0049] GWAS analysis results Figure 1 shown.

[0050] from Figure 1 It can be seen that in the Canadian Duroc, there is a SNP locus on chromosome 4 that significantly affects waist circumference, and the strongest associated SNP is g.22721111C>T (P=9.96×10 -7 ), i.e., the 134th nucleotide from the 5' end in SEQ NO.1, corresponds to the C>T mutation at 22721111bp on chromosome 4 of the international pig reference genome version 11.1.

[0051] (5) Analyze the association between different genotypes and the waist circumference phenotype of breeding pigs to verify the effect of SNP loci on the waist circumference trait of pigs

[0052] The results are shown in Table 1. Figure 2 As shown in Table 1, Figure 2It can be seen that the molecular marker SNP site g.22721111C>T is extremely significantly correlated with the waist circumference trait (P<0.001), indicating that this molecular marker significantly affects the waist circumference of pigs. Among them, the waist circumference of pigs with the SNP molecular marker genotype CC is significantly greater than that of pigs with the CT and TT types, indicating that homozygous CC is beneficial to the waist circumference of breeding pigs. Waist circumference is an important indicator for the selection and retention of lean pigs. In actual production, pigs with large waist circumference have a larger market weight and better economic benefits. Therefore, breeding pigs with CT and TT genotypes are not conducive to the breeding goal of large weight listing. In the process of breeding, it is necessary to gradually eliminate CT and TT type breeding pigs and retain CC type breeding pigs to increase the frequency of allele C at this site from generation to generation.

[0053] Table 1 Correlation analysis between SNP site g.22721111C>T and waist circumference

[0054]

[0055] Note: Data in the same column with different lowercase letters indicate significant differences (P<0.05), and data with the same letters indicate no significant differences (P>0.05).

[0056] (6) Effect analysis

[0057] The present invention provides a SNP molecular marker significantly associated with the waist circumference trait of Duroc breeding pigs. Using the SNP molecular marker for marker-assisted selection can accelerate the waist circumference breeding process of Duroc breeding pigs. According to Table 1, the frequency of the dominant allele C of the SNP site g.22721111C>T in the population is 0.666. Therefore, through molecular marker-assisted selection, the pigs with genotypes of CT and TT in the population are gradually eliminated, which can significantly increase the allele frequency of allele C, increase the waist circumference of breeding pigs, indirectly increase the weight of breeding pigs, accelerate the improvement of lean meat pigs, and effectively improve the economic benefits of breeding pigs.

[0058] Example 2 Method for genetic improvement of pigs

[0059] The target fragment containing the SNP site significantly associated with the waist circumference trait of the Canadian Duroc is a 239bp nucleotide sequence in chromosome 4, the specific sequence of which is shown in SEQ ID NO:1, and the primer pair for PCR amplification is shown in SEQ ID NO:2 and SEQ ID NO:3.

[0060] SEQ ID NO:1

[0061] ACGTATGTGTTACAGAGCAGTATAACAAGATTCATAACAATAAGAAGAAAACAAAATAGTTCGGGTTTAATGAAAGTGGCCCTCTTTGTCTATCTAGCATATTTGATAACAATTTAAGATCTGCATTTGAAGG Y GGTGAAACGGCAGAAAATAACATTCCCTTGGTTATTATTACAAAGTGGTTAGAAAGATGAAGTAAACACCTACCTCCGATTTATTTAGTCAGCATTTTACCTAAAATATTTCCTAAACAGGCAAGTTTAAAAGGGACT

[0062] The Y marked in the sequence is the mutation site, and C or T is the allele mutation; the bold at the beginning and end of the sequence is the primer sequence binding position.

[0063] Upstream primer primer-F: 5'-ACGTATGTGTTACAGAGCAGT-3' (SEQ ID NO: 2);

[0064] Downstream primer primer-R: 5'-AGTCCCTTTTAAACTTGCCTGT-3' (SEQ ID NO: 3).

[0065] The method for genetic improvement of pigs includes the following steps:

[0066] S1. Determine the genotype of SNP molecular markers associated with pig waist circumference

[0067] (1) Collect pig ear tissue or piglet tail tissue, extract the whole genome DNA of the pig according to the standard phenol-chloroform method, and then perform quality inspection and concentration measurement on the extracted DNA.

[0068] (2) PCR amplification

[0069] Prepare a 10 μL system, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, 3.4 μL ddH2O; PCR mix can be commercially available 2×Taq PCR Star Mix (Dye) (manufacturer: GenStar, catalog number: A012-101), which includes dNTPs, DNA polymerase, Mg 2+ Components of conventional PCR reaction systems such as PCR reaction buffer.

[0070] PCR reaction program: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 64°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles, and the final extension was 72°C for 5 min.

[0071] (3) DNA sequence identification

[0072] The PCR amplification products were sequenced, and the positive and negative reactions of the gene fragments were tested. The genotype of the pig SNP site g.22721111C>T was determined based on the sequencing results.

[0073] S2. Select pigs with CC genotype at the SNP site as parents for breeding, and increase the frequency of allele C at this site generation by generation.

[0074] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the creative concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A SNP molecular marker related to waist circumference located on pig chromosome 4, characterized in that: The site of the SNP molecular marker is located at 22721111bp on chromosome 4 of the international pig reference genome version 11.1, the nucleotide type of the site is C or T, and the genotype of the SNP molecular marker is CC, CT or TT; the single nucleotide polymorphism of the SNP molecular marker site affects the waist circumference trait of pigs, wherein the waist circumference of pigs with the SNP molecular marker genotype CC is greater than the waist circumference of pigs with the genotype CT and the genotype TT.

2. The SNP molecular marker according to claim 1, characterized in that: The pigs are Canadian Duroc and its synthetic strain.

3. The use of SNP molecular markers according to claim 1 or 2, characterized in that: The applications include: (1) Identify pig waist circumference traits; (2) preparing products for identifying pig waistline traits; (3) Pig genetic improvement, based on breeding pigs with CC genotype of SNP molecular markers related to waist circumference on chromosome 4; (4) Prepare a product for assisting pig genetic improvement, wherein the product assists pig genetic improvement based on identifying the SNP molecular marker genotype associated with waist circumference located on chromosome 4 of pigs.

4. A primer pair, characterized in that The primer pair specifically amplifies an amplified fragment containing the 134th single nucleotide polymorphism from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1; wherein, The 134th position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1 is C or T, and the corresponding genotype of the SNP molecular marker related to waist circumference located on chromosome 4 of pigs is CC, CT or TT, and the waist circumference of pigs with genotype CC is greater than that of pigs with genotype CT and genotype TT; In the primer pair, the nucleotide sequence of the upstream primer is shown as SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO:

3.

5. The use of the primer pair according to claim 4, characterized in that: The applications include: (1) Identify the genotype of the SNP molecular markers on porcine chromosome 4 that are associated with waist circumference; (2) preparing a product for identifying the genotype of a SNP molecular marker located on porcine chromosome 4 and associated with waist circumference; (3) Identifying the waist circumference trait of pigs, based on identifying the genotype of a SNP molecular marker associated with waist circumference located on chromosome 4 of pigs; (4) preparing a product for identifying the waist circumference trait of pigs, wherein the product is based on identifying the genotype of a SNP molecular marker associated with waist circumference located on chromosome 4 of pigs to achieve identification of the waist circumference trait of pigs; (5) Pig genetic improvement, based on breeding pigs with CC genotype of SNP molecular marker associated with waist circumference on chromosome 4; (6) Prepare a product for assisting pig genetic improvement, wherein the product assists pig genetic improvement based on identifying the SNP molecular marker genotype associated with waist circumference located on chromosome 4 of the pig.

6. A kit, characterized in that Its composition includes the primer pair described in claim 4.

7. Use of the kit according to claim 6, characterized in that, The applications include: (1) Identify the genotype of the SNP molecular markers on porcine chromosome 4 that are associated with waist circumference; (2) preparing a product for identifying the genotype of a SNP molecular marker associated with waist circumference located on porcine chromosome 4; (3) Identifying the waist circumference trait of pigs, based on identifying the genotype of a SNP molecular marker associated with waist circumference located on chromosome 4 of pigs; (4) preparing a product for identifying the waist circumference trait of pigs, wherein the product is based on identifying the genotype of a SNP molecular marker associated with waist circumference located on chromosome 4 of pigs to achieve identification of the waist circumference trait of pigs; (5) Pig genetic improvement, based on breeding pigs with CC genotype of SNP molecular marker associated with waist circumference on chromosome 4; (6) Prepare a product for assisting pig genetic improvement, wherein the product assists pig genetic improvement based on identifying the SNP molecular marker genotype associated with waist circumference located on chromosome 4 of pigs.

8. A method for genetic improvement of pigs, characterized in that: The steps include: (1) Determine the genotype of the SNP molecular marker associated with waist circumference located on chromosome 4 of pigs; (2) Select individuals with the SNP molecular marker genotype CC, eliminate individuals with the genotypes CT and TT, and increase the frequency of the allele C at this site generation by generation; The site of the SNP molecular marker related to waist circumference on pig chromosome 4 is located at the 134th position from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to the 22721111bp on chromosome 4 of the international pig reference genome version 11.

1. The nucleotide type of this site is C or T, and the genotype is CC, CT or TT.

9. The method for genetic improvement of pigs according to claim 8, characterized in that: In step (1), the method for determining the genotype of the SNP molecular marker associated with waist circumference located on chromosome 4 of the pig comprises the following steps: The whole genome DNA of the pig is extracted, PCR amplification is performed using the primer pair with nucleotide sequences such as SEQ ID NO: 2 and SEQ ID NO: 3, the amplified product is sequenced, and the genotype of the SNP molecular marker related to waist circumference located on chromosome 4 of the pig is determined based on the sequencing results.

10. The method for genetic improvement of pigs according to claim 8 or 9, characterized in that: The pigs are Canadian Duroc and its synthetic strain.

Images