Thyroid protein detection probe based on aptamer fluorescence enhancement and application thereof

Abstract

The invention discloses a thyroid protein detection probe based on aptamer fluorescence enhancement and application of the thyroid protein detection probe, and belongs to the technical field of biological medicine. The thyroglobulin aptamer probe Tg-Apt is obtained by modifying a fluorophore in a specific area, and the aptamer probe has high affinity and specificity and can be specifically combined with Tg in a complex biological sample. The aptamer probe Tg-Apt and a to-be-detected sample are subjected to a mixed reaction, and when Tg-Apt is combined with thyroglobulin, a fluorescence enhancement phenomenon occurs to realize detection of thyroglobulin, so that rapid identification of thyroid cancer or thyroid cancer metastasis is realized. The detection method disclosed by the invention has the characteristics of high sensitivity, high specificity and simplicity, convenience and rapidness in operation, provides an effective tool for diagnosis and treatment of thyroid cancer, and has a good clinical application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a thyroid protein detection probe based on aptamer fluorescence enhancement and application thereof. Background Art

[0002] Thyroid cancer is one of the most common malignant tumors in the endocrine system. Its incidence has been on the rise in recent years, especially the rapid increase in the incidence of papillary thyroid carcinoma (PTC). Cervical lymph node metastasis is a common phenomenon in patients with thyroid cancer. About 50% of PTC patients may have cervical lymph node metastasis in the early stage or during postoperative follow-up. The presence or absence of cervical lymph node metastasis has an important impact on the staging, treatment strategy selection and prognosis evaluation of thyroid cancer.

[0003] Thyroglobulin (Tg) is a macromolecular glycoprotein synthesized and secreted by thyroid follicular epithelial cells and a key protein for the synthesis of thyroid hormones. In patients with thyroid cancer, especially differentiated thyroid cancer, including papillary thyroid carcinoma, the expression level of Tg is usually elevated. Therefore, Tg is often used as a tumor marker for thyroid cancer, and its detection is of great significance for the diagnosis, efficacy evaluation and recurrence monitoring of thyroid cancer. By detecting the Tg level, it can assist in determining the lymph node metastasis of thyroid cancer and provide useful guidance for surgeons to determine the scope of lymph node dissection during surgery.

[0004] However, there are some defects in the current detection methods of Tg. Traditional detection methods such as radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA) have problems such as complex operation, long time consumption, and the need for professional technicians and equipment. In addition, the sensitivity and specificity of these methods need to be improved, and it is difficult to achieve rapid bedside detection. Based on this, it is particularly important to develop a highly sensitive, highly specific, easy-to-operate and rapid Tg detection method. Summary of the invention

[0005] To solve the above technical problems, the present invention provides a method for detecting thyroglobulin based on the fluorescence enhancement effect of aptamers. The method contains a thyroglobulin aptamer probe modified with a fluorescent group at a specific position, and detects the presence or absence of thyroglobulin by the change of fluorescence intensity in the system. The operation is simple and easy to read. Compared with the same aptamer that is not modified or otherwise modified, the probe of the present invention has significantly improved sensitivity, specificity, accuracy, etc. in detecting thyroglobulin.

[0006] The first object of the present invention is to provide a probe composition for detecting thyroglobulin, wherein the probe composition comprises a first probe and a second probe.

[0007] The first probe comprises a thyroglobulin aptamer having a nucleotide sequence as shown in SEQ ID NO.1, and the 20th base (T) of the thyroglobulin aptamer is modified with a fluorescent group;

[0008] The second probe is an arbitrary sequence that does not bind to thyroglobulin, and the sequence is modified with a fluorescent group, which can be modified at any position.

[0009] Furthermore, the second probe comprises a nucleotide sequence as shown in SEQ ID NO.2.

[0010] Preferably, the 21st base (T) of the sequence shown in SEQ ID NO.2 is modified with a fluorescent group.

[0011] Furthermore, the fluorescent groups include but are not limited to Cy3, Cy5, etc. These fluorescent groups absorb photons of a certain wavelength and then emit light waves of a specific wavelength, and are covalently linked to the nucleic acid aptamer molecules as markers.

[0012] Protein-induced fluorescence enhancement (PIFE) is a method for studying DNA-protein interactions at the single-molecule level, and refers to the phenomenon that the fluorescence quantum yield increases when the dye is close to the protein macromolecule. In the present invention, the anthocyanin fluorescent group Cy3 is modified in a specific region of the aptamer fluorescent probe Tg-Apt (first probe), which produces protein-induced fluorescence enhancement (PIFE) after binding to Tg. Therefore, due to the specific binding of the nucleic acid aptamer to the protein and the PIFE effect, the detection of thyroglobulin can be achieved by detecting the fluorescent signal. Moreover, the present invention can further improve the detection performance by adding the fluorescence response of the random sequence Tg-Scrb probe to the detection system.

[0013] The second object of the present invention is to provide a probe for detecting thyroglobulin, wherein the probe comprises a thyroglobulin aptamer having a nucleotide sequence as shown in SEQ ID NO.1, and the 20th base (T) of the thyroglobulin aptamer is modified with a fluorescent group.

[0014] The third object of the present invention is to provide the use of the above probe or probe combination in the preparation of products for detecting thyroglobulin, thyroid cancer or thyroid cancer metastasis.

[0015] The detection principle of the present invention is: a fluorescent group is modified in a specific region of the aptamer fluorescent probe Tg-Apt (corresponding to the first probe), which generates a protein-induced fluorescence enhancement phenomenon (PIFE) after binding to Tg. In contrast, although the random probe Tg-Scrb (corresponding to the second probe) is modified with a fluorescent group in the corresponding region, since it cannot bind to Tg, no fluorescence enhancement will occur when it coexists with Tg in the same system. The sample to be tested is incubated with Tg-Apt and Tg-Scrb respectively to obtain fluorescence values ​​F1 and F2, and statistical analysis can be performed to assist in determining whether thyroid cancer metastasis has occurred.

[0016] Furthermore, the thyroid cancer includes but is not limited to papillary thyroid cancer, follicular thyroid cancer, mixed papillary-follicular thyroid cancer, medullary thyroid cancer, anaplastic thyroid cancer, etc.

[0017] Furthermore, the sites of thyroid cancer metastasis include but are not limited to lymph nodes, bones, liver, brain, etc., so the sample to be tested can be derived from the puncture fluid of the above sites.

[0018] Furthermore, when the probe composition is used to detect thyroglobulin or thyroid cancer metastasis, the application includes the steps of mixing the sample to be tested with the first probe and the second probe respectively, and detecting the fluorescence intensity in the system.

[0019] Further, the following steps are included:

[0020] S1, mixing the sample to be tested with the first probe and incubating them, and detecting the fluorescence intensity after the incubation, which is recorded as F1;

[0021] The sample to be tested is mixed with the second probe for incubation, and the fluorescence intensity is detected after the incubation is completed, which is recorded as F2;

[0022] S2. Calculate n=F1 / F2, and determine whether thyroglobulin exists or whether thyroid cancer metastasis occurs based on the calculated n.

[0023] Preferably, if there is a statistical difference between F1 and F2 (p<0.05), it indicates the presence of thyroglobulin in the system, and if the sample is derived from a metastatic site, it indicates the occurrence of thyroid cancer metastasis.

[0024] Preferably, the detection comprises the following steps:

[0025] Step (1): Mix the first probe, the sample to be tested, and glycerol in a detection buffer under light-proof conditions, and detect the fluorescence intensity, which is recorded as F1;

[0026] Step (2): Mix the second probe, the sample to be tested, and glycerol in a detection buffer under light-proof conditions, and detect the fluorescence intensity, which is recorded as F2;

[0027] Step (3): Calculate n = F1 / F2.

[0028] Preferably, in step (1) or step (2), the pH of the detection buffer is 6.0-8.0, and most preferably it is Tris-HCl buffer with a concentration of 15-30 mM.

[0029] Preferably, in step (1) or step (2), the concentration of the first probe or the second probe in the reaction system is 5.0-15.0 μM.

[0030] Preferably, in step (1) or step (2), the final concentration of glycerol in the reaction system is 5-15% (v / v).

[0031] Furthermore, when the probe is used to detect thyroid cancer, the application includes the steps of mixing the probe with the sample to be tested and the sample from a healthy individual (the samples are obtained in the same way except for the different individuals from which they come), and detecting the fluorescence intensity in the system.

[0032] Further, the following steps are included:

[0033] S01, the sample to be tested is mixed with the probe for incubation, and the fluorescence intensity is detected after the incubation is completed, which is recorded as F1';

[0034] The samples from healthy individuals were mixed with the probes and incubated, and the fluorescence intensity was detected after the incubation, which was recorded as F2';

[0035] S02. Calculate n'=F1' / F2', and determine whether thyroid cancer occurs or the risk of developing it based on the calculated n'. Preferably, if F1' is significantly higher than F2' (p<0.05), it indicates the occurrence of thyroid cancer or indicates a higher risk of developing it.

[0036] By means of the above scheme, the present invention has at least the following advantages:

[0037] (1) The present invention discloses for the first time a detection scheme in which fluorescent groups are modified on a Tg aptamer so that fluorescence enhancement occurs after binding to Tg. This is not only the first time that a Tg aptamer has been used for fluorescence detection of Tg, but also the first time that the PIFE phenomenon has been discovered in a Tg aptamer. The occurrence of the PIFE phenomenon enables Tg to be detected by fluorescence enhancement, which is beneficial for eliminating interference in complex background signals and obtaining more accurate detection results.

[0038] (2) The present invention designs Tg-Scrb, which has the same length as Tg-Apt and is modified with a fluorescent group at the same position, but the sequence is a random sequence. Tg-Scrb cannot effectively bind to Tg, so there is no PIFE phenomenon. The present invention assists in the identification of thyroid cancer metastasis during surgery by comparing the fluorescence intensity of the same sample reacting with Tg-Apt and Tg-Scrb and performing statistical analysis.

[0039] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention in conjunction with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.

[0041] Figure 1 Schematic diagram of the principle of the detection method of the present invention. DETAILED DESCRIPTION

[0042] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0043] The scheme involved in the present invention is as follows:

[0044] The Tg-Apt of the present invention is a specific aptamer of Tg, which is a single-stranded DNA with a length of 40 bases. Its binding constant with Tg is as high as 3.18μM, and it can specifically bind to Tg in biological samples through weak interactions such as hydrogen bonds. At present, there are few cases of using Tg aptamers for Tg detection, especially the construction of a fluorescence detection system and its use for thyroid cancer metastasis identification (such as intraoperative identification of cervical lymph node metastasis of papillary thyroid carcinoma) There is no public report. The present invention modifies the anthocyanin dye Cy3 on the 20th T base (5'→3' direction) of the Tg aptamer to obtain Tg-Apt, and it is found that Tg-Apt binds to Tg and will produce significant fluorescence enhancement. The enhancement effect comes from protein-induced fluorescence enhancement (PIFE), which is a fluorescence enhancement effect caused by the viscosity change of the chemical environment of Cy3 modified on DNA after a protein binds to DNA. The fluorescence enhancement amplitude produced by this effect is positively correlated with the Tg concentration, and can be used for Tg detection and intraoperative identification of cervical lymph node metastasis of papillary thyroid carcinoma.

[0045] The drugs and reagents involved in the following examples are as follows:

[0046] Tg-Apt and Tg-Scrb were purchased from Shanghai Bioengineering, Tris, hydrochloric acid, and glycerol were purchased from Aladdin Reagents China Co., Ltd., recombinant human Tg (catalog number ab152743) was purchased from Abcam, and the CLIA detection kit was purchased from Roche.

[0047] The sequence of Tg-Apt is (SEQ ID NO.1):

[0048] 5'-CGCGTGAGCGGGGAGGCGA / iCy3dT / GCCCAGGCTAACTTGACT CA-3',

[0049] The sequence of Tg-Apt-a is:

[0050] 5'-CGCG / iCy3dT / GAGCGGGGAGGCGATGCCCAGGCTAACTTGACT CA-3',

[0051] The sequence of Tg-Apt-b is:

[0052] 5'-CGCGTGAGCGGGGAGGCGATGCCCAGGC / iCy3dT / AACTTGACT CA-3',

[0053] The sequence of Tg-Apt-c is:

[0054] 5'-CGCGTGAGCGGGGAGGCGATGCCCAGGCTAAC / iCy3dT / TGACT CA-3',

[0055] The sequence of Tg-Apt-d is:

[0056] 5'-CGCGTGAGCGGGGAGGCGATGCCCAGGCTAACT / iCy3dT / GACT CA-3',

[0057] The sequence of Tg-Apt-e is:

[0058] 5'-CGCGTGAGCGGGGAGGCGATGCCCAGGCTAACTTGAC / iCy3dT / CA-3',

[0059] The sequence of Tg-Scrb is (SEQ ID NO.2):

[0060] 5'-CGCAAATTCCGGGCTAGCGA / iCy3dT / GCCCGAGCAATCAAGAA GTC-3', wherein / iCy3dT / indicates that the T base at this position is modified with Cy3.

[0061] Example 1: Fluorescence enhancement response of Tg-Apt to Tg

[0062] Prepare the detection buffer with a Tris concentration of 20 mM and adjust the pH to 7.4 with HCl. Dissolve Tg-Apt and Tg-Scrb in Tris-HCl buffer to a concentration of 10 μM. Dilute the recombinant human Tg with Tris-HCl buffer to obtain a Tg standard with a concentration of 5 μg / mL.

[0063] Group 1: Tg-Apt (20 μL, 10 μM), detection buffer (40 μL), and glycerol (10 μL) were mixed, reacted at 25°C for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0064] Group 2: Tg standard (20 μL, 5 μg / mL), Tg-Apt (20 μL, 10 μM), detection buffer (50 μL), and glycerol (10 μL) were mixed, reacted at 25°C for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0065] Group 3: Tg standard (20 μL, 5 μg / mL), Tg-Apt-a (20 μL, 10 μM), detection buffer (50 μL), and glycerol (10 μL) were mixed, reacted at 25°C for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0066] Group 4: Tg standard (20 μL, 5 μg / mL), Tg-Apt-b (20 μL, 10 μM), detection buffer (50 μL), and glycerol (10 μL) were mixed, reacted at 25°C for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0067] Group 5: Tg standard (20 μL, 5 μg / mL), Tg-Apt-c (20 μL, 10 μM), detection buffer (50 μL), and glycerol (10 μL) were mixed, reacted at 25°C for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0068] Group 6: Tg standard (20 μL, 5 μg / mL), Tg-Apt-d (20 μL, 10 μM), detection buffer (50 μL), and glycerol (10 μL) were mixed, reacted at 25°C for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0069] Group 7: Tg standard (20 μL, 5 μg / mL), Tg-Apt-e (20 μL, 10 μM), detection buffer (50 μL), and glycerol (10 μL) were mixed, reacted at 25°C for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0070] Group 8: Tg-Scrb (20 μL, 10 μM), detection buffer (40 μL), and glycerol (10 μL) were mixed, reacted at 25° C. for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0071] Group 9: Tg standard (20 μL, 5 μg / mL), Tg-Scrb (20 μL, 10 μM), detection buffer (50 μL), and glycerol (10 μL) were mixed, reacted at 25°C for 20 min, and fluorescence detection (excitation wavelength 540 nm, emission wavelength 570 nm) was performed. Six parallel groups were set up.

[0072] Table 1 Detection results of different probes on Tg standards

[0073]

[0074] The above results show that the binding of Tg-Apt to Tg will produce significant fluorescence enhancement, while Apt and Tg-Scrb modified with Cy3 groups at other T bases do not have this property, indicating that the Tg-Apt proposed in the present invention has the characteristic of responding to Tg. At the same time, only 5 μg / mL of Tg can cause a high fluorescence enhancement (ratio=2371.2 / 1532.4=1.55), indicating that this method has good detection sensitivity for Tg. Subsequently, the signal-to-noise ratio = 3 method was used to determine that the detection sensitivity of this method for Tg was 0.1 μg / mL.

[0075] Example 2: Construction of a reaction system for detecting human Tg in an analyte and its application in detecting lymph node metastasis of papillary thyroid carcinoma

[0076] Study subjects: Specimens were collected from 29 patients undergoing surgery. All specimens were punctured with a syringe during surgery and sampled for future use. A total of 29 lymph nodes were confirmed by surgical pathology, including 16 metastatic lymph nodes and 13 non-metastatic lymph nodes.

[0077] Sampling: Use a 26-gague syringe needle to puncture the sample three times and connect the needle after sampling to a 1 mL syringe.

[0078] Sample pretreatment: Take a solution tube containing 150 μL PBS buffer and equilibrate it to room temperature. Make sure all the liquid is at the bottom of the tube before use. Insert the syringe needle after puncture sampling into the buffer solution, and wash and mix it thoroughly by repeated aspiration to prepare the sample to be tested.

[0079] Detection: Set up a detection group and a control group. The detection group is a mixture of sample (20μL), Tg-Apt (20μL, 10μM), detection buffer (40μL), and glycerol (10μL), reacted at 25℃ for 20min, and fluorescence detection (excitation wavelength 540nm, emission wavelength 570nm), set up 6 parallel groups, and the average fluorescence value is recorded as F1. The control group is a mixture of sample (20μL), Tg-Scrb (20μL, 10μM), detection buffer (40μL), and glycerol (10μL), reacted at 25℃ for 20min, and fluorescence detection (excitation wavelength 540nm, emission wavelength 570nm), set up 6 parallel groups, and the average fluorescence value is recorded as F2.

[0080] Results and Discussion:

[0081] Table 2 Results of different lymph node detection

[0082]

[0083]

[0084] The results showed that there was a significant difference in Tg in the puncture fluid between the metastatic lymph node group and the non-metastatic lymph node group (Table 2). The average value was taken for statistical analysis, p<0.001, and the test results were consistent with the sample source, with an accuracy of 100%. This provides a reliable and convenient detection tool for rapid diagnosis of lymph node metastasis in PTC.

[0085] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A probe composition for detecting thyroglobulin, characterized in that: The probe composition comprises a first probe and a second probe, The first probe comprises a thyroglobulin aptamer having a nucleotide sequence as shown in SEQ ID NO.1, and the 20th base of the thyroglobulin aptamer is modified with a fluorescent group; The second probe is a random sequence that does not bind to thyroglobulin, and the sequence is modified with a fluorescent group.

2. The probe composition according to claim 1, characterized in that The second probe comprises a nucleotide sequence as shown in SEQ ID NO.

2.

3. The probe composition according to claim 1, characterized in that The fluorescent group includes Cy3 or Cy5.

4. A probe for detecting thyroglobulin, characterized in that: The probe comprises a thyroglobulin aptamer with a nucleotide sequence as shown in SEQ ID NO.1, and the 20th base of the thyroglobulin aptamer is modified with a fluorescent group.

5. Use of the probe composition according to any one of claims 1 to 3 or the probe according to claim 4 in the preparation of a product for detecting thyroglobulin, thyroid cancer or thyroid cancer metastasis.

6. The use according to claim 5, characterized in that: The thyroid cancer includes papillary thyroid cancer, follicular thyroid cancer, mixed papillary-follicular thyroid cancer, medullary thyroid cancer or anaplastic thyroid cancer.

7. The use according to claim 5, characterized in that: When the probe combination is used for detection, the application includes the steps of mixing the sample to be detected with the first probe and the second probe respectively, and detecting the fluorescence intensity in the system.

8. The use according to claim 7, characterized in that: The following steps are involved: S1, mixing the sample to be tested with the first probe, and detecting the fluorescence intensity, which is recorded as F1; Mixing the sample to be tested with the second probe, and detecting the fluorescence intensity, which is recorded as F2; S2. Compare F1 and F2 to obtain the test results.

9. The use according to claim 5, characterized in that: When the probe is used for detection, the application includes the steps of mixing the probe with the sample to be tested and the negative control sample respectively, and detecting the fluorescence intensity in the system.

10. The use according to claim 9, characterized in that: The following steps are involved: S01, mixing the sample to be tested with the probe, and detecting the fluorescence intensity, which is recorded as F1'; The negative control sample was mixed with the probe, and the fluorescence intensity was detected, which was recorded as F2'; S02. Compare F1' and F2' to obtain the detection result.

Images