InDel molecular marker primer pair of cauliflower variety 'TX65' and application thereof

Abstract

The application discloses an InDel molecular marker primer pair of a cauliflower variety 'TX65' and application of the InDel molecular marker primer pair. The application screens difference InDel sites in a whole genome range by using parent resequencing data of the cauliflower variety 'TX65', and designs specific primers to screen an InDel molecular marker primer pair, nucleotide sequences of the InDel molecular marker primer pair are shown as SEQ ID NO. 1 and SEQ ID NO. 2. Based on a PCR amplification reaction, the InDel molecular marker primer pair can be used to quickly and accurately complete purity identification of the 'TX65' cauliflower variety or hybrid seed in a short time, the method is simple and fast, the identification result is accurate, the seed production quality of the hybrid 'TX65' can be controlled, and problems, such as long cycle, large labor input and inaccurate identification, existing in the current identification of the cauliflower 'TX65' variety are solved.

Description

Technical Field

[0001] The present invention relates to a cauliflower molecular marker primer set and its application, in particular to a cauliflower InDel molecular marker primer pair and its application in authenticity identification of cauliflower 'TX65' variety or seed purity, belonging to the field of molecular identification of authenticity or seed purity of cauliflower 'TX65' variety. Background Art

[0002] Cauliflower (Brassica oleracea var. Botrytis) is one of the world's most important vegetable varieties, beloved by consumers in both China and the West for its nutritious and delicious florets. As a representative of high-quality, healthy vegetables, its florets, composed of a fleshy stem and inflorescence meristem, are rich in vitamin C and anti-cancer glucosinolates, meeting the demand for healthy vegetables.

[0003] As the number of cauliflower varieties increases year by year, the concentrated use of a few core parents has reduced the genetic differences between varieties, making effective identification difficult. Effectively managing and identifying cauliflower varieties with similar genetic backgrounds at the source is a major challenge that needs to be addressed. Currently, cauliflower variety identification mainly relies on traditional methods such as morphological markers. This takes a long time, often yields incomplete conclusions, and makes it difficult to eliminate the influence of environmental and human factors. Therefore, it is necessary to develop a rapid identification method based on genotypes.

[0004] Molecular markers are markers at the gene level, detecting genetic variation directly at the DNA molecule level. They are unaffected by factors such as tissue and organ type, developmental stage, and habitat conditions, and are highly polymorphic and genetically stable. Insertion-Deletion Length Polymorphism (InDel) markers are third-generation molecular markers, characterized by the insertion or deletion of a certain number of nucleotides at an allelic locus. Developed primarily based on whole-genome sequencing, they have a higher density within the genome than SSR (Simple Sequence Repeat) markers. They offer advantages such as high marker specificity, good stability, simple detection methods, and cost-effectiveness. They have been successfully applied to the identification of rice, soybean, and cotton varieties, overcoming the uncertainty associated with identifying new varieties based solely on morphological characteristics.

[0005] The cauliflower variety 'TX65' is a mid-maturing autumn variety, harvested 75-80 days after planting. It has strong growth potential, strong disease resistance, upright plant shape, and semi-protected head. The head is smooth, round, firm, and white, with a single head weighing about 1.5 kilograms. It is harvested in time after the head matures.

[0006] To date, there are no molecular markers and identification methods suitable for the cauliflower variety 'TX65'. Developing molecular identification markers suitable for the cauliflower variety 'TX65' will be beneficial to standardizing cauliflower variety registration, strengthening market supervision and enhancing intellectual property protection. Summary of the Invention

[0007] One of the objectives of the present invention is to provide an InDel molecular marker primer pair for identifying the authenticity of the cauliflower variety 'TX65' or the purity of the seeds;

[0008] The second object of the present invention is to provide a PCR detection kit for identifying the authenticity of the cauliflower variety 'TX65' or identifying the purity of the cauliflower hybrid 'TX65' seeds;

[0009] The third purpose of the present invention is to apply the InDel molecular marker primer pair to identify the authenticity or seed purity of the cauliflower variety 'TX65'.

[0010] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0011] The present invention first extracts genomic DNA from the maternal superior inbred line '24DM-5' and the paternal superior inbred line '24DL-9' of the cauliflower variety 'TX65', performs Illumina double-end sequencing, removes the adapter sequence and performs data quality control on the obtained raw data, and then aligns the effective sequencing data with the cauliflower reference genome using BWA software. The alignment results are deduplicated using SAMTOOLS. The GATK HaplotypeCaller module is used to detect and analyze InDel variations in the samples; the present invention further uses a python language script to screen for differential InDel sites in the parental genomes of the cauliflower variety 'TX65'. The InDel size is set to 25-500bp, and the sequencing depth is greater than 4. Based on the reference genome information, the screened sites are located on the genome, and the nucleotide sequences 200bp upstream and downstream of the InDel marker site are extracted. Primers are designed in batches using Primer3.0 and a python language script. The designed and synthesized primers were used to perform PCR amplification on the cauliflower variety 'TX65' and its parents, and a pair of InDel molecular marker primers that can be used to identify the authenticity or seed purity of the cauliflower variety 'TX65' was finally screened out, thereby completing the present invention.

[0012] One aspect of the present invention provides an InDel molecular marker primer pair for identifying the authenticity or seed purity of the cauliflower variety 'TX65'. The InDel marker primer pair consists of a forward primer shown in SEQ ID NO. 1 and a reverse primer shown in SEQ ID NO. 2.

[0013] Another aspect of the present invention is to provide a PCR detection kit for identifying the authenticity of the cauliflower variety 'TX65' or identifying the purity of the cauliflower hybrid 'TX65' seeds. The PCR detection kit comprises: dNTPs, Taq enzyme, MgCl2, a PCR primer pair consisting of a forward primer shown in SEQ ID NO. 1 and a reverse primer shown in SEQ ID NO. 2, an amplification buffer, and sterile water.

[0014] Another aspect of the present invention provides a method for using the InDel molecular marker primers of the cauliflower variety 'TX65' to identify the authenticity of the cauliflower variety 'TX65' or the purity of the seeds of the cauliflower variety 'TX65', comprising: using the InDel marker primer pair to amplify by PCR and then detect by agarose gel electrophoresis to reveal the polymorphism of the InDel site among different individuals, thereby achieving the purpose of identification.

[0015] Specifically, the present invention provides an application of the InDel molecular marker primer pair in authenticity identification of the cauliflower hybrid 'TX65' variety, comprising:

[0016] (1) extracting genomic DNA from a cauliflower plant sample to be tested;

[0017] (2) using the extracted sample genomic DNA as a template and the InDel molecular marker primer pair as a PCR primer to establish a PCR amplification system and perform PCR amplification respectively;

[0018] (3) If the banding patterns of the amplified products both have the banding patterns of the parents of the cauliflower hybrid TX65', the cauliflower variety to be tested is the cauliflower hybrid 'TX65'; if the banding patterns of the amplified products do not both have the banding patterns of the parents of the cauliflower hybrid 'TX65', the cauliflower variety to be tested is not the cauliflower hybrid 'TX65'; wherein, the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.5.

[0019] The PCR amplification system in step (2) is preferably: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and reverse primer 1.0 μL each, 0.5 units of Taq DNA polymerase 0.2 μL, 50 ng of template, and ddH2O added to 10 μL;

[0020] The PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, 35 cycles; 72°C for 5 min.

[0021] Specifically, the present invention provides an application of the above-mentioned InDel molecular marker primer pair group to the seed purity identification of cauliflower hybrid 'TX65', the identification method comprising:

[0022] (1) extracting genomic DNA from a cauliflower seed sample to be tested;

[0023] (2) Using the extracted seed sample genomic DNA as a template, PCR amplification was performed using forward and reverse primers to establish a PCR amplicon;

[0024] (3) If the banding patterns of the amplified products both have the banding patterns of the parents of the cauliflower hybrid 'TX65', the cauliflower seeds to be tested are seeds of the cauliflower hybrid 'TX65'; if the banding patterns of the amplified products do not both have the banding patterns of the parents of the cauliflower hybrid 'TX65', the cauliflower seeds to be tested are not seeds of the cauliflower hybrid 'TX65'; wherein, the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.5;

[0025] (4) Calculate the ratio of the number of true 'TX65' cauliflower hybrid seeds to the total number of tested seeds to obtain the seed purity of the 'TX65' cauliflower hybrid seeds.

[0026] The PCR amplification system in step (2) is preferably: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and reverse primer 1.0 μL each, 0.5 units of Taq DNA polymerase 0.2 μL, 50 ng of template, and ddH2O added to 10 μL;

[0027] The PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, 35 cycles; 72°C for 5 min.

[0028] In a preferred embodiment of the present invention, the male parent of the cauliflower variety 'TX65' is preferably cauliflower '24DL-9', and the female parent of the cauliflower variety 'TX65' is preferably cauliflower '24DM-5'.

[0029] The present invention uses the screened InDel molecular marker primers of the cauliflower variety 'TX65' to quickly and accurately complete the purity identification of the cauliflower variety 'TX65' or hybrid seeds in a short period of time, solving the problems of the existing cauliflower 'TX65' variety identification process, which has a long identification cycle and high labor input. TX65' can be detected quickly, efficiently, stably and accurately based on InDel molecular markers.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] 1. The present invention uses the resequencing data of the parents of the cauliflower variety 'TX65' to screen differential InDel sites across the entire genome and design specific primers, with high accuracy and stable and reliable results.

[0032] 2. The present invention utilizes agarose gel electrophoresis for detection, which has the advantages of simple operation, low cost, high speed, and wide application range compared with polyacrylamide gel electrophoresis.

[0033] 3. The present invention is based on PCR amplification reaction and can quickly and accurately complete the purity identification of 'TX65' cauliflower varieties and hybrid seeds in a short time. The method is simple and fast, has a short detection cycle, saves labor costs, and has a good application and promotion prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1The results of using the InDel molecular marker primer pair of the present invention to detect the authenticity of the cauliflower variety 'TX65' and its parents as well as 152 commercial cauliflower varieties;M is Marker, and lanes 01-155 are 24DL-9, 24DM-5, TX65, Jin Song 75, Qing Nong 92, Zhe Nong Song Hua 80, Zhe Nong Song Hua 85, Zhe Nong Song Hua 90, Shang Mei 65, Jin Pin 70, Fu Gui 80, B11, BX110, BX120, CB30, CY-17, DX-8, DX-108, DX-120, DX-142, Fuzi YAMA, H2 194, JN152, JN154, JN155, JN156, JN157, JP63, JP69, JP70, SX60, 1522, ID3, ID4, ID7, ID10, ID11, ID16, ID23, ID24, ID31, ID32, ID33, ID36, ID37, ID38, ID47, ID41, ID51, ID53, ID55, ID57, ID58, ID60, ID61, ID62, ID63, ID64, ID65, ID68, ID70, ID71, ID73, ID74, ID82, ID83, ID85, ID88, ID89, ID90, ID92, ID93, ID99, ID100, PK2, PK3, PK4, PK5, PK6, PK8, PK10, PK12, 20KV36, 20KV39, 20KV46, 20CP1, 20CP2, 20CP3, 20CP5, 20CP6, 20CP7, 20CP8, 20CP9, 19QK1, 19QK2, 19QK6, 19QK8, 19QK13, 19QK16, 19QK33, 19QK35, 19QK36, 19QK42, 19QK43, 19QK53, 19QK67, 19QK68, 16SY44, 16SY51, 16SY55, 16SY56, 16SY61, 16SY62, 16SY63, 16SY64, 16SY69, 16SY72, 16SY76, 16SY79, 16SY81, 16SY82, 16SY89, 16SY92, 16SY93, 16SY94, 16SY96, 16SY104, 16SY105, 16SY110, 16SY112, 16SY113, 16SY116, 16SY117, 16SY122, 16SY127, 16SY128, 16SY132, 21NY4, 21NY6, 21NY8, 21NY10, 21NY19, 21NY21, 21NY23, 21NY34, 21NY37, 21NY38, 21JN79, 21JN74, 21JN81, KB2, KB3, KB4, KB18, KB19.

[0035] Figure 2 This is an electrophoresis diagram of the detection of seed purity of the cauliflower variety 'TX65' using the InDel molecular marker primer pair of the present invention; in the figure, M is a marker, and lanes 01-96 represent 96 individual plants of the sample to be tested. DETAILED DESCRIPTION

[0036] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0037] Experimental Example 1 Screening for differential InDel sites across the entire genome and designing specific primers for screening

[0038] 1 Test method

[0039] 1.1 Illumina high-throughput sequencing

[0040] Genomic DNA was extracted from the maternal and paternal superior inbred lines '24DM-5' and '24DL-9' of the cauliflower variety 'TX65'. Illumina paired-end sequencing was performed. After removing adapter sequences and performing quality control on the raw data, the valid sequencing data were aligned to the cauliflower reference genome using BWA software. Duplicates were removed using SAMTOOLS. Indel variants were detected and analyzed using the GATK HaplotypeCaller module.

[0041] 1.2 Screening of differential InDel sites and specific primer design

[0042] A Python script was used to screen for differential InDel sites between the parental genomes of the cauliflower variety 'TX65'. The InDel size was set to 20-500 bp, and the sequencing depth was greater than 4. Based on the reference genome information, the screened sites were mapped to the genome, and the InDel molecular marker was ultimately found to be located on chromosome 3 of the cauliflower reference genome 'C-8'. The InDel site was located at nucleotide 6703860, and the base at this site was A or AATCTTCGTTGTTATAGAAATGTTTTCTTGTAGTGTTTTTATTTTTAA AGTTTATATTTGTGAAAAAAACTTTTTTTTAG (SEQ ID NO. 3).

[0043] The nucleotide sequence of the 200 bp upstream and downstream of the InDel marker site was extracted. Primers were designed in batches using Primer 3.0 and a Python script. PCR amplification was performed on the cauliflower 'TX65' variety and its parents. Ultimately, a pair of InDel molecular marker primers was screened and found that could be used to identify the authenticity or seed purity of the cauliflower 'TX65' variety:

[0044] Forward primer: TGGACTCGTCGTAATTTCGTTG (SEQ ID NO. 1)

[0045] Reverse primer: AATGCCCCGTTCTTATGCACG (SEQ ID NO. 2).

[0046] Experimental Example 2: Authenticity Identification of 'TX65' Cauliflower Variety Using InDel Molecular Marker Primer Pairs

[0047] 1 Test method

[0048] 1.1 Extraction of leaf genomic DNA

[0049] Genomic DNA was extracted from the cauliflower variety 'TX65', its parents, and 152 commercial varieties. Specifically, the paternal parent 24DL-9 (its DNA sequence is 290 bp long, and its nucleotide sequence is shown in SEQ ID NO. 4), the maternal parent 24DM-5 (its DNA sequence is 213 bp long, and its nucleotide sequence is shown in SEQ ID NO.5), TX65 (sold by Tianjin Academy of Agricultural Sciences under the trade name of Cauliflower TX65), Jinsong 75, Qingnong 92, Zhe Nong Songhua 80, Zhe Nong Songhua 85, Zhe Nong Songhua 90, Shangmei 65, Jinpin 70, Fugui 80, B11, BX110, BX120, CB30, CY-17, DX-8, DX-108, DX-120, DX-142, Fuzi YAMA, H2 194,JN152,JN154,JN155,JN156,JN157,JP63,JP69,JP70,SX60,1522,ID3,ID4,ID7,ID10,ID11,ID16,ID23,ID24,ID31 ,ID32,ID33,ID36,ID37,ID38,ID47,ID41,ID51,ID53,ID55,ID57,ID58,ID60,ID61,ID62,ID63,ID64,ID65,ID68,ID70 ,ID71,ID73,ID74,ID82,ID83,ID85,ID88,ID89,ID90,ID92,ID93,ID99,ID100,PK2,PK3,PK4,PK5,PK6,PK8,PK10,PK12 ,20KV36,20KV39,20KV46,20CP1,20CP2,20CP3,20CP5,20CP6,20CP7,20CP8,20CP9,19QK1,19QK2,19QK6,19QK8,19QK13 ,19QK16,19QK33,19QK35,19QK36,19QK42,19QK43,19QK53,19QK67,19QK68,16SY44,16SY51,16SY55,16SY56,16SY61,1 6SY62,16SY63,16SY64,16SY69,16SY72,16SY76,16SY79,16SY81,16SY82,16SY89,16SY92,16SY93,16SY94,16SY96,16S Y104,16SY105,16SY110,16SY112,16SY113,16SY116,16SY117,16SY122,16SY127,16SY128,16SY132,21NY4,21NY6,21NY8,21NY10,21NY19,21NY21,21NY23,21NY34,21NY37,21NY38,21JN79,21JN74,21JN81,KB2,KB3,KB4,KB18,KB19 single strain DNA.

[0050] 1.2 PCR amplification

[0051] Using the genomic DNA of each cauliflower variety described in 1.1 as a template, PCR amplification was performed using the InDel molecular marker primer pairs screened in Experimental Example 1 as PCR primers;

[0052] The PCR amplification system was as follows: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and reverse primer 1.0 μL each, 0.5 units of Taq DNA polymerase 0.2 μL, 50 ng of template, and ddH2O to 10 μL;

[0053] The PCR amplification program was as follows: 95°C for 3 min, 35 cycles of (95°C for 15 s, 56°C for 15 s, 72°C for 20 s), and 72°C for 5 min.

[0054] 1.3 Detection and analysis of PCR amplification products

[0055] Add 1 μL of 10× Loding Buffer to the amplified product described in 1.2. Run the product on a 2% agarose gel at a constant voltage of 120 V / cM for 90 minutes. Stain with Gelred and photograph using a gel imaging system. Identify the cultivar based on the electrophoretic banding pattern. If the banding pattern at the InDel locus matches that of both the male and female cauliflower hybrid 'TX65', confirm that the cauliflower variety being tested is the cauliflower hybrid 'TX65'.

[0056] 2 Identification results

[0057] Figure 1The figure shows the agarose gel electrophoresis of cauliflower variety 'TX65' and its parents as well as 152 commercial cauliflower varieties using the above method.In the figure, M is a marker. Lanes 01 to 155 are the male parent 24DL-9 of the cauliflower variety 'TX65', the female parent 24DM-5 of the cauliflower variety 'TX65', TX65, Jinsong 75, Qingnong 92, Zhenong Songhua 80, Zhenong Songhua 85, Zhenong Songhua 90, Shangmei 65, Jinpin 70, Fugui 80, B11, BX110, BX120, CB30, CY-17, DX-8, DX-108, DX-120, DX-142, Fuzi YAMA, and H2, respectively. 194,JN152,JN154,JN155,JN156,JN157,JP63,JP69,JP70,SX60,1522,ID3,ID4,ID7,ID10,ID11,ID16,ID23,ID24,ID3 1,ID32,ID33,ID36,ID37,ID38,ID47,ID41,ID51,ID53,ID55,ID57,ID58,ID60,ID61,ID62,ID63,ID64,ID65,ID68,ID7 0,ID71,ID73,ID74,ID82,ID83,ID85,ID88,ID89,ID90,ID92,ID93,ID99,ID100,PK2,PK3,PK4,PK5,PK6,PK8,PK10,PK 12,20KV36,20KV39,20KV46,20CP1,20CP2,20CP3,20CP5,20CP6,20CP7,20CP8,20CP9,19QK1,19QK2,19QK6,19QK8,19QK 13,19QK16,19QK33,19QK35,19QK36,19QK42,19QK43,19QK53,19QK67,19QK68,16SY44,16SY51,16SY55,16SY56,16SY6 1,16SY62,16SY63,16SY64,16SY69,16SY72,16SY76,16SY79,16SY81,16SY82,16SY89,16SY92,16SY93,16SY94,16SY96, 16SY104,16SY105,16SY110,16SY112,16SY113,16SY116,16SY117,16SY122,16SY127,16SY128,16SY132,21NY4,21NY6,21NY8,21NY10,21NY19,21NY21,21NY23,21NY34,21NY37,21NY38,21JN79,21JN74,21JN81,KB2,KB3,KB4,KB18和KB19(. Figure 1 ).

[0058] according to Figure 1 The detection results show that the banding pattern of the InDel site of the cauliflower hybrid 'TX65' has the banding patterns of both the male and female parents of the cauliflower hybrid 'TX65', while the banding patterns of the same InDel site of other varieties do not have the banding patterns of both the male and female parents of the cauliflower hybrid 'TX65'. Therefore, the InDel molecular marker primer pair designed and screened in Experimental Example 1 of the present invention can accurately identify the cauliflower hybrid 'TX65' from other cauliflower varieties.

[0059] Experimental Example 3: Purity Identification of 'TX65' Cauliflower Hybrid Seeds Using InDel Molecular Marker Primers

[0060] 1 Test method

[0061] 1.1 Extraction of leaf genomic DNA

[0062] 96 random hybrid sample seeds from a batch of 'TX65' cauliflower hybrid seeds.

[0063] Cauliflower hybrid 'TX65' and sample seeds were sown simultaneously in 72-well trays and watered regularly until two true leaves grew. Leaves were sampled from each of the 96 hybrid sample seeds. Genomic DNA was extracted from each seed using the standard CTAB method and stored at -20°C until further use.

[0064] 1.2 PCR amplification

[0065] The PCR amplification was the same as that in Experimental Example 2.

[0066] 1.3 Detection and analysis of PCR amplification products

[0067] The methods for detecting PCR amplification products and identifying hybrid varieties are the same as those in Experimental Example 2.

[0068] 2 Identification results

[0069] The results of agarose gel electrophoresis of the seed purity of cauliflower hybrid 'TX65' using the above method are shown in the figure below. Figure 2 In the figure, M is a marker, and lanes 01 to 96 are 96 individual strains of the sample to be tested.

[0070] There were 96 true hybrid seeds among the 96 sample seeds, so the purity of this batch of 'TX65' hybrid seeds was 100%, which met the national standards and was consistent with the field survey results.

Claims

1. Application of an InDel molecular marker primer pair of the cauliflower variety 'TX65' in the authenticity identification of the cauliflower variety 'TX65', characterized in that: The InDel primer pair consists of a forward primer shown in SEQ ID NO.1 and a reverse primer shown in SEQ ID NO.2; including: (1) Extracting genomic DNA from the cauliflower plant sample to be tested; (2) Using the extracted sample genomic DNA as a template and the InDel molecular marker primer pair as the forward and reverse primers, a PCR amplification system is established to perform PCR amplification respectively; (3) If the banding patterns of the amplified products have the banding patterns of both the male and female parents of the cauliflower hybrid 'TX65', the cauliflower variety to be tested is the cauliflower hybrid 'TX65'; if the banding patterns of the amplified products do not have the banding patterns of both the male and female parents of the cauliflower hybrid 'TX65', the cauliflower variety to be tested is not the cauliflower hybrid 'TX65'; wherein, the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.

5.

2. Use of a PCR detection kit for identifying the authenticity of cauliflower variety 'TX65' or identifying the purity of cauliflower variety 'TX65' seeds, the PCR detection kit comprising: dNTPs, Taq enzyme, MgCl2, a PCR primer pair consisting of a forward primer and a reverse primer, an amplification buffer, and sterile water; characterized in that the PCR primer pair consists of the forward primer shown in SEQ ID NO.1 and the reverse primer shown in SEQ ID NO.2, comprising: (1) Extracting genomic DNA from the cauliflower plant sample to be tested; (2) Using the extracted sample genomic DNA as a template and the InDel molecular marker primer pair as the forward and reverse primers, a PCR amplification system is established to perform PCR amplification respectively; (3) If the banding patterns of the amplified products have the banding patterns of both the male and female parents of the cauliflower hybrid 'TX65', the cauliflower variety to be tested is the cauliflower hybrid 'TX65'; if the banding patterns of the amplified products do not have the banding patterns of both the male and female parents of the cauliflower hybrid 'TX65', the cauliflower variety to be tested is not the cauliflower hybrid 'TX65'; wherein, the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.

5.

3. The use according to claim 2, characterized in that The PCR amplification system described in step (2) is: 10× buffer 1.0 μL, 25 mM MgCl2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and 10 μM reverse primer 1.0 μL each, 0.5 units of Taq DNA polymerase 0.2 μL, 50 ng of template, and ddH2O added to 10 μL; The PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, 35 cycles; 72°C for 5 min.

4. The use according to claim 2, characterized in that The male parent of the cauliflower variety 'TX65' is cauliflower '24DL-9', and the female parent of the cauliflower variety 'TX65' is cauliflower '24DM-5'. The DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp long, and its nucleotide sequence is shown in SEQ ID NO. 4; the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp long, and its nucleotide sequence is shown in SEQ ID NO.

5.

5. Application of InDel molecular marker primer pairs in identifying seed purity of cauliflower hybrid 'TX65', characterized in that: The InDel primer pair consists of a forward primer shown in SEQ ID NO.1 and a reverse primer shown in SEQ ID NO.2; including: (1) Extracting genomic DNA from the cauliflower seed sample to be tested; (2) Using the extracted seed sample genomic DNA as a template, and using the InDel molecular marker primer pair described in claim 1 as the forward and reverse primers, respectively, a PCR amplification system is established to perform PCR amplification; (3) If the banding pattern of the amplified product has both the banding pattern of the male and female parents of the cauliflower hybrid 'TX65', the cauliflower seeds to be tested are seeds of the cauliflower hybrid 'TX65'; if the banding pattern of the amplified product does not have both the banding pattern of the male and female parents of the cauliflower hybrid 'TX65', the cauliflower seeds to be tested are not seeds of the cauliflower hybrid 'TX65'; wherein, the length of the DNA sequence of the male parent of the cauliflower hybrid 'TX65' is 290 bp, and its nucleotide sequence is shown in SEQ ID NO.4; the length of the DNA sequence of the female parent of the cauliflower hybrid 'TX65' is 213 bp, and its nucleotide sequence is shown in SEQ ID NO.5; (4) Calculate the ratio of the number of true 'TX65' cauliflower hybrid seeds to the total number of tested seeds to obtain the seed purity of the 'TX65' cauliflower hybrid seeds.

6. The use according to claim 5, characterized in that the PCR amplification system described in step (2) is: 10× buffer 1.0 μL, 25 mM MgCL2 1.0 μL, 2 mM dNTPs 1.0 μL, 10 μM forward primer and 10 μM reverse primer 1.0 μL each, 0.5 units of Taq DNA polymerase 0.2 μL, 50 ng of template, and ddH2O added to 10 μL; The PCR amplification program is: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, 35 cycles; 72°C for 5 min.

7. The use according to claim 5, characterized in that The male parent of the cauliflower variety 'TX65' is cauliflower '24DL-9', and the female parent of the cauliflower variety 'TX65' is cauliflower '24DM-5'.

Images