Preparation method and kit of methylation library for trace or degraded genome DNA (deoxyribonucleic acid)

Abstract

The invention relates to the technical field of methylation sequencing, in particular to the technical field of methylation library preparation of trace or degraded genome DNA. The invention also relates to a kit for microscale or degradation of methylated libraries of genomic DNA. The method and the kit provided by the invention are particularly suitable for sequencing analysis of a methylation target area, and the method and the kit are suitable for library construction of trace or seriously degradable samples.

Description

Technical Field

[0001] The present application relates to the technical field of methylation sequencing, in particular to the technical field of methylation library preparation of trace or degraded genomic DNA. The present application also relates to a kit for methylation library of trace or degraded genomic DNA. The method and kit of the present application are particularly suitable for sequencing and analyzing methylation target regions, and the method and kit are suitable for library construction of trace or severely degraded samples. Background Art

[0002] Second-generation high-throughput sequencing, also known as next-generation sequencing technology, can sequence hundreds of thousands to millions of nucleic acid molecules at a time. At present, second-generation sequencing is mainly used in scientific research for genome sequencing, transcriptome sequencing, population sequencing, amplicon sequencing, metagenomic sequencing, and resequencing. In clinical practice, it plays an increasingly important role in assisted reproduction, such as non-invasive prenatal testing (NIPT); genetic diseases, such as genetic pathogenic mutation screening; and tumor research, such as early diagnosis, medication guidance, and prognosis judgment.

[0003] DNA methylation is a major epigenetic modification of genomic DNA. A large number of studies in recent years have shown that abnormal DNA methylation is closely related to the occurrence, development, and cell carcinogenesis of tumors. A gold standard for methylation sequencing is whole genome bisulfite sequencing (WGBS), referred to as BS-seq. The detection principle is to use bisulfite treatment to convert the unmethylated C bases in the genome into U, which are then converted into T after PCR amplification, and distinguished from the C bases that originally had methylation modifications. Combined with high-throughput sequencing technology, it is compared with the reference sequence to determine whether the CpG / CHG / CHH site is methylated. To achieve this process, the genome needs to be first constructed into a library, and then a suitable linker is added, and then sequenced on a sequencing platform. According to the different order in which bisulfite is added during the library construction process, the library construction can be divided into pre-conversion library construction (Pre-BS) and post-conversion library construction (Post-BS). Pre-BS library construction requires a relatively high input amount, and the constructed library is mostly AT-preferred, which is easy to lose the areas with dense CpG content and important epigenetic information. The Post-BS library construction method, because the DNA is first treated with bisulfite, and then the library is constructed by ligation or PCR, has a low sample starting amount requirement and can meet the sequencing needs of various sample types such as cfDNA (cell free DNA), FFPE DNA and other special samples.

[0004] There are many sequencing platforms on the market. Illumina platform has become the most mainstream second-generation sequencing company with its ultra-low sequencing cost and acceptable read length. The present invention develops a method for constructing WGBS library with low sample input amount. Its product can be used for hybridization capture, and the data utilization rate is very high. Summary of the invention

[0005] The purpose of the present application is to provide a methylation library preparation method and kit for trace or degraded genomic DNA. In the library construction process, the joint used is improved and the process is optimized so that it can be used for whole genome bisulfite sequencing (WGBS) and for hybridization rapid library construction. The DNA library preparation method of the present application can also be used for methylation target region sequencing. Verification is carried out in the hybridization capture process, and good results are achieved, and the sequencing index is better than the effect of the library construction kit after conversion on the market (important indicators such as effective sequencing depth after de-duplication, see attached figure). At the same time, the method can also be suitable for library construction of trace or severely degradable samples, and the minimum starting amount is as low as 1ng.

[0006] The specific technical solutions of this application are as follows:

[0007] 1. A method for constructing a whole genome methylation library, comprising the following steps:

[0008] (1) Extract and isolate target genomic DNA from biological samples;

[0009] (2) performing bisulfite conversion on the extracted genomic DNA;

[0010] (3) adding a phosphate to the 5' end of the genomic DNA fragment;

[0011] (4) connecting the adapter 1 to one end of the genomic DNA fragment using a ligase, and capturing and purifying the genomic DNA fragment connected with the adapter 1;

[0012] (5) using ligase to connect linker 2 to the other end of the genomic DNA fragment again, and capturing and purifying the genomic DNA fragment connected with linkers 1 and 2;

[0013] (6) amplifying the library by PCR and purifying the product to obtain a whole genome methylation library;

[0014] The lengths of the adapter 1 and adapter 2 are 30-50 nucleotides, respectively, preferably the lengths of the adapter 1 and adapter 2 are 32-45 nucleotides, respectively, and more preferably the lengths of the adapter 1 and adapter 2 are 33-42 nucleotides, respectively;

[0015] The biological sample can be fresh tissue, FFPE sample (formalin-fixed paraffin-embedded sample) or plasma.

[0016] 2. The method for constructing a whole genome methylation library according to item 1, wherein the capture and purification steps in step (4) and step (5) are performed using magnetic beads or purification columns; the purification column is preferably a purification column with a product number of C1003-50 from ZYMO.

[0017] 3. A method for constructing a whole genome methylation library according to item 1 or 2, wherein, when the biological sample is a fresh tissue or an FFPE sample, i.e., a formalin-fixed paraffin-embedded sample, there is also a step of fragmenting the genomic DNA in step (1); the fragmentation method is selected from nebulization, ultrasonic fragmentation, or HydroShear treatment.

[0018] 4. The method for constructing a whole genome methylation library according to item 3, wherein in the fragmentation step, the genomic DNA is fragmented into fragments of 300-400 bp; and the purification step in step (6) is purified using magnetic beads.

[0019] 5. A method for constructing a whole genome methylation library according to any one of items 1 to 4, wherein the linker 1 in step (4) contains the nucleotide sequence shown in SEQ ID NO:1 and SEQ ID NO:2, or consists of the nucleotide sequence shown in SEQ ID NO:1 and SEQ ID NO:2; the linker 2 in step (5) contains the nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:4, or consists of the nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:4.

[0020] 6. The method for constructing a whole genome methylation library according to item 5, wherein:

[0021] The 5' end of the sequence shown in SEQ ID NO: 1 is phosphorylated; the 5' end of SEQ ID NO: 2 is not phosphorylated, and the 3' end is blocked by a blocking group; the blocking group is preferably a carbon spacer, dideoxynucleotide, etc.;

[0022] The 5' end of the sequence shown in SEQ ID NO: 3 is phosphorylated; the 5' end of SEQ ID NO: 4 is not phosphorylated, and the 3' end is not blocked by a blocking group.

[0023] 7. The method for constructing a whole genome methylation library according to any one of items 1 to 6, wherein step (3) comprises a DNA denaturation step.

[0024] 8. A method for constructing a whole genome methylation library according to any one of items 1 to 7, which is used for nanogram-level genomic DNA, preferably 1ng-20ng, more preferably 1ng-10ng, more preferably 1ng-5ng, more preferably 1ng-3ng, and most preferably 1ng.

[0025] 9. A method for constructing a whole genome methylation library according to any one of items 1 to 4, wherein the amount of magnetic beads used in steps (4) and (5) is 0.8-2 times, preferably 1-1.2 times.

[0026] 10. A method for constructing a whole genome methylation library according to any one of items 1 to 4, wherein the ligase used in steps (4) and (5) is selected from one or more of the following: NAD-dependent ligases, such as Taq DNA ligase, Thermus filiformis DNA ligase, Escherichia coli DNA ligase, Tth DNA ligase, Thermus scotoductus DNA ligase (I and II), thermostable ligases, Ampligase thermostable DNA ligase, VanC-type ligase and 9°N DNA ligase; and ATP-dependent ligases, including T4 RNA ligase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Pfu DNA ligase, DNA ligase I, DNA ligase III and DNA ligase IV.

[0027] 11. The method for constructing a whole genome methylation library according to item 10, wherein the ligase used in steps (4) and (5) is T4 DNA ligase.

[0028] 12. A method for constructing a whole genome methylation library according to any one of items 1 to 4, wherein in step (6), after amplifying the library by PCR and purifying the product, a quality detection step is also included: detecting the length of the amplified product fragment, when the product fragment length is 150bp-400bp, the obtained product is a whole genome methylation library; preferably, the product fragment length is 150-300bp.

[0029] 13. A whole genome methylation library construction kit, which is used in the method for constructing a whole genome methylation library as described in any one of items 1 to 12;

[0030] It includes extraction and separation reagents of target genomic DNA, bisulfite conversion reagents, nucleic acid 5' end phosphorylation reagents, adapter 1 and adapter 2 oligonucleotides, adapter sequence connection reagents, magnetic beads, and PCR amplification reagents.

[0031] 14. A method for sequencing a genomic methylation target region, comprising the following steps:

[0032] (1) constructing a whole genome methylation library using the method for constructing a whole genome methylation library as described in any one of items 1 to 12;

[0033] (2) Library samples are hybridized and captured with probes;

[0034] (3) Post-capture PCR amplification, purification and quality inspection.

[0035] 15. A linker for constructing a DNA library, comprising or consisting of a nucleotide sequence as described in any one or more of SEQ ID NOs: 1-4.

[0036] 16. The linker for constructing a DNA library according to item 15, wherein the library is a whole genome methylation library.

[0037] 17. A linker for constructing a DNA library according to item 15, wherein the library is a micro-library; preferably, the library is a micro-DNA whole genome methylation library.

[0038] Technical Effects

[0039] The present application provides a method for methylation whole genome library construction (WGBS) and methylation target region library construction, which can be used for second-generation library preparation. This method can achieve: 1) fast and high-yield WGBS library construction and methylation target region library construction, and can be applied to hybrid capture process. Compared with commonly used kits on the market, hybrid capture can achieve higher data utilization; 2) low starting amount library construction (can be used for 1ng library construction); 3) low cost and simple operation process; 4) applicable to all sample types of DNA, such as fresh tissue genome, FFPE sample (Formalin-Fixed and Parrffin Embedded, i.e. formalin-fixed paraffin-embedded sample) genome, plasma free DNA, etc.; 5) has a high data utilization rate, and sequencing of methylation target regions can bring higher molecular diversity. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a flow chart of the method for preparing cfDNA or genomic methylation library of the present application.

[0041] Figure 2 A- Figure 2 E is the 2100 detection result of the library fragment distribution obtained from the preparation of libraries with different starting amounts of cfDNA in Example 1 of the present application. Figure 2 A- Figure 2The starting amounts of cfDNA for E were 20ng, 10ng, 5ng, 3ng and 1ng respectively.

[0042] Figure 3 This is the electrophoresis diagram of FFPE extracted genomic DNA in Example 2. M1 is a molecular weight marker with a maximum of 2000 bp; M2 is a molecular weight marker with a maximum of 15000 bp; lanes numbered 1, 2, 3, 4, 5, and 6 are all genomic DNA samples extracted from the same batch. DETAILED DESCRIPTION

[0043] The present invention is described in detail below. Although specific embodiments of the present invention are shown, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0044] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the difference in the functions of the components as the criterion for distinction. As mentioned throughout the specification and claims, "including" or "comprising" are open-ended terms and should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the present invention, but the description is based on the general principles of the specification and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be determined by the attached claims.

[0045] Explanation of some definitions in this application:

[0046] Library construction: abbreviated as library construction, refers to the process of randomly interrupting DNA extracted from samples such as blood and tissues, repairing and connecting it to a known DNA fragment, namely the adapter sequence (also called a linker), so that it can be used for high-throughput DNA sequencing on a second-generation sequencing platform (this patent is used for the Illumina sequencing platform).

[0047] Linker: A universal known sequence that allows DNA fragments to be joined together using the enzyme ligase.

[0048] Annealing: It is the process of denaturing single-stranded DNA and then slowly cooling it to form double-stranded DNA.

[0049] Index / barcode: It is the label sequence. When multiple samples are tested simultaneously by next-generation sequencing, a different base sequence is added to the sequences from different samples as a distinguishing label, which is generally 8nt in length.

[0050] DNA ligase: The DNA ligase useful in the present application is selected from one or more of the following: NAD-dependent ligases, such as Taq DNA ligase, Thermus filiformis DNA ligase, E. coli DNA ligase, Tth DNA ligase, Thermus scotoductus DNA ligase (I and II), thermostable ligase, Ampligase thermostable DNA ligase, VanC-type ligase and 9°N DNA ligase; and ATP-dependent ligases, including T4 RNA ligase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Pfu DNA ligase, DNA ligase 1, DNA ligase III and DNA ligase IV. The DNA ligase is preferably T4 DNA ligase.

[0051] Example

[0052] The present application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % means wt%, i.e., weight percentage. The reagents or instruments used without indicating the manufacturer are all conventional reagent products that can be obtained commercially.

[0053] Example 1: Preparation of plasma free DNA methylation library

[0054] Apostle MiniMax was used to extract free DNA from plasma TM cfDNA was prepared using the High Efficiency Total cfDNA / RNA (cfNAs) Isolation Kit, catalog number A18725-50. The bisulfite conversion method was performed using ZYMOEZ DNA Methylation-Gold TM Kit, item number D5005, its experimental detection method is as follows:

[0055] 1. Peripheral Blood Collection

[0056] 1.1 The examinee does not need any special preparation and does not need to fast or drink any water.

[0057] 1.2 Use a purple-headed K2EDTA negative pressure anticoagulation blood collection tube to slowly draw 10 ml of venous blood from the subject to avoid the formation of red blood bubbles inside the blood collection tube.

[0058] 1.3 Gently invert 180 degrees and shake well 5-8 times.

[0059] 1.4 Immediately place the blood collection tube in a 4℃ ice box or a 2-8℃ refrigerator. It is best to complete the centrifugation of whole blood to separate plasma within 4 hours. The longest time should not exceed 8 hours and the sample must not be frozen.

[0060] 1.5 During the storage and transportation of whole blood, avoid severe physical stimulation, such as temperature changes and severe vibration.

[0061] 2. Plasma separation

[0062] 2.1 Adjust the centrifuge to no brake. If conditions permit, precool the centrifuge to 2-8°C.

[0063] 2.2 Centrifuge 10 ml of whole blood in a blood collection tube at 16000 g (relative centrifugal force, rcf) for 10 minutes;

[0064] 2.3 Take out the blood collection tube from the centrifuge. Use a disposable pipette to transfer the plasma to 2 to 3 2.0 ml centrifuge tubes;

[0065] 2.4 Centrifuge the 15 ml centrifuge tube containing plasma again at 16000g for 10 minutes;

[0066] 2.5 Take out the 15 ml centrifuge tube from the centrifuge. Use a disposable pipette to transfer 3.5 ml of plasma to a new 15 ml centrifuge tube and mark it.

[0067] 3. cfDNA extraction and sample lysis

[0068] 3.1 Prepare the reaction system according to Table 1:

[0069] Table 1

[0070] Reagents Input Plasma / Serum 3.6mL Proteinase K 144μl Sample lysis buffer 360μl

[0071] (Avoid mixing proteinase K with sample lysate; mix lysate with plasma / serum before adding proteinase K)

[0072] 3.2 Mix the solution thoroughly by vortexing briefly and incubate the mixture at 60°C for 20 min.

[0073] 3.3 After incubation, cool the plasma / serum to room temperature.

[0074] 3.4 Prepare the reaction system according to Table 2:

[0075] Table 2

[0076]

[0077]

[0078] 3.5 Add the prepared binding / nanoparticle solution to the plasma / serum sample and mix thoroughly by vortexing briefly or turning the tube 10 times (Note: avoid over-vortexing to create excessive bubbles)

[0079] 3.6 Shake at medium speed in a 3D mixer for 10 min.

[0080] 3.7 Place the 15 mL centrifuge tube on the magnetic stand for 5 min, or until the solution is dissolved and clear, and then precipitate the beads on the magnetic stand.

[0081] 3.8 Carefully remove the supernatant (avoid adsorption to the magnetic beads)

[0082] 3.9 Remove the test tube (hereinafter referred to as the lysis / binding tube) from the magnetic rack and add 1 mL of Apostle MiniMaxTM cfDNA Wash Solution, and vortex to resuspend the magnetic beads.

[0083] 3.10 Transfer the suspension on the magnetic stand to a new 1.5 mL microcentrifuge tube and save the lysis / binding tube.

[0084] 3.11 Place the 1.5 mL test tube on the magnetic rack to precipitate the magnetic beads for 1 min.

[0085] 3.12 Rinse the saved Lysis / Binding tube with the supernatant from the 1.5 mL tube and transfer any residual magnetic beads into a 1.5 mL centrifuge tube and discard the Lysis / Binding tube.

[0086] 3.13 Place the 1.5 mL test tube on the magnetic rack for 2 min to adsorb the magnetic beads until the solution is clear.

[0087] 3.14 Carefully remove the supernatant using a pipette.

[0088] 3.15 Remove the 1.5 mL tube from the magnetic stand, add 1 mL of Apostle MiniMaxTM cfDNA WashSolution, and vortex for 30 seconds.

[0089] 3.16 Use a desktop centrifuge to centrifuge the 1.5 mL centrifuge tube briefly to pour the solution to the bottom, place the 1.5 mL tube on the magnetic rack and adsorb for 2 minutes, until the magnetic beads are completely adsorbed on the magnetic rack until the solution is clear.

[0090] 3.17 Carefully remove the supernatant using a pipette.

[0091] 3.18 Pre-diluted Apostle MiniMaxTM cfDNA 2nd Wash Solution was mixed in ethanol at a ratio of 1:4 before use, and the final composition was 20% Apostle MiniMaxTM cfDNA 2nd Wash Solution and 80% ethanol. The final amount of secondary wash buffer required was 2 mL per sample.

[0092] 3.19 Take out the 1.5 mL tube from the magnetic stand, add 1 mL of the prepared secondary wash buffer (20% ApostleMiniMaxTM cfDNA 2nd Wash Solution, containing 80% ethanol), and then vortex for 30 seconds.

[0093] 3.20 Use a tabletop centrifuge to centrifuge the 1.5 mL centrifuge tube, briefly pour the solution to the bottom, and place the 1.5 mL tube on the magnetic rack for 2 minutes, waiting for the magnetic beads to be completely adsorbed on the magnetic rack until the solution is clear.

[0094] 3.21 Carefully remove the supernatant using a pipette.

[0095] 3.22 Repeat steps 3.19-3.21 for a second wash.

[0096] 3.23 Remove the 1.5 mL test tube from the magnetic rack, centrifuge it briefly using a tabletop centrifuge to bring the liquid to the bottom, place the 1.5 mL test tube on the magnetic rack, and wait until the magnetic beads are completely adsorbed on the magnetic rack until the solution is clear.

[0097] 3.24 Carefully remove the supernatant with a pipette and clear the liquid remaining at the bottom of the 1.5 mL tube.

[0098] 3.25 Place the 1.5 mL test tube on the magnet and air-dry the beads for 3 minutes. (When the ambient humidity is high, the time can be longer; the amount of residual ethanol will affect the elution efficiency).

[0099] 3.26 Remove the 1.5 mL tube from the magnet and add MiniMaxTM cfDNA Elution Solution (BlueCap) to the 1.5 mL tube according to Table 3, based on the initial sample volume.

[0100] Table 3

[0101] Plasma / serum volume 1mL 2mL 3.6mL 4mL 8mL Recommended cfDNA Elution Solution Volume 20 uL 40uL 72uL 80uL 160uL

[0102] 3.27 Vortex the 1.5 mL tube to resuspend the magnetic beads in the magnetic solution, vortex several times, and let stand for 3 minutes to elute the cfDNA from the magnetic beads.

[0103] 3.28 Use a tabletop centrifuge to centrifuge the 1.5 mL centrifuge tube briefly to sink the solution to the bottom. Place the 1.5 mL tube on a magnetic rack and wait for the magnetic beads to be completely adsorbed on the magnetic rack until the solution is clear.

[0104] 3.29 Collect the supernatant containing cfDNA in a DNase- and RNase-free microcentrifuge tube.

[0105] 3.30 Store cfDNA samples at 4°C for short-term storage and -20°C for long-term storage.

[0106] 3.31 Bioanalyzer 2100 High Sensitivity DNA Analysis Kit (less than 5pg / uL)

[0107] 4. DNA interruption

[0108] The genomic samples were sheared to 300-400bp, and the cfDNA samples were directly used for the experiment without shearing.

[0109] 5. Bisulfite conversion

[0110] Use Zymo EZ DNA Methylation-Gold Kit according to the instructions, and after purification, obtain 10 μL of DNA fragments before library construction.

[0111] 6. End treatment

[0112] The transformed DNA was pretreated by adding 1.5 μL of buffer A, 0.5 μL of enzyme A, and 3 μL of water to the above 10 μL product, with a total volume of 15 μL; mixed and incubated at 37°C for 15 min. The product was then incubated at 95°C for 3 min and immediately placed on ice before proceeding to the next step.

[0113] Note: Buffer A includes but is not limited to Tris-HCl, MgCl2, DTT, etc. Enzyme A is an enzyme that can be used for DNA phosphatase.

[0114] 7. Connector connection 1

[0115] Add 3ul of annealed linker 1, 6μL of buffer B, and 1μL of enzyme B to the above 15μL reaction system, mix well, and incubate at 22°C for 15min.

[0116] Note: The buffer B mentioned above contains but is not limited to Tris-HCl, MgCl2, DTT, etc., and the enzyme B contains a ligase that can be used to connect DNA.

[0117] Different amounts of DNA have different corresponding adapter concentrations: for example, for 40-50 ng DNA, the adapter concentration can be 25 μM, and for 10-20 ng DNA, the adapter concentration can be 15 μM.

[0118] The sequence of linker 1 is:

[0119] SEQ ID NO: 1: 5'-P-AGATCGGAAGAGCACACGTCTGAACTCCAGT CAC-3'P;

[0120] SEQ ID NO:2: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNN-N6-3'

[0121] N can be any base such as A, T, C or G, but it does not represent a fixed length.

[0122] 8. Purification

[0123] 8.1 Add 50 μl AMPure XP magnetic beads to the above product, mix well and centrifuge;

[0124] 8.2 Incubate at room temperature for 5-15 minutes;

[0125] 8.3 Place the above mixture on a magnetic rack. After the magnetic beads are completely adsorbed, remove the supernatant.

[0126] 8.4 Add 200 μl of 80% ethanol to wash the beads, incubate at room temperature for 30 seconds, and remove the supernatant;

[0127] 8.5 Repeat the previous step;

[0128] 8.6 Leave at room temperature for 5 minutes to allow the ethanol to evaporate;

[0129] 8.7 Add 15 μl of NF water, vortex to mix the magnetic beads, incubate at room temperature for 2 minutes, centrifuge briefly, and place the tube on the magnetic rack until the magnetic beads are completely adsorbed;

[0130] 8.8 Transfer 13 μL of supernatant to a new PCR tube;

[0131] 9. Connector connection 2

[0132] Add 3ul of annealed linker 2, 4μL of buffer B, and 1μL of enzyme B to the above 13μL reaction system, mix well, and incubate at 22°C for 15min.

[0133] Note: The buffer B mentioned above contains but is not limited to Tris-HCl, MgCl2, DTT, etc., and the enzyme B contains a ligase that can be used to connect DNA.

[0134] Different amounts of DNA have different corresponding adapter concentrations: for example, for 40-50 ng DNA, the adapter concentration can be 25 μM, and for 10-20 ng DNA, the adapter concentration can be 15 μM.

[0135] The sequence of linker 2 is:

[0136] SEQ ID NO: 3: 5'-P-ACACTCTTTCCCTACACGACCGCTCTTCCGATCT-3'P;

[0137] SEQ ID NO:4': 5'-NNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGA GTGT-3'

[0138] N can be any base such as A, T, C or G, but it does not represent a fixed length.

[0139] 10. Purification

[0140] 10.1 Add 40 μl AMPure XP magnetic beads to the above product, mix well and centrifuge;

[0141] 10.2 Incubate at room temperature for 5-15 minutes;

[0142] 10.3 Place the above mixture on a magnetic rack. After the magnetic beads are completely adsorbed, remove the supernatant.

[0143] 10.4 Add 200 μl of 80% ethanol to wash the beads, incubate at room temperature for 30 seconds, and remove the supernatant;

[0144] 10.5 Repeat the previous step;

[0145] 10.6 Leave at room temperature for 5 minutes to allow the ethanol to evaporate;

[0146] 10.7 Add 22 μl of NF water, vortex to mix the magnetic beads, incubate at room temperature for 2 min, centrifuge briefly, and place the tube on the magnetic rack until the magnetic beads are completely adsorbed;

[0147] 10.8 Transfer 20 μL of supernatant to a new PCR tube;

[0148] 11. PCR amplification

[0149] Prepare the following reaction system in PCR according to Table 4:

[0150] Table 4

[0151]

[0152]

[0153] Illumina platform universal amplification primer sequences:

[0154] Forward primer: SEQ ID NO:5:

[0155] CAAGCAGAAGACGGCATACGAGATGTCGGTAAGTGACTGGAGTTCAGACGTG;

[0156] Reverse primer: SEQ ID NO:6:

[0157] AATGATACGGCGACCACCGAGATCTACACACACTCTTTCCCTACACGACG.

[0158] Amplify according to the following procedure:

[0159] 95℃, 3min; 98℃ 30s, 60℃ 30s, 72℃ 2min. The number of cycles is determined according to the starting amount. For example, 8 cycles are recommended for 100ng DNA; 72℃, 5min.

[0160] 12. Purification

[0161] 12.1 Add 40 μl AMPure XP magnetic beads to the above product, mix well and centrifuge;

[0162] 12.2 Incubate at room temperature for 5-15 minutes;

[0163] 12.3 Place the above mixture on a magnetic rack. After the magnetic beads are completely adsorbed, remove the supernatant.

[0164] 12.4 Add 200 μl of 80% ethanol to wash the beads, incubate at room temperature for 30 seconds, and remove the supernatant;

[0165] 12.5 Repeat the previous step;

[0166] 12.6 Leave at room temperature for 5 minutes to allow the ethanol to evaporate;

[0167] 12.7 Add 32 μl of NF water, vortex to mix the magnetic beads, incubate at room temperature for 2 min, centrifuge briefly, and place the tube on the magnetic rack until the magnetic beads are completely adsorbed;

[0168] 12.8 Transfer 30 μL of supernatant to a new PCR tube;

[0169] Note: The product can be temporarily stored at -20°C.

[0170] 13. Library quality control and sequencing

[0171] After the library was constructed, the fragment size was detected and the concentration was quantitatively detected by QPCR using Agilent 2100. After passing the test, the library was sequenced on the Novasek6000 platform.

[0172] Example 2: Preparation of gDNA methylation library from severely degraded FFPE samples

[0173] 1. gDNA extraction from FFPE samples

[0174] Qiagen Circulating Nucleic Acid Kit was used to prepare cfDNA, catalog number 56404.

[0175] 1.1. Use a scalpel to trim excess paraffin from the sample block;

[0176] 1.2. Cut 8 slices of 10 μm thick;

[0177] 1.3. Immediately place the slices into a 1.5ml or 2ml microcentrifuge tube and cover it with a lid;

[0178] 1.4. Add 1000 μl of deparaffinization solution, vortex vigorously for 10 seconds, and then centrifuge briefly to bring the sample to the bottom of the tube;

[0179] 1.5. Incubate at 56°C for 3 minutes and then cool to room temperature.

[0180] The dewaxing solution may become waxy or solid after cooling. If this happens, add more dewaxing solution and repeat the 56°C incubation. If 320 μl of dewaxing solution is added, aspirate 160 μl of the upper dewaxing solution after 56°C.

[0181] 1.6. Add 180 μl Buffer ATL and 20 μl Proteinase K and mix by vortexing.

[0182] 1.7. Vortex and briefly centrifuge the sample;

[0183] 1.8. Incubate at 56°C for 1 hour;

[0184] 1.9. Incubate at 90°C for 1 hour;

[0185] 1.10. Briefly centrifuge the tube to remove droplets in the lid and transfer the lower clear phase to a new microcentrifuge tube (not provided).

[0186] 1.11. Add 200 μl of Buffer AL to the sample and mix thoroughly by vortexing. Then add 200 μl of ethanol (96-100%) and mix thoroughly by vortexing.

[0187] 1.12. Briefly centrifuge the 1.5 ml tube to remove any droplets on the inside of the lid.

[0188] 1.13. Carefully transfer the entire lysate to the QIAamp MinElute column (in a 2 ml collection tube) without wetting the rim, close the lid, and centrifuge at 6000 x g (8000 rpm) for 1 min. Place the QIAamp MinElute column in a clean 2 ml collection tube and discard the collection tube.

[0189] If the lysate does not completely pass through the membrane after centrifugation, centrifuge again at a higher speed until the QIAampMinElute column is empty.

[0190] 1.14. Carefully open the QIAamp MinElute column and add 500 μl of Buffer AW1 without wetting the edges. Close the lid and centrifuge at 6000 x g (8000 rpm) for 1 min. Place the QIAamp MinElute column in a clean 2 ml collection tube and discard the collection tube.

[0191] 1.15. Carefully open the QIAamp MinElute column and add 500 μl of Buffer AW2 without wetting the edges. Close the lid and centrifuge at 6000 x g (8000 rpm) for 1 min. Place the QIAamp MinElute column in a clean 2 ml collection tube and discard the collection tube.

[0192] 1.16. Centrifuge at full speed (20,000 x g; 14,000 rpm) for 3 min to completely dry the membrane.

[0193] 1.17. Place the QIAamp MinElute column in a clean 1.5 ml microcentrifuge tube (not required) and discard the collection tube. Carefully open the cap of the QIAamp MinElute column and add 20-100 μl of buffer ATE to the center of the column membrane.

[0194] 1.18. Cover the lid and incubate at room temperature for 5 min. Centrifuge at full speed (20,000 x g; 14,000 rpm) for 1 min.

[0195] 1.19. Take 1 μl of sample, quantify by Nanodrop, and take 5 μl to run agarose gel to evaluate the degree of sample degradation (as shown below) Figure 1 ).

[0196] 2. Shearing of FFPE gDNA

[0197] According to the quantitative results of Qubit, take 100-200ng of sample and use Bioruptor or Covaris interrupter for ultrasonic interruption. The interruption conditions are optimized based on the instrument manual, with an interruption time of 75s and a volume of 50μl. Take 35μl of DNA sample for downstream bisulfite conversion.

[0198] 3. Other steps are the same as 4 to 12 in Example 1.

[0199] Example 3: Cell-free DNA or FFPE genomic methylation libraries can be used for sequencing of methylation target regions

[0200] 1. The library preparation process is the same as 4 to 12 in implementation 1;

[0201] 2. Hybridization of samples and probes:

[0202] 2.1. Mixed samples:

[0203] 2.1.1. Refer to Table 5 for the amount of DNA library used. The total amount can be more than 1500ng, but not more than 4ug;

[0204] Table 5

[0205] Number of mixed samples The amount of each library Total library volume per reaction 1 500ng 500ng 2 500ng 1000ng 3 500ng 1500ng 4 375ng 1500ng 8 187.5ng 1500ng

[0206] 2.1.2. Calculate the amount of different samples and mix them evenly in a centrifuge tube.

[0207] 2.1.3. Add the following pre-hybridization reagents to the mixed sample and mix well, trying not to create bubbles.

[0208] Table 6

[0209] Components volume Twist probe panel 4ul Universal sealant 8ul Blocking agent solution 5μl Methylation Enhancer 2ul

[0210] 2.1.4. Dry the mixed pre-hybridization reagents in a vacuum concentrator at room temperature (if heating is required, please use low temperature).

[0211] 2.2. Hybridization:

[0212] 2.2.1. Incubate Fast Hybridization Mix at 65℃ for 10min or until all precipitates are dissolved. Vortex quickly and add 20ul of freeze-dried sample to resuspend the sample (do not let the hybridization solution return to room temperature). Mix gently with fingertips to avoid bubbles.

[0213] 2.2.2. Rapidly centrifuge to remove bubbles and add 30ul Hybridization Enhancer to the surface of the above reagents.

[0214] 2.2.3. Place the PCR tube in the preheated PCR instrument for hybridization.

[0215] 2.2.4. Set the following program according to Table 7 and run: Heat cover 85℃.

[0216] Table 7

[0217] temperature time 95℃ ∞ 95℃ 5min 60℃ 15min-4h

[0218] 2.3. Binding (capture):

[0219] 2.3.1. Shake the pre-equilibrated streptavidin magnetic beads until completely mixed, and add 100 μl of magnetic beads to a 1.5 ml centrifuge tube.

[0220] 2.3.2. Add 200ul of binding buffer and mix well by pipetting.

[0221] 2.3.3. Place the centrifuge tube on the magnetic rack for 1 minute or until the solution becomes clear, discard the supernatant and remove the centrifuge tube.

[0222] 2.3.4. Repeat the above washing steps 2 times, for a total of 3 times.

[0223] 2.3.5. After the last wash, add 200ul of binding buffer and resuspend by vortexing to mix thoroughly.

[0224] 2.3.6. After the hybridization is completed, open the lid of the PCR instrument and quickly transfer all the hybridization solution to the balanced magnetic beads.

[0225] 2.3.7. Mix the magnetic beads with hybridization solution thoroughly on an oscillator, rocker or rotator at room temperature for 30 minutes.

[0226] 2.3.8. Remove the centrifuge tube from the mixer, centrifuge quickly and place it on the magnetic rack for 1 minute, remove the supernatant and remove the tube.

[0227] 2.3.9. Add 200ul preheated washing solution 1 and mix well.

[0228] 2.3.10.Incubate at 63°C or 65°C for 5 min.

[0229] 2.3.11. Place the centrifuge tube on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0230] 2.3.12. Repeat the above steps, add 200ul preheated Wash Buffer 1 again and mix well.

[0231] 2.3.13. Incubate at 63°C or 65°C for 5 min.

[0232] 2.3.14. Transfer the liquid to a new tube; place it on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0233] 2.3.15. Add 200ul preheated wash buffer 2 and mix well using a pipette tip.

[0234] 2.3.16.Incubate at 48°C for 5 min.

[0235] 2.3.17. Place on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0236] 2.3.18. Repeat (steps 2.3.15-2.3.17) and wash twice, for a total of three times.

[0237] 2.3.19. For the last time, use a 10ul pipette tip to suck up the wash solution.

[0238] 2.3.20. Add 45ul of water, mix well, and incubate the solution on ice.

[0239] 2.4. PCR amplification, purification and quality inspection after hybridization capture:

[0240] 2.4.1. Set the following program according to Table 8 and run: Heat cover 105℃.

[0241] Table 8

[0242]

[0243] 2.4.2. Mix the magnetic bead mixture in step 2.3.20 and pipette 22.5ul into a 0.2ml PCR tube.

[0244] 2.4.3. Add 2.5ul amplification primers and 25ul KAPA HiFi HotStartReadyMix to a 0.2ml PCR tube, for a total of 50ul reaction system.

[0245] 2.4.4. Mix gently with a pipette tip, centrifuge quickly, then place in the PCR instrument to start amplification.

[0246] 2.4.5. Vortex to thoroughly mix the pre-equilibrated DNA purification magnetic beads.

[0247] 2.4.6. Add 90ul (1.8*) DNA purification magnetic beads to the amplified PCR product and vortex to mix thoroughly.

[0248] 2.4.7. Incubate at room temperature for 5 minutes.

[0249] 2.4.8. Place the centrifuge tube on the magnetic rack for 1 minute and remove the supernatant after the solution becomes clear.

[0250] 2.4.9. Without removing the centrifuge tube from the magnetic rack, directly add 200ul of freshly prepared 80% ethanol, incubate for 1 minute, and discard the supernatant; repeat the 80% ethanol wash once (2 times in total) and keep the centrifuge tube on the magnetic rack.

[0251] 2.4.10. Carefully remove the remaining ethanol with a 10ul pipette tip and leave at room temperature for 5-10 minutes or until the magnetic beads are dry. Be careful not to overdry the magnetic beads.

[0252] 2.4.11. Remove the tube from the magnetic rack and add 32ul of water, mix thoroughly by blowing with a pipette tip, and incubate at room temperature for 2min;

[0253] 2.4.12. Place the centrifuge tube on the magnetic rack for 3 minutes or until the solution becomes clear.

[0254] 2.4.13. Transfer 30ul of supernatant to a clean 0.2ml centrifuge tube.

[0255] 2.4.14. Take 1 μl of the library and use Qubit to quantify it, and record the library concentration.

[0256] 2.4.15. Take 1 μl of sample and use Agilent2100 to measure the length of library fragments.

[0257] 2.4.16. Sequencing was performed using the Illumina high-throughput sequencing platform.

[0258] Experimental Results

[0259] 1. The results of library preparation with different starting amounts of cfDNA in Example 1 are shown in Table 9:

[0260] Table 9: Results of library preparation with different starting amounts of cfDNA in Example 1

[0261]

[0262] Table 9 shows the library construction results of cfDNA at low starting amount.

[0263] The 2100 detection results of the library fragment distribution obtained by preparing libraries with different starting amounts of cfDNA in Example 1 are as follows Figure 2 As shown in A-2E. Figure 2 A- Figure 2 The starting amounts of cfDNA for E were 20ng, 10ng, 5ng, 3ng and 1ng respectively.

[0264] The library output and electropherogram shown in Table 9 ( Figure 2 The results of A-2E) show that this patented method can be applied to library preparation with samples as low as 1 ng.

[0265] 2. The comparison of the library output of the patented method in Example 1 and the commercially available kit in real lung cancer plasma is shown in Table 10:

[0266] Table 10

[0267]

[0268] Compared with the commercial method of the present application, the method of the present application obtains better library output under the same conditions, and shows a higher utilization rate of the original template under the same starting amount.

[0269] 3. Based on the library docking hybridization capture process of Example 1 (Example 3), the patented method is superior in terms of the deduplication sequencing depth and other indicators of the two methods. Please see Table 11 for specific comparison results.

[0270] Table 11: Comparison of data quality between the patented method and commercial kits used in cfDNA library construction and sequencing

[0271]

[0272] It can be seen from Table 11 that: using the same sample and input amount, after sequencing, the same number of reads were randomly extracted from the original data using the seqkit software. The results showed that compared with the commercial kit, the sequencing depth was effectively improved after deduplication, especially in the case of low starting amount, which can further improve the accuracy of panel application.

[0273] 5. The electrophoresis diagram of the FFPE-extracted genome in Example 2 is as follows Figure 3 shown.

[0274] Figure 3 The figure shows the electrophoresis diagram of FFPE-extracted genome, where lanes 1-6 are all genomic DNA samples extracted from the same batch. Figure 3 It can be seen that the electrophoresis channel is very diffuse, indicating that the sample shown is a degraded sample. The experimental results of the present application show that the degraded sample can be used to construct a library using the experimental method of the present application.

[0275] 6. Based on the library docking hybridization capture process of Example 2 (Example 3), the patented method is superior in terms of the deduplication sequencing depth and other indicators of the two methods. Please see Table 12 for specific comparison results.

[0276] Table 12: Comparison of data quality between the patented method and commercial kits used in FFPE gDNA library construction and sequencing

[0277]

[0278] As shown in Table 12, when the same samples and input amounts are used, the same number of reads are randomly extracted from the original data using the seqkit software after sequencing. The results show that compared with commercial kits, when applied to FFPE, a severely degraded tissue genome library, indicators such as sequencing depth can also be effectively improved.

[0279] 7. This application uses several linkers to prepare libraries, including long linkers, short linkers, and commercial linkers. The long linkers are linkers 1 and 2 used in this application; the sequence of the short linker is shorter than that of linker 1 and linker 2 used in this application; the commercial linker is the linker in the commercially available kit. The results of using the three linkers to prepare libraries are as follows:

[0280] Table 13: Quality inspection results of library preparation for three processes: long linker, short linker, and commercialization

[0281]

[0282] It can be seen from the total amount of the library shown in Table 13 that compared with the short linker and the commercially available linker, the linker 1 and linker 2 of the present application have the best library construction effect.

[0283] Table 14: Nucleotide sequences involved in this application

[0284]

[0285] Note: The sequences used in this application are based on the sequences shown in Table 14. The nucleotide sequences in the sequence table do not include information such as terminal phosphate modifications and nucleotides designated by N.

[0286] The method of this application can be applied to the construction of various types of full methylation libraries or target region libraries. Compared with existing commercial kits, after removing the linker and filtering the low-quality data after sequencing, the quality control results of the patented method are the best, especially in terms of sequencing depth. For samples with extremely low starting amount or severe degradation, the method of this application performs better.

Claims

1. A method for constructing a whole genome methylation library, comprising the following steps: (1) Extract and isolate target genomic DNA from biological samples; (2) performing bisulfite conversion on the extracted genomic DNA; (3) adding a phosphate to the 5' end of the genomic DNA fragment; (4) connecting the adapter 1 to one end of the genomic DNA fragment using a ligase, and capturing and purifying the genomic DNA fragment connected with the adapter 1; (5) using ligase to connect linker 2 to the other end of the genomic DNA fragment again, and capturing and purifying the genomic DNA fragment connected with linkers 1 and 2; (6) amplifying the library by PCR and purifying the product to obtain a whole genome methylation library; The lengths of the adapter 1 and adapter 2 are 30-50 nucleotides, respectively, preferably the lengths of the adapter 1 and adapter 2 are 32-45 nucleotides, respectively, and more preferably the lengths of the adapter 1 and adapter 2 are 33-42 nucleotides, respectively; The biological sample can be fresh tissue, FFPE sample (i.e. formalin-fixed paraffin-embedded sample) or plasma; The capture and purification steps in step (4) and step (5) are preferably completed using magnetic beads or purification columns; the purification column is preferably a purification column with a product number of ZYMO C1003-50; Wherein, when the biological sample is a fresh tissue or a FFPE sample, i.e. a formalin-fixed paraffin-embedded sample, step (1) also includes a step of fragmenting the genomic DNA; the fragmentation method is selected from nebulization, ultrasonic fragmentation, or HydroShear treatment.

2. The method for constructing a whole genome methylation library according to claim 1, wherein: The linker 1 in step (4) contains the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2, or consists of the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2; the linker 2 in step (5) contains the nucleotide sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4, or consists of the nucleotide sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4; preferably: The 5' end of the sequence shown in SEQ ID NO: 1 is phosphorylated; the 5' end of SEQ ID NO: 2 is not phosphorylated, and the 3' end is blocked by a blocking group; the blocking group is preferably a carbon spacer, dideoxynucleotide, etc.; The 5' end of the sequence shown in SEQ ID NO: 3 is phosphorylated; the 5' end of SEQ ID NO: 4 is not phosphorylated, and the 3' end is not blocked by a blocking group.

3. A method for constructing a whole genome methylation library according to any one of claims 1-2, wherein a DNA denaturation step is contained in step (3); it is used for nanogram-level genomic DNA, preferably 1ng-20ng, more preferably 1ng-10ng, more preferably 1ng-5ng, more preferably 1ng-3ng, most preferably 1ng; wherein the amount of magnetic beads used in steps (4) and (5) is 0.8-2 times, preferably 1-1.2 times.

4. A method for constructing a whole genome methylation library according to any one of claims 1 to 3, wherein the ligase used in steps (4) and (5) is selected from one or more of the following: NAD-dependent ligases, such as Taq DNA ligase, Thermus filiformis DNA ligase, Escherichia coli DNA ligase, Tth DNA ligase, Thermus scotoductus DNA ligase (I and II), thermostable ligases, Ampligase thermostable DNA ligase, VanC-type ligase and 9°N DNA ligase; and ATP-dependent ligases, including T4 RNA ligase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Pfu DNA ligase, DNA ligase I, DNA ligase III and DNA ligase IV; wherein the ligase used in steps (4) and (5) is preferably T4 DNA ligase.

5. The method for constructing a whole genome methylation library according to any one of claims 1 to 4, wherein: In the step (6), after amplifying the library by PCR and purifying the product, a quality detection step is also included: detecting the length of the amplified product fragment, when the product fragment length is 150bp-400bp, the obtained product is a whole genome methylation library; preferably, the product fragment length is 150-300bp.

6. A whole genome methylation library construction kit, which is used in the method for constructing a whole genome methylation library as claimed in any one of claims 1 to 5; It includes extraction and separation reagents of target genomic DNA, bisulfite conversion reagents, nucleic acid 5' end phosphorylation reagents, adapter 1 and adapter 2 oligonucleotides, adapter sequence connection reagents, magnetic beads, and PCR amplification reagents.

7. A method for sequencing a genomic methylation target region, comprising the following steps: (1) constructing a whole genome methylation library using the method for constructing a whole genome methylation library as described in any one of claims 1 to 5; (2) Library samples are hybridized and captured with probes; (3) Post-capture PCR amplification, purification and quality inspection.

8. A linker for constructing a DNA library, comprising or consisting of a nucleotide sequence as described in any one or more of SEQ ID NOs: 1-4.

9. The adaptor for constructing a DNA library according to claim 8, wherein the library is a whole genome methylation library.

10. The adaptor for constructing a DNA library according to claim 8, wherein the library is a micro-library; preferably, the library is a micro-DNA whole genome methylation library.

Images