Acetylated ribonucleic acids and uses thereof

Abstract

Disclosed herein are a modified ribonucleotide comprising a nucleoside comprising 2 '-O-acetylated ribose, and a polyribonucleotide comprising the same. Also provided herein are compositions comprising the polyribonucleotides of the present disclosure and methods of making and using the same.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 338,429 filed on May 4, 2022, the entire contents of which are hereby incorporated by reference. Background Art

[0003] RNA therapeutics is an emerging field. Summary of the invention

[0004] The present disclosure identifies certain challenges faced in producing RNA for applications such as therapeutic applications, as well as challenges faced in using RNA as a therapeutic agent. For example, in some embodiments, the present disclosure identifies certain problems that may be encountered when using currently available RNA for therapeutic agents due to, for example, the transient activity and / or instability of the RNA. In some embodiments, the instability of the RNA can be traced to, for example, the reactivity of the hydroxyl group on carbon 2 of the ribose of a ribonucleotide.

[0005] Among other things, the present disclosure provides technology related to 2-O-acetylated nucleotides, wherein the hydroxyl group on carbon 2 of the ribose is acetylated (2-O-acetylated ribose). Without wishing to be bound by theory, in some embodiments, ribonucleotides with 2-O-acetylated ribose can maintain key hydrogen bonding interactions necessary for transcription, translation, and duplex formation while having reduced reactivity that would otherwise promote RNA spontaneous hydrolysis and nuclease degradation. In some embodiments, ribonucleotides with 2-O-acetylated ribose are more stable than comparable RNAs with fewer 2-O-acetyl groups on the ribose.

[0006] The technology provided by the present disclosure is to use 2-O-acetylated nucleotide triphosphate as reagent for using RNA polymerase to carry out the technology of in vitro transcription of polyribonucleotide.In some embodiments, RNA polymerase can use 2-O-acetylated nucleotide triphosphate to produce 2-O-acetylated polyribonucleotide, which can be translated by the intracellular mechanism of cell.In some embodiments, 2-O-acetylated polyribonucleotide can be used for multiple applications, including therapeutic agent application, research application, diagnostic application, agricultural application and any other suitable application.

[0007] The present disclosure also provides a technology for reducing the immunogenicity of RNA therapeutics by providing polyribonucleotides comprising modified ribonucleotides (e.g., 2-O-acetylated ribose). Without wishing to be bound by theory, the present disclosure proposes that polyribonucleotides comprising 2-O-acetylated ribose can be reduced by the activation of innate immune response when applied to cells, tissues or subjects to achieve immunogenicity reduction. In some embodiments, polyribonucleotides comprising 2-O-acetylated ribose or compositions comprising it are used to reduce the activation of innate immune response, such as NF-kb or NF-kb pathways, IRF or IRF pathways and / or other inflammatory cytokines; or molecular sensors (e.g., RIG-I) detect uncapped RNA and reduce the repeated administration of the polyribonucleotides or compositions comprising it, for example, at least two doses. In some embodiments, compared with reference polyribonucleotides comprising less 2'-O-acetyl groups on ribose, polyribonucleotides comprising 2-O-acetylated ribose or compositions comprising it can be administered at a higher dose.

[0008] Also provided herein is the technology of increasing the expression of RNA therapeutic agent by providing polyribonucleotides comprising modified ribonucleotides (e.g., ribonucleotides comprising 2-O-acetylated ribose). Without wishing to be bound by theory, the disclosure proposes that, compared with the comparable polyribonucleotides having less 2'-O-acetyl groups on the ribose, the polyribonucleotides comprising 2-O-acetylated ribose can realize protein or polypeptide expression level increase when being administered to cells, tissues or subjects.

[0009] Further provided herein is a technology for increasing the persistence of RNA therapeutic agents by providing polyribonucleotides comprising modified ribonucleotides (e.g., ribonucleotides comprising 2-O-acetylated ribose). Without wishing to be bound by theory, the disclosure proposes that, compared with the comparable polyribonucleotides having less 2'-O-acetyl groups on the ribose, the polyribonucleotides comprising 2-O-acetylated ribose can realize persistence increase when applied to cells, tissues or subjects. In some embodiments, persistence increase is the result of increased resistance to one or more nucleases. In some embodiments, persistence increase can also allow reduction of the frequency of administration and / or reduction of the dosage of the polyribonucleotides comprising modified ribonucleotides (e.g., ribonucleotides comprising 2-O-acetylated ribose).

[0010] Also provided herein are compositions comprising polyribonucleotides comprising 2-O-acetylated ribose and methods of making and using the same.

[0011] The present disclosure provides modified ribonucleotides comprising nucleosides, wherein the nucleosides comprise a ribose moiety comprising an acetyl group, wherein the ribose is 2'-O-acetylated. In some embodiments, the modified ribonucleotide has the following structure:

[0012]

[0013] (a) wherein X is a 5' monophosphate, a 5' diphosphate or a 5' triphosphate; and

[0014] (b) wherein R is a nucleobase selected from the group consisting of adenine or a modified form thereof, guanine or a modified form thereof, cytosine or a modified form thereof, or uracil or a modified form thereof.

[0015] In some embodiments, the modified ribonucleotide has a 5' triphosphate and the following structure:

[0016]

[0017] wherein R is a nucleobase selected from the group consisting of adenine or a modified form thereof, guanine or a modified form thereof, cytosine or a modified form thereof, or uracil or a modified form thereof.

[0018] In some embodiments, the nucleobase is adenine. In some embodiments, the polyribonucleotide comprising adenine has a 5' triphosphate and the following structure:

[0019]

[0020] In some embodiments, the nucleobase is guanine. In some embodiments, the polyribonucleotide comprising guanine has a 5' triphosphate and the following structure:

[0021]

[0022] In some embodiments, the nucleobase is cytosine. In some embodiments, the polyribonucleotide comprising cytosine has a 5' triphosphate and the following structure:

[0023]

[0024] In some embodiments, the nucleobase is uracil. In some embodiments, the polyribonucleotide has 5' triphosphate and the following structure, and has the following structure:

[0025]

[0026] Also provided herein are polyribonucleotides comprising one or more modified ribonucleotides (e.g., ribonucleotides comprising 2-O-acetylated ribose). In some embodiments, the polyribonucleotides comprise a plurality of ribonucleotides selected from: adenine, guanine, cytosine or uracil, or any combination thereof.

[0027] In some embodiments, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the ribose moieties in the polyribonucleotides are acetylated (2'-O-acetylated).

[0028] In some embodiments, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of the ribose moieties in the polyribonucleotides are acetylated (2'-O-acetylated).

[0029] In some embodiments, at least about 95% of the ribose moieties are 2'-O-acetylated.

[0030] In some embodiments, 100% of the ribose moieties in the polyribonucleotide are acetylated (2'-O-acetylated).

[0031] In some embodiments, the polyribonucleotide comprises a cap structure. In some embodiments, the cap structure does not comprise 2'-O-acetylated ribose. In some embodiments, the cap structure comprises 2'-O-acetylated ribose.

[0032] In some embodiments, the polyribonucleotide comprising 2-O-acetylated ribose (e.g., comprising adenine comprising 2-O-acetylated ribose, guanine comprising 2-O-acetylated ribose, cytosine comprising 2-O-acetylated ribose, and / or uracil comprising 2-O-acetylated ribose) further comprises modifications including: a modified backbone, a modified nucleobase, or any combination thereof.

[0033] In some embodiments, the polyribonucleotide comprising 2-O-acetylated ribose (e.g., comprising adenine comprising 2-O-acetylated ribose, guanine comprising 2-O-acetylated ribose, cytosine comprising 2-O-acetylated ribose, and / or uracil comprising 2-O-acetylated ribose) further comprises a modified backbone.

[0034] In some embodiments, the polyribonucleotide comprising 2-O-acetylated ribose (e.g., comprising adenine comprising 2-O-acetylated ribose, guanine comprising 2-O-acetylated ribose, cytosine comprising 2-O-acetylated ribose and / or uracil comprising 2-O-acetylated ribose) also comprises a modified nucleobase. In some embodiments, the modified nucleobase is selected from adenine, guanine, cytosine or uracil. In some embodiments, the modified nucleobase is adenine. In some embodiments, the modified nucleobase is cytosine. In some embodiments, the modified nucleobase is guanine. In some embodiments, the modified nucleobase is uracil.

[0035] In some embodiments, nucleobase modifications include modifications known in the art or as disclosed herein. In some embodiments, the nucleobase modification includes: N4-acetyl-cytidine (ac4C), 5-hydroxymethyluridine (5-hmU), N1-methylpseudouridine, pseudouridine, pyridine-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 5-methylcytidine (m5C), 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, inosine (I), 1-methyl-inosine (m1 I), wyosine (imG), methyl wyosine (mimG), or any combination thereof.

[0036] In some embodiments, the polyribonucleotide comprising 2-O-acetylated ribose (e.g., comprising adenine comprising 2-O-acetylated ribose, guanine comprising 2-O-acetylated ribose, cytosine comprising 2-O-acetylated ribose, and / or uracil comprising 2-O-acetylated ribose) further comprises a nucleoside comprising an acetyl group, wherein the nucleoside is N4-acetylcytidine, and the modified ribonucleotide has the following structure:

[0037]

[0038] In some embodiments, the polyribonucleotides comprise cytidine residues and about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 1 ... 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the cytidine residues contain N4-acetyl cytidine.

[0039] In some embodiments, the polyribonucleotides comprise cytidine residues and at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the cytidine residues in the polyribonucleotides comprise N4-acetyl cytidine.

[0040] In some embodiments, the polyribonucleotide comprising 2-O-acetylated ribose (e.g., adenine comprising 2-O-acetylated ribose, guanine comprising 2-O-acetylated ribose, cytosine comprising 2-O-acetylated ribose, and / or uracil comprising 2-O-acetylated ribose) further comprises one or more modified ribonucleotides comprising a hydroxymethyl group. In some embodiments, the one or more modified ribonucleotides comprise a nucleoside selected from the following: adenosine, guanosine, cytidine or uridine, or any combination thereof. In some embodiments, the nucleoside of the one or more modified ribonucleotides is 5-hydroxymethyluridine, and the modified ribonucleotide has the following structure:

[0041]

[0042] In some embodiments, the polyribonucleotides comprise uridine residues and about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 1 ...5%, about 5% to 20%, about 5% to 15%, about 5% to 25 About 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the uridine residues comprise 5-hydroxymethyluridine.

[0043] In some embodiments, the polyribonucleotides comprise uridine residues and at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine.

[0044] The present disclosure also provides a method for preparing a polyribonucleotide comprising 2-O-acetylated ribose. In some embodiments, a method for producing a polyribonucleotide is disclosed herein, comprising the step of incubating an in vitro transcription mixture, wherein the in vitro transcription mixture comprises: (i) a DNA template; (ii) at least one RNA polymerase or its variant or fragment; and (iii) a plurality of ribonucleotides comprising at least one modified ribonucleotide comprising 2'-O-acetylated ribose; thereby producing a polyribonucleotide comprising 2'-O-acetylated ribose.

[0045] Also disclosed herein is an in vitro transcription mixture that can be used to produce a polyribonucleotide comprising 2'-O-acetylated ribose. In some embodiments, disclosed herein is an in vitro transcription mixture that comprises: (i) a DNA template; (ii) at least one RNA polymerase or its variant or fragment; and (iii) a plurality of ribonucleotides comprising at least one modified ribonucleotide comprising 2'-O-acetylated ribose.

[0046] In some embodiments, the method or in vitro transcription mixture produces a plurality of polyribonucleotides. In some embodiments, each polyribonucleotide in the plurality of polyribonucleotides comprises a 2'-O-acetylated ribose.

[0047] In some embodiments, the polyribonucleotides produced using the methods or in vitro transcription mixtures disclosed herein further comprise one or more modifications, such as one or more base modifications.

[0048] In some embodiments, the RNA polymerase is selected from: bacteriophage RNA polymerase, mitochondrial RNA polymerase, eukaryotic RNA polymerase, bacterial RNA polymerase, or any combination thereof. In some embodiments, the RNA polymerase comprises T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, viral RNA polymerase, N4 virion RNA polymerase, or a variant of any of the foregoing.

[0049] In some embodiments, the polyribonucleotides produced by the methods disclosed herein or used in an in vitro transcription mixture include a polyribonucleotide comprising a coding region.

[0050] In some embodiments, the polyribonucleotides produced by the methods disclosed herein or used in an in vitro transcription mixture include polyribonucleotides that do not include a coding region.

[0051] In some embodiments, the polyribonucleotides produced by the methods disclosed herein or using an in vitro transcription mixture include guide RNA, short hairpin RNA, siRNA, microRNA, long noncoding RNA, or messenger RNA (mRNA), circular RNA, or any combination thereof.

[0052] In some embodiments, the polyribonucleotide encoding payload is produced by the methods disclosed herein or using an in vitro transcription mixture. In some embodiments, the payload comprises one or more target polypeptides.

[0053] In some embodiments of the methods of producing ribonucleotides disclosed herein, the incubating step occurs at a temperature of at least 37°C.

[0054] In some embodiments of the methods of producing ribonucleotides disclosed herein, the incubating step occurs at a temperature of about 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C or more.

[0055] In some embodiments of the methods of producing ribonucleotides disclosed herein, the incubating step is performed for at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, or longer.

[0056] Also provided herein are compositions comprising polyribonucleotides disclosed herein, such as polyribonucleotides prepared according to methods disclosed herein. In some embodiments, the composition is or includes a pharmaceutical composition. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the pharmaceutical composition is or includes an immunogenic composition. In some embodiments, the pharmaceutical composition is or includes an antibody therapy. In some embodiments, the pharmaceutical composition is or includes an immunomodulatory therapy. In some embodiments, the pharmaceutical composition is or includes a vaccine. In some embodiments, the pharmaceutical composition is or includes a gene therapy. In some embodiments, the pharmaceutical composition is or includes chemotherapy. In some embodiments, the pharmaceutical composition is or includes a protein replacement therapy. In some embodiments, the pharmaceutical composition is or includes an immunotherapy. In some embodiments, the pharmaceutical composition is or includes a cell engineering therapy.

[0057] In some embodiments, the composition includes double-stranded RNA.

[0058] Also provided herein is a method comprising administering to a cell, tissue or subject a polyribonucleotide disclosed herein or a composition comprising the same. In some embodiments, the method further comprises determining the cell viability of the cell, tissue or subject.

[0059] In some embodiments, cell viability is the measurement of one or more cell survival time lengths of a cell, tissue or subject.In some embodiments, cell viability is the measurement of the cell quantity of a cell, tissue or subject that survives at one or more time points.In some embodiments, compared with reference to cell viability, a cell, tissue or subject that has been administered polyribonucleotides or a composition comprising it shows cell viability improvement.In some embodiments, reference to cell viability is the cell viability of a cell, tissue or subject that has been administered comparable polyribonucleotides or a composition comprising it that comprises less 2'-O-acetylated ribose (for example, does not comprise any 2'-O-acetylated ribose) or a composition comprising it.

[0060] In some embodiments, method also includes including determining that polyribonucleotides or cells, tissues or subjects of compositions comprising it have been used and the immune system response of the subject.In some embodiments, immune response includes the innate immune system response of the toxicity including innate immune system induction.In some embodiments, determining that innate immune system response includes determining the level of NF-κB, IRF and / or other inflammatory cytokines in cells, tissues or subjects.In some embodiments, compared with reference, polyribonucleotides or cells, tissues or subjects of compositions comprising it have been used and the innate immune system response of reduction is shown.In some embodiments, reference is to have used comparable polyribonucleotides comprising less 2'-O-acetylated ribose (for example, not comprising any 2'-O-acetylated ribose) or cells, tissues or subjects of compositions comprising it and the innate immune system response of the subject.

[0061] In some embodiments, the method of administration disclosed herein also includes determining that the polyribonucleotide or the composition comprising it is applied to the cell, tissue or subject of the polyribonucleotide or the effect of the composition comprising it. In some embodiments, determining the effect includes determining the antibody response or cellular response in the cell, tissue or subject. In some embodiments, compared with reference, the cell, tissue or subject of the polyribonucleotide or the composition comprising it shows an antibody response or cellular response increase. In some embodiments, reference is to use a comparable polyribonucleotide or the cell, tissue or subject of the composition comprising less 2'-O-acetylated ribose (for example, not comprising any 2'-O-acetylated ribose) or the antibody response or cellular response of the cell, tissue or subject of the composition comprising it.

[0062] In some embodiments, method comprises using polyribonucleotide or comprising its composition at least twice to cell, tissue or experimenter.In some embodiments, method comprises using polyribonucleotide or comprising its composition at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times or at least 10 times to cell, tissue or experimenter.In some embodiments, compared with using the polyribonucleotide of a dosage or comprising its composition, using polyribonucleotide or comprising its composition at least twice to cell, tissue or experimenter will not cause the effect of polyribonucleotide or comprising its composition to reduce.

[0063] In some embodiments, method comprises and compares with suitable reference comparator, uses polyribonucleotide or the composition comprising it to cell, tissue or experimenter with higher dosage.In some embodiments, reference comparator comprises and comprises less 2'-O-acetylated ribose (for example, does not comprise any 2'-O-acetylated ribose) comparable polyribonucleotide.In some embodiments, cell is mammalian cell, tissue is mammalian tissue, or experimenter is mammal.

[0064] In some embodiments, the polyribonucleotides disclosed herein are or comprise RNA oligonucleotides.

[0065] In some embodiments, the polyribonucleotide disclosed herein comprises a coding region. In some embodiments, the coding region encodes a gene product. In some embodiments, the gene product is or comprises a polypeptide. In some embodiments, the gene product is or comprises a transcript.

[0066] In some embodiments, the polyribonucleotides disclosed herein do not comprise a coding region.

[0067] In some embodiments, the polyribonucleotides disclosed herein are or comprise messenger RNA (mRNA).

[0068] In some embodiments, the polyribonucleotide disclosed herein is or comprises a gRNA.

[0069] In some embodiments, the polyribonucleotides disclosed herein are or comprise inhibitory RNA.

[0070] In some embodiments, the polyribonucleotide disclosed herein is or comprises a miRNA or a siRNA.

[0071] In some embodiments, the polyribonucleotides disclosed herein are or comprise long non-coding RNA.

[0072] In some embodiments, the polyribonucleotides disclosed herein are or comprise antisense oligonucleotides.

[0073] In some embodiments, the method is a method of stimulating an immune response.

[0074] In some embodiments, the method is a vaccination method.

[0075] In some embodiments, the method is an antibody therapy method.

[0076] In some embodiments, the method is an immunomodulatory therapy method.

[0077] In some embodiments, the method is a gene therapy method.

[0078] In some embodiments, the methods include delivering one or more components of a gene therapy such as a gRNA.

[0079] In some embodiments, the method is a cell therapy engineering method.

[0080] In some embodiments, the method is an immunotherapy method. In some embodiments, the immunotherapy method comprises delivering an immunomodulatory therapy and / or an immune checkpoint therapy.

[0081] In some embodiments, the method is a protein replacement therapy method. In some embodiments, the protein replacement therapy method comprises delivering an enzyme replacement therapy.

[0082] In some embodiments, the method is a chemotherapeutic method.

[0083] Also provided herein is a method of vaccination, comprising administering one or more polyribonucleotides disclosed herein or a composition comprising the same to a cell, a tissue or a subject.

[0084] Disclosed herein is an immunotherapy method comprising administering to a cell, a tissue or a subject one or more polyribonucleotides disclosed herein or a composition comprising the same.

[0085] Provided herein is a method for providing antibody therapy, which includes administering one or more polyribonucleotides disclosed herein or compositions comprising them to cells, tissues or subjects. In some embodiments, antibody therapy includes antibodies, fragments, variants or fusions thereof. In some embodiments, antibody therapy includes fragments (e.g., scFv, Fab or other fragments) or complete antibodies comprising antigen recognition domains or includes polypeptides specifically fused to Fc antigen binding. In some embodiments, antibody therapy includes: bispecific antibodies, multispecific antibodies, heterodimers, Crossmab, DVD-Ig, 2 in 1 IgG, IgG-sc-FV, scFv-scFv, BiTE, DART, double antibodies, Fab-scFv fusions, Fab-Fab fusions, tandem antibodies or any other antibody forms known in the art.

[0086] Provided herein is a method for providing immunomodulatory therapy, comprising administering one or more polyribonucleotides disclosed herein or compositions comprising them to cells, tissues or subjects. In some embodiments, immunomodulatory therapy includes: cytokines or variants or fragments thereof, chemokines or variants or fragments thereof, T cell regulators, NK cell regulators, B cell regulators, myeloid cell regulators, regulators of any other immune cells, or any combination thereof. In some embodiments, immunomodulatory therapy includes chimeric antigen receptor (CAR) therapy. In some embodiments, immunomodulatory therapy includes engineered T cell receptor (TCR) therapy.

[0087] Provided herein is a method of gene therapy, which comprises administering one or more polyribonucleotides disclosed herein or a composition comprising the same to a cell, a tissue or a subject.

[0088] Provided herein is a method of protein replacement therapy comprising administering to a cell, a tissue or a subject one or more polyribonucleotides disclosed herein or a composition comprising the same.

[0089] Also provided herein is a method of cell engineering therapy, which comprises administering one or more polyribonucleotides disclosed herein or a composition comprising the same to a cell, a tissue or a subject.

[0090] The disclosure provides a kind of experimenter that has received comparable unmodified polyribonucleotides, and obtains the method for lower level immunogenicity in the experimenter that has received polyribonucleotides or the compositions comprising the ribonucleotides comprising modification compared with the experimenter that has received comparable unmodified polyribonucleotides.In some embodiments, the method comprises administering polyribonucleotides or the compositions comprising the ribonucleotides comprising modification to the experimenter.

[0091] In some embodiments of any method disclosed herein, purposes or compositions, the polyribonucleotide comprising the modified ribonucleotide does not comprise a 5' cap, such as a guanosine connected to a 5'-5' triphosphate. In some embodiments, the polyribonucleotide comprising the modified ribonucleotide comprises a 5' phosphate and / or hydroxyl group at the 5' end of the polyribonucleotide.

[0092] In some embodiments of any of the methods, uses, or compositions disclosed herein, the polyribonucleotide comprising a modified ribonucleotide comprises a 5' cap, eg, a 5'-5' triphosphate-linked guanosine.

[0093] In some embodiments, the subject who received the polyribonucleotide comprising a modified ribonucleotide or a composition comprising the same and the subject who received the comparable unmodified polyribonucleotide are the same subject.

[0094] In some embodiments, the subject who received the polyribonucleotide comprising a modified ribonucleotide or a composition comprising the same and the subject who received a comparable unmodified polyribonucleotide are different subjects.

[0095] Provided herein is a method for making an RNA composition comprising introducing at least one modified ribonucleotide disclosed herein into a polyribonucleotide. In some embodiments, the method does not include removing double-stranded RNA from the RNA composition.

[0096] Disclosed herein is a cell comprising a polyribonucleotide disclosed herein or a composition comprising the same.

[0097] Also disclosed herein is the use of the modified ribonucleotides disclosed herein in the production of polyribonucleotides.

[0098] The present disclosure provides use of the polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for stimulating an immune response.

[0099] Provided herein is the use of the polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for use as a vaccine.

[0100] The present disclosure provides use of the polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for immunotherapy.

[0101] Provided herein is the use of a polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for use as an antibody therapy.

[0102] Provided herein is the use of the polyribonucleotides disclosed herein or compositions comprising the same in the preparation of a medicament for use as an immunomodulatory therapy.

[0103] Provided herein is the use of the polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for gene therapy.

[0104] The present disclosure provides use of the polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for use as a protein replacement therapy.

[0105] Provided herein is the use of the polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for cell engineering therapy.

[0106] The present disclosure provides use of the polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for use as chemotherapy.

[0107] The present disclosure provides use of the polyribonucleotide disclosed herein or a composition comprising the same in the preparation of a medicament for stimulating an immune response.

[0108] Provided herein are compositions for use as vaccines comprising the polyribonucleotides disclosed herein.

[0109] Provided herein are compositions for use as immunotherapy comprising the polyribonucleotides disclosed herein.

[0110] Provided herein are compositions for use as antibody therapy comprising the polyribonucleotides disclosed herein.

[0111] Provided herein are compositions comprising the polyribonucleotides disclosed herein for use as immunomodulatory therapies.

[0112] Provided herein are compositions for use as gene therapy comprising the polyribonucleotides disclosed herein.

[0113] Disclosed herein are compositions for use as protein replacement therapies comprising the polyribonucleotides disclosed herein.

[0114] Provided herein are compositions for use as cell engineering therapies comprising the polyribonucleotides disclosed herein.

[0115] Provided herein are compositions comprising the polyribonucleotides disclosed herein for use as chemotherapeutics.

[0116] In some embodiments of any of the uses or methods provided herein, a polyribonucleotide or a composition comprising the same is administered to a cell, a tissue, or a subject.

[0117] In some embodiments of any of the uses or methods provided herein, the cell is a mammalian cell, the tissue is a mammalian tissue, or the subject is a mammal. In some embodiments, the mammal is a human. BRIEF DESCRIPTION OF THE DRAWINGS

[0118] Figures 1A-1D The structures of natural base 2-O-acetyl ribonucleotide analogs are provided.

[0119] Figure 2 is a graph depicting luciferase gene expression normalized to cell viability by dose of RNA synthesized using the indicated nucleotide compositions.

[0120] Figure 3 is a graph depicting the viability of A549 cells after transfection with corresponding doses of RNA synthesized using the indicated nucleotide compositions.

[0121] Figure 4 is a graph depicting IRF reporter gene activation obtained by doses of RNA synthesized using the indicated nucleotide compositions.

[0122] Figure 5 is a graph depicting NF-KB reporter gene activation obtained by doses of RNA synthesized using the indicated nucleotide compositions.

[0123] Figure 6 is a graph depicting the 1H NMR (300 MHz; DMSO-d6) of silyl-protected cytidine 2.

[0124] Figure 7 is the mass spectrum of silyl protected cytidine 2 (ESI+, 100% CH3OH, TOF).

[0125] Figure 8 is the HPLC chromatogram of silyl-protected cytidine 2 (CH3OH).

[0126] Fig. 9 is a graph depicting the 1H NMR (300 MHz; DMSO-d6) of diacetylated cytidine 3.

[0127] Fig.10 The mass spectrum of diacetylated cytidine 3 (ESI + , 100% CH 3 OH, TOF), retention time (4.534).

[0128] Fig.11 This is the HPLC chromatogram of diacetylated cytidine 3 (a compound unstable on LC-MS) (CH 3 OH),

[0129] Fig.12 is a depiction of 2'-O-acetylated silyl protected cytidine 4 1 H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0130] Fig.13 The mass spectrum (ESI + , 100% CH 3 OH, TOF).

[0131] Fig.14 is the HPLC chromatogram of 2'-O-acetylated silyl protected cytidine 4 (a compound unstable on LC-MS) (CH 3 OH).

[0132] Fig.15 is a graph depicting N,O-diacetyl-cytidine 6 (a mixture of 2'-OAc and 3'-OAc regioisomers). 1 HNMR (300 MHz, DMSO-d 6 ) in the table below.

[0133] Fig.16 The mass spectrum (ESI + , 100% CH 3 OH, TOF).

[0134] Fig.17 is the HPLC chromatogram of N,O-diacetyl-cytidine 6 (mixture of 2'-OAc and 3'-OAc regioisomers) (CH 3 OH).

[0135] Fig.18is a graph depicting the 1H NMR (300 MHz, DMSO-d6) of 2'-O-monoacetyl-cytidine 7 (mixture of 2'-OAc and 3'-OAc).

[0136] Fig.19 The mass spectrum of 2'-O-acetyl-cytidine 7 (ESI + , 100% CH 3 OH, TOF).

[0137] Fig. 20 is a HPLC chromatogram depicting 2'-O-acetyl-cytidine 7 (CH 3 OH).

[0138] Fig.21 is a graph depicting N,O-diacetyl-cytidine triphosphate sodium salt 9 (a mixture of 2'-OAc and 3'-OAc) 1 HNMR (300 MHz, D 2 O) diagram.

[0139] Fig. 22 is a graph depicting N,O-diacetyl-cytidine triphosphate sodium salt 9 (a mixture of 2'-OAc and 3'-OAc regioisomers). 31 P NMR (121 MHz, D 2 O) diagram.

[0140] Fig.23 It is a sodium salt of 2-O-acetyl-cytidine triphosphate 11 (a mixture of 2'-OAc and 3'-OAc regioisomers). 1 H NMR (300 MHz, D 2 O) diagram.

[0141] Fig.24 is a graph depicting 2-O-acetyl-cytidine triphosphate sodium salt 11 (a mixture of 2'-OAc and 3'-OAc regioisomers). 31 P NMR (121 MHz, D 2 O) diagram.

[0142] Fig.25 is a depiction of silyl-protected uridine 13 1 H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0143] Fig.26 is the mass spectrum of silyl protected uridine 13 (ESI+, 100% CH3OH, TOF).

[0144] Fig. 27is the HPLC chromatogram of silyl-protected uridine 13 (CH 3 OH).

[0145] Fig.28 is a depiction of 2'-O-acetyl-silyl protected uridine 14 1 H NMR (300 MHz, D 2 O) diagram.

[0146] Fig.29 is the mass spectrum of 2'-O-acetyl-silyl protected uridine 14 (ESI+, 100% CH3OH, TOF).

[0147] Fig.30 is the HPLC chromatogram of 2'-O-acetyl-silyl-protected uridine 14.

[0148] Fig.31 is a depiction of 2'-O-acetyl-uridine 15 (a mixture of 2'-OAc and 3'-OAc regioisomers). 1 HNMR (300 MHz, DMSO-d 6 ) in the table below.

[0149] Fig.32 The mass spectrum (ESI + , 100% CH 3 OH, TOF).

[0150] Fig.33 is the HPLC chromatogram of 2'-O-acetyl-uridine 15 (mixture of 2'-OAc and 3'-OAc regioisomers) (CH 3 OH).

[0151] Fig.34 is a derivative of 2-O-acetyl-uridine triphosphate 17 (a mixture of 2'-OAc and 3'-OAc regioisomers). 1 HNMR (300 MHz, D 2 O) diagram.

[0152] Fig.35 is a depiction of 2-O-acetyl-uridine triphosphate 17 (a mixture of regioisomers of 2'-OAc and 3'-OAc) 31 P NMR (121 MHz, D 2 O) diagram.

[0153] Fig.36 is a depiction of silyl-protected adenosine 19 1H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0154] Fig.37 The mass spectrum of silyl-protected adenosine 19 (ESI + , 100% CH 3 OH, TOF).

[0155] Fig.38 is the HPLC chromatogram of silyl-protected adenosine 19 (CH 3 OH).

[0156] Fig.39 is a depiction of 2'-O-acetyl-silyl protected adenosine 20 1 H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0157] Fig.40 The mass spectrum (ESI + , 100% CH 3 OH, TOF).

[0158] Fig.41 is the HPLC chromatogram of 2'-O-acetylated silyl protected adenosine 20 (CH 3 OH).

[0159] Fig.42 is a depiction of 2'-OAc adenosine 21 (minor) 1 H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0160] Fig.43 The mass spectrum of 2'-OAc adenosine 21 (minor) (ESI + , 100% CH 3 OH, TOF).

[0161] Fig.44 This is the HPLC chromatogram of 2'-OAc adenosine 21 (minor) (CH 3 OH).

[0162] Fig.45 is a representation of 3'-OAc adenosine 22 (primarily) 1 H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0163] Fig.46 The mass spectrum (ESI +, 100% CH 3 OH, TOF).

[0164] Fig.47 This is the HPLC chromatogram of 3'-OAc adenosine 22 (major) (CH 3 OH).

[0165] Fig.48 It is 2'-O-acetylated adenosine triphosphate sodium salt 24 1 H NMR (300 MHz, D 2 O) diagram.

[0166] Fig.49 is a depiction of 2'-O-acetylated adenosine triphosphate sodium salt 24 31 P NMR (121 MHz, D 2 O) diagram.

[0167] Fig.50 The mass spectrum (ESI - , 100% CH 3 OH, TOF).

[0168] Fig.51 is a depiction of silyl-protected guanosine 26 1 H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0169] Fig.52 The mass spectrum of silyl-protected guanosine 26 (ESI + , 100% CH 3 OH, TOF).

[0170] Fig.53 is the HPLC chromatogram of silyl-protected guanosine 26 (CH 3 OH).

[0171] Fig.54 is a depiction of 2'-O-acetyl-silyl protected guanosine 27 1 H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0172] Fig.55 The mass spectrum (ESI + , 100% CH 3 OH, TOF).

[0173] Fig.56is the HPLC chromatogram of 2'-O-acetyl-silyl protected guanosine 27 (CH 3 OH).

[0174] Fig.57 is a representation of 2'-O-acetylguanosine 28 1 H NMR (300 MHz, DMSO-d 6 ) in the table below.

[0175] Fig.58 The mass spectrum of 2'-O-acetylguanosine 28 (ESI + , 100% CH 3 OH, TOF).

[0176] Fig.59 This is the HPLC chromatogram of 2'-O-acetylguanosine 28 (CH 3 OH).

[0177] Fig.60 is a depiction of 2'-O-acetyl-guanosine triphosphate 30 1 H NMR (300 MHz, D 2 O) diagram.

[0178] Fig.61 is a representation of 2'-O-acetyl-uridine triphosphate 30 31 P NMR (121 MHz, D 2 O) diagram.

[0179] Figures 62A-62B Is a graph showing in vivo luciferase gene expression from LNP-delivered 2-O acetylated RNA or N1-methylpseudouridine-modified RNA delivered by LNP. Luciferase gene expression was measured in all animals at 6 hours, 24 hours, and 48 hours after LNP administration.

[0180] Some definitions

[0181] About or approximately: As used herein, the terms "about" and "approximately" when used herein when referring to a value refer to a value similar to the value mentioned in the context. Generally speaking, those skilled in the art who are familiar with the context will understand the relevant degree of difference covered by "about" or "approximately" in this context. For example, in some embodiments, the term "about" or "approximately" may be covered in 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or a range of values ​​within a smaller range of the reference value.

[0182] Administration: As used herein, the term "administering" or "administration" generally refers to applying a composition to a subject to achieve delivery as a composition or an agent contained in a composition. One of ordinary skill in the art will appreciate the various routes that can be used for administration to a subject (e.g., a human) where appropriate. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, and the like. In some specific embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or include, for example, one or more of topical, intradermal, interdermal, transdermal, and the like), enteral, intraarterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, intra-organ specific (e.g., intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreous administration, and the like. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve applying a fixed number of doses. In some embodiments, administration may involve administration that is intermittent (e.g., multiple doses separated in time) and / or periodic (e.g., individual doses separated by the same time period) administration. In some embodiments, administration may involve continuous administration (e.g., perfusion) for at least a selected time period.

[0183] Antigen: As used herein, the term "antigen" refers to an agent that triggers an immune response; and / or (ii) an agent that binds to a T cell receptor (e.g., when presented by an MHC molecule) or to an antibody. In some embodiments, an antigen triggers a humoral response (e.g., including the production of antigen-specific antibodies); in some embodiments, an antigen triggers a cellular response (e.g., involving a T cell that specifically interacts with a receptor). In some embodiments, an antigen comprises at least one epitope of a target protein. In some embodiments, an epitope may be a linear epitope. In some embodiments, an epitope may be a conformational epitope. In some embodiments, an antigen binds to an antibody and may or may not induce a specific physiological response in an organism. Generally speaking, an antigen may be or include any chemical entity, such as, for example, a small molecule, a nucleic acid, a polypeptide, a carbohydrate, a lipid, a polymer (in some embodiments, except for a biopolymer [e.g., except for a nucleic acid or an amino acid polymer]), etc. In some embodiments, an antigen is or includes a polypeptide. In some embodiments, an antigen is or includes a polysaccharide. Those of ordinary skill in the art will appreciate that, in general, antigens can be provided in an isolated or pure form, or alternatively can be provided in a crude form (e.g., with other materials, e.g., in an extract containing an antigenic source such as a cell extract or other relatively crude preparation). In some embodiments, the antigen used according to the present invention is provided in a crude form. In some embodiments, the antigen is a recombinant antigen.

[0184] Delivery / contacting: As used interchangeably herein, the terms "delivery," "delivering," or "contacting" refer to the introduction of a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) into a target cell. The target cell may be cultured in vitro or ex vivo or present in a subject (in vivo). The method of introducing a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) into a target cell may vary with in vitro, ex vivo, or in vivo applications. In some embodiments, a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) may be introduced into a target cell in cell culture by in vitro transfection. In some embodiments, a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) may be introduced into a target cell via a delivery vehicle (e.g., nanoparticles, liposomes, and / or complexes with cell permeabilizing agents). In some embodiments, a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) can be introduced into target cells of a subject by administering the fusion polynucleotide (e.g., as described herein) or the fusion polypeptide (e.g., as described herein) to the subject.

[0185] Expression: As used herein, the term "expression" of a nucleic acid sequence refers to the production of any gene product from the nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, etc.); (3) translation of the RNA into a polypeptide or protein; and / or (4) post-translational modification of the polypeptide or protein.

[0186] Functional: As used herein, the term "functional" is used to refer to a form or fragment of an entity that exhibits a specific property and / or activity.

[0187] Fragment: A "fragment" of a material or entity as described herein has a structure comprising discrete portions of a whole, but lacks one or more portions present in the whole. In some embodiments, a fragment consists of such discrete portions. In some embodiments, a fragment consists of or contains characteristic structural elements or portions found in the whole. In some embodiments, a fragment comprises a polynucleotide fragment. In some embodiments, a fragment comprises a polypeptide fragment. 300, 325, 350, 375, 400, 425, 450, 475, 500, 500, 600, 650, 700, 750, 800, 850, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4750, 5000, 6000, 6500, 7500, 8500, 9000, 9500 In some embodiments, a polynucleotide fragment or a polypeptide fragment comprises or consists of at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the monomeric units (e.g., residues) found in the entire polynucleotide or the entire polypeptide. The entire polypeptide or the entire polynucleotide may be referred to as the "parent" of a polynucleotide fragment or a polypeptide fragment in some embodiments.

[0188] Gene product or expression product: As used herein, the term "gene product" or "expression product" generally refers to RNA transcribed from a gene (before and / or after processing) or a polypeptide encoded by RNA transcribed from a gene (before and / or after modification).

[0189] Nucleic acid / oligonucleotide / polynucleotide: As used herein, the terms "nucleic acid" and "polynucleotide" and "oligonucleotide" are used interchangeably and refer to polymers of 3 or more nucleotides. In some embodiments, nucleic acids include DNA. In some embodiments, nucleic acids include RNA. In some embodiments, nucleic acids include messenger RNA (mRNA). In some embodiments, nucleic acids are single-stranded. In some embodiments, nucleic acids are double-stranded. In some embodiments, nucleic acids include both single-stranded and double-stranded portions. In some embodiments, nucleic acids include a backbone containing one or more phosphodiester linkages. In some embodiments, nucleic acids include a backbone containing phosphodiester linkages and non-phosphodiester linkages. For example, in some embodiments, nucleic acids may include a backbone containing one or more phosphorothioate or 5'-N-phosphoramidite bonds and / or one or more peptide bonds, for example, as in "peptide nucleic acids". In some embodiments, nucleic acids include one or more or all natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, nucleic acid comprises one or more or all non-natural residues. In some embodiments, non-natural residues comprise nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 6-O-methylguanine, 2-thiocytidine, methylated bases, inserted bases, and combinations thereof). In some embodiments, non-natural residues comprise one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to the sugars in natural residues. In some embodiments, nucleic acid has a nucleotide sequence encoding a functional gene product such as an RNA or polypeptide. In some embodiments, nucleic acid has a nucleotide sequence comprising one or more introns. In some embodiments, nucleic acid can be prepared by separation from natural sources, enzymatic synthesis (e.g., by polymerization based on complementary templates, such as in vivo or in vitro), replication in a recombinant cell or system, or chemical synthesis.In some embodiments, the length of the nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, or 20,000 or more residues or nucleotides. When the number of nucleotides is used as an indication of size (eg, the size of a fusion polynucleotide), a certain number of nucleotides refers to the number of nucleotides on a single strand (eg, a single strand of a fusion polynucleotide).

[0190] Polypeptide: As used herein, the term "polypeptide" generally has its art-recognized meaning of a polymer of at least three or more amino acids. One of ordinary skill in the art will appreciate that the term "polypeptide" is intended to be sufficiently general so as to encompass not only polypeptides having the complete sequences described herein, but also polypeptides representing functional, biologically active or characteristic fragments, portions or domains of such complete polypeptides (e.g., fragments, portions or domains that retain at least one activity). The polypeptide may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, and the like. In some embodiments, the polypeptide may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof.

[0191] Polyribonucleotide: As used herein, the term "polyribonucleotide" refers to a polymer of 3 or more ribonucleotides. In some embodiments, the polyribonucleotide is single-stranded. In some embodiments, the polyribonucleotide is double-stranded. In some embodiments, the polyribonucleotide comprises single-stranded and double-stranded parts. In some embodiments, the polyribonucleotide may comprise a backbone structure as described in the definition of "nucleic acid / oligonucleotide" above. The polyribonucleotide may comprise a coding region encoding a gene product, or the polyribonucleotide may not comprise a coding region. In addition, the polyribonucleotide may be a regulatory RNA (e.g., siRNA, microRNA, etc.) or a messenger RNA (mRNA) oligonucleotide. In some embodiments in which the polyribonucleotide is a polyribonucleotide (e.g., mRNA oligonucleotide) comprising a coding region, the polyribonucleotide generally comprises a poly (A) region located at its 3' end. In some embodiments where the polyribonucleotide is a polyribonucleotide (e.g., mRNA oligonucleotide) comprising a coding region, the polyribonucleotide generally includes a 5' end thereof, for example, for identifying the polyribonucleotide (e.g., mRNA) and attaching it to a ribosome to start a cap structure recognized in the art for translation. In some embodiments where the polyribonucleotide does not include a coding region, the polyribonucleotide may include long noncoding RNA (lncRNA), microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, rRNA, tRNA or a combination thereof. In some embodiments, the polyribonucleotide includes an RNA oligonucleotide. When the number of ribonucleotides is used as an indication of size (e.g., the size of the polyribonucleotide), a certain number of nucleotides refers to the number of ribonucleotides on a single strand.

[0192] Subject: As used herein, the term "subject" refers to an organism, typically a mammal (e.g., a human). In some embodiments, the subject suffers from a disease, disorder, or illness. In some embodiments, the subject is susceptible to a disease, disorder, or illness. In some embodiments, the subject exhibits one or more symptoms or features of a disease, disorder, or illness. In some embodiments, the subject does not exhibit any symptoms or features of a disease, disorder, or illness. In some embodiments, the subject is a person with one or more characteristics characterized by susceptibility to a disease, disorder, or illness or a risk of a disease, disorder, or illness. In some embodiments, the subject is a patient. In some embodiments, the subject is an individual to whom diagnosis and / or therapy is administered and / or has been administered.

[0193] Variant: As used herein, the term "variant" refers to an entity that shows significant structural identity with a reference entity but is structurally different from the reference entity in the presence or level of one or more chemical moieties compared to the reference entity. In many embodiments, the variant is also functionally different from its reference entity. Generally, whether a particular entity is appropriately considered to be a "variant" of a reference entity is based on the degree of structural identity of the particular entity to the reference entity. For example, due to one or more differences in the amino acid sequence and / or one or more differences in the chemical moieties (e.g., carbohydrates, lipids, etc.) covalently attached to the polypeptide backbone, the variant polypeptide may be different from the reference polypeptide. Alternatively or additionally, in some embodiments, the variant polypeptide does not share at least one characteristic sequence element with the reference polypeptide. In some embodiments, the reference polypeptide has one or more biological activities. In some embodiments, the variant polypeptide shares one or more of the biological activities of the reference polypeptide. In some embodiments, the variant polypeptide lacks one or more of the biological activities of the reference polypeptide. In some embodiments, the variant polypeptide shows a reduction in one or more biological activity levels compared to the reference polypeptide.

[0194] Standard techniques can be used for recombinant DNA, oligonucleotide synthesis (e.g., RNA synthesis) and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques can be performed according to the manufacturer's instructions or as generally accomplished in the art or as described herein. The aforementioned techniques and procedures can generally be performed according to conventional methods well known in the art, and as described in various general and more specific references cited and discussed throughout this specification. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), which is incorporated herein by reference for any purpose. DETAILED DESCRIPTION

[0195] RNA, such as messenger RNA (mRNA), has great potential to provide life-changing therapies for diseases that were previously determined to be untreatable. However, RNA technology is still in the early stages of development in the broader therapeutic agent approach. Much progress has been made in this field to bring the technology to its current form, but further improvements to the platform are still needed to truly unlock its full capabilities.

[0196] One of the unresolved issues is that RNA is an intrinsically unstable molecule. The use of pseudouridine derivatives instead of uridine has provided some improvement in this regard, due to proposed mechanisms for increased base stacking and hydrogen bonding (Hudson, Bloomingdale, and Znosko, RNA 2013). However, in its current commercial form, its stability and activity are still very short-lived (Anand and Stahel, Patient Saf Surg 2021). In fact, the transience of RNA is largely seen as an advantage of the platform, which contributes to its safety as a therapeutic agent. However, an independent view contrary to this cognitive benefit is that in order for RNA to be used for indications other than vaccination, it is crucial that the half-life of the therapeutic RNA be at least somewhat longer than it is currently. This is because indications such as cancer treatment and enzyme replacement require, for example, the expression of the therapeutic protein of interest within a certain period of time in order to bring optimal benefits to patients. Therapeutics that are inactivated within a few hours and therefore lose their benefits to patients require frequent administration and increase formulation costs. This may be unbearable and difficult to maintain for ordinary patients, and may limit the use of therapies. In some embodiments, extending the RNA half-life does not mean that it is always active. Instead, it is a question of increasing the RNA half-life so that the desired dosing frequency is more reasonable. It should also be noted that the optimal RNA half-life for a given indication may be different from another, but the underlying theme is that it is expected to be extended.

[0197] Without wishing to be bound by theory, in some embodiments, the instability of RNA or even base-modified RNA can be traced back to the reactivity of the hydroxyl group on the carbon 2 of the ribose of, for example, ribonucleotides. When RNA is exposed to high pH, ​​high temperature, divalent cations or some combination thereof, oxygen atoms can initiate nucleophilic attacks on the phosphate backbone of the RNA chain. The hydroxyl groups targeted by the ubiquitous RNase enzymes that rapidly degrade any RNA are the same (Brown and Pasloske, Methods in Enzymology 2001). Compared with RNA, the lack of this hydroxyl group provides DNA with its outstanding stability. Therefore, reducing the reactivity of this hydroxyl group should improve the stability of RNA. This phenomenon will be observed when 2-O-methyl nucleoside triphosphates (NTPs) are used in RNA, which provide higher thermal stability for RNA duplexes and provide resistance to nucleases (Assi, et al., NAR 2020). However, the problem with using 2-O-methyl and other currently available 2-O modified NTPs is that they can only be incorporated into short RNA oligonucleotides by chemical synthesis, because only error-prone RNA polymerases are able to use 2-O-methyl NTPs as substrates because key hydrogen bonding interactions are eliminated (Meyer, et al., NAR 2015). The size limitations of RNA prepared by chemical synthesis using 2-O-methyl NTPs also mean that gene-length RNAs are currently not available by this method. When considering RNA therapeutics, these issues are superseded by the fact that 2-O-methyl modifications throughout RNA transcripts inhibit their translation due to steric hindrance and codon-anticodon interactions of key ribosomal RNA residues (Choi, et al., Nat Struct Mol Biol 2018).

[0198] Given this knowledge in the field, it was hypothesized that, for RNA applications, the ideal 2-O-modification would be a functional group that maintains the critical hydrogen bonding interactions necessary for transcription, translation, and duplex formation while having reduced reactivity that would otherwise promote RNA spontaneous hydrolysis and nuclease degradation. Based on biochemical principles, it was also hypothesized that 2-O-acetylated NTPs ( Figures 1A-1D ) can provide this feature. Therefore, the present disclosure provides technology related to 2-O-acetylated nucleotides, wherein the hydroxyl group on carbon 2 of ribose is acetylated (2-O-acetylated ribose). The technology provided in the present disclosure includes: modified ribonucleotides containing 2-O-acetylated ribose, polyribonucleotides containing modified ribonucleotides containing 2-O-acetylated ribose, compositions containing such modified ribonucleotides and / or polyribonucleotides, and methods for preparing such polyribonucleotides, and methods for using such polyribonucleotides for various applications.

[0199] Tyrosine (Tyr) 639 of T7 RNA polymerase appears to be a major discriminating amino acid residue that determines whether T7 RNA polymerase can use nucleotides as substrates ( et al., Nature Communications 2021). It is hypothesized that the carbonyl oxygen of the acetyl group may act as a hydrogen bond acceptor to maintain the critical interaction with Tyr639 and allow 2-O-acetyl nucleotides to be used with wild-type bacteriophage RNA polymerases such as T7 RNA polymerase. This is in contrast to 2-O-methyl NTPs, where the methyl group prevents hydrogen bonding between the 2' oxygen and Tyr639 and therefore prevents the use of 2-O-methyl NTPs for in vitro transcription.

[0200] Early studies found that RNA chemically acetylated with acetic anhydride after transcription was translationally active in a wheat germ cell-free translation system (Ovodov and Alakhov, FEBS 1990). The authors of this study were unable to confirm the specific acetylation of the 2-OH and only claimed that up to 75% of the 2-OH groups in the RNA were acetylated. Ovodov and Alakhov also used a cell-free translation system; their study did not report whether the chemically acetylated RNA could be introduced into living cells and / or translated by the intracellular ribosomal machinery. Therefore, the application of Ovodov and Alakhov's chemically acetylated RNA is limited to artificial cell-free translation systems.

[0201] Disclosed herein, among other things, is the novel discovery that 2-O-acetylated nucleotide triphosphates can be accepted by RNA polymerases as substrates for in vitro transcription of RNA. The disclosure also provides insight that RNA polymerases can use 2-O-acetylated nucleotide triphosphates to produce fully acetylated RNA. In some embodiments, the RNA produced by the methods disclosed herein is 100% 2-O-acetylated except for the cap structure, which does not contain 2-O-acetylated ribose, for example, due to co-transcriptional capping. In some embodiments, the RNA produced by the methods disclosed herein is 100% 2-O-acetylated, including a cap structure that contains 2-O-acetylation. A new type of modified nucleotide has been discovered that can be used to generate RNA using an in vitro transcription reaction, allowing the use of 2-O-acetylated ribose to make RNA for various applications, including therapeutic applications, research applications, diagnostic applications, agricultural applications, and any other suitable application.

[0202] In addition, the present disclosure also demonstrates for the first time the surprising discovery that RNA containing 2-O-acetylated ribose can be translated by the intracellular ribosomal machinery of the cell. Figure 2-5Exemplary polypeptide expression from 2-O-acetylated RNA is provided. Also provided herein is the insight that the yield of 2-O-acetylated RNA is comparable to RNA without such modification. Table 1 provides exemplary yields obtainable using 2-O-acetylated RNA.

[0203] In addition, the present disclosure provides insights: polyribonucleotides containing 2-O-acetylated ribose, such as those produced using in vitro transcription reactions, are functional and have desired properties, such as reduced immunogenicity, escape from innate immune system activation, improve the viability of cells introduced into the polyribonucleotides, increase the expression of payloads introduced into the polyribonucleotides and / or increase the persistence of polyribonucleotides. In some embodiments, escaping the innate immune system includes reducing the activation of NFkb or NFkb pathways, IRF or IRF pathways and / or other inflammatory cytokines in cells, tissues or organisms introduced into the polyribonucleotides. In some embodiments, escaping the innate immune system includes reducing the detection of uncapped RNA in cells, tissues or organisms introduced into the polyribonucleotides. In some embodiments, the in vitro transcribed RNA containing 2-O-acetylated ribose can improve the efficacy of RNA therapeutics due to reducing undesirable innate immune responses. In some embodiments, by including one or more base modifications in RNA, the RNA containing 2-O-acetylated ribose can be further enhanced to reduce undesirable innate immune responses (e.g., undesirable innate immune responses can be further reduced). For example, Figure 4 and 5 The combination of polyribonucleotides comprising 2-O-acetylated ribose and exemplary modified cytosine bases (N4-acetyl-cytidine; Ac4C) has been shown to reduce innate immune activation. These data support the inclusion of one or more base modifications to polyribonucleotides comprising 2-O-acetylated ribose to reduce innate immune activation while increasing payload expression and / or persistence.

[0204] This article also provides insights into how RNA expression levels can be regulated by including 2-O-acetylated ribose in RNA. Figure 2 Exemplary increases in payload expression with polyribonucleotides comprising 2-O-acetylated ribose compared to polyribonucleotides without 2-O-acetylated ribose are provided.

[0205] This article further provides insights that polyribonucleotides with 2-O acetylated ribose can increase the persistence of polyribonucleotides. For example, this article Figures 62A-62BProvide exemplary data, show by LNP delivery of N1-methyl pseudouridine modified polyribonucleotide compared to the equivalent gene expression of 2-O acetylated.When considering the observed immunogenicity increase of 2-O ribose acetylated polyribonucleotide without any additional modification (Example 1, Figure 4 and 5 ), this observation suggests that polyribonucleotides with 2-O-acetylated ribose have increased persistence, likely due to increased resistance to nuclease degradation.

[0206] Therefore, this paper provides insight: using the polyribonucleotide that comprises 2-O acetylated ribose alone or comprises it and one or more base modified combinations can be used for the application (for example, therapeutic agent application) of the persistence (for example, improving nuclease resistance) of polyribonucleotide that needs to be improved wherein.Do not wish to be bound by any particular theory, by combining the immunogenicity of the reduction from base modification (for example, Ac4C, 5hmU, N1-methyl pseudouridine etc.) and the nuclease resistance from ribosome compatibility main chain modification (for example, 2-O ribose acetylation as described herein), it is possible to realize the polyribonucleotide with the persistence of increase.

[0207] In some embodiments, the method provided can be used to enhance the persistence or uptake of polyribonucleotides comprising 2-O acetylated ribose in target cells. In some embodiments, the persistence or uptake of polyribonucleotides comprising 2-O acetylated ribose in target cells is improved by at least 30% or more compared to the persistence or uptake of other similar polyribonucleotides that do not contain 2-O acetylated ribose or contain less 2-O acetylated ribose. In some embodiments, the persistence or uptake of polyribonucleotides comprising 2-O acetylated ribose in target cells is improved by at least 30% or more compared to the persistence or uptake of other similar polyribonucleotides that do not contain 2-O acetylated ribose or contain less 2-O acetylated ribose.

[0208] like Figures 62A-62B Shown, the disclosure also provides, 2-O-acetylated polyribonucleotide can be in vivo and delivered by LNP.Therefore, this paper provides insight: 2-O-acetylated polyribonucleotide can use delivery vehicle (such as LNP) to deliver, to deliver polyribonucleotide to cell, tissue or experimenter, to treat disease or illness, and / or to improve the symptom of disease or illness.

[0209] In some embodiments, the payload is or comprises a polypeptide encoded by a polyribonucleotide comprising modified ribonucleotides.

[0210] In some embodiments, the payload is or comprises RNA positioned within a polyribonucleotide comprising modified ribonucleotides.

[0211] In some embodiments, the use of polyribonucleotides comprising 2-O-acetylated ribose allows for improved efficacy of RNA therapeutics comprising the same and / or better tolerability in subjects to which they are administered.

[0212] 2'-O-acetylated nucleotides

[0213] Among others, provided herein are polyribonucleotides comprising one or more modified ribonucleotides, the one or more modified ribonucleotides comprising a ribose moiety comprising an acetyl group rather than a hydroxyl group. In some embodiments, the modified ribonucleotides comprise 2'-O-acetylated ribose. In some embodiments, the modified ribonucleotides comprising 2'-O-acetylated ribose comprise 5' monophosphate, 5' diphosphate or 5' triphosphate. In some embodiments, the modified ribonucleotides comprising 2'-O-acetylated ribose comprise a core base selected from: adenine or its modified form, guanine or its modified form, cytosine or its modified form or uracil or its modified form.

[0214] In some embodiments, the modified ribonucleotide has the following structure:

[0215]

[0216] (a) wherein X is a 5' monophosphate, a 5' diphosphate or a 5' triphosphate; and

[0217] (b) wherein R is a nucleobase selected from the group consisting of adenine or a modified form thereof, guanine or a modified form thereof, cytosine or a modified form thereof, or uracil or a modified form thereof.

[0218] In some embodiments, the modified ribonucleotide comprising a 2'-O-acetylated ribose has a 5' triphosphate and the following structure:

[0219]

[0220] wherein R is a nucleobase selected from adenine (e.g., unmodified or modified adenine), guanine (e.g., unmodified or modified guanine), cytosine (e.g., unmodified or modified cytosine), or uracil (e.g., unmodified or modified uracil).

[0221] In some embodiments, the modified ribonucleotide comprising a 2'-O-acetylated ribose comprises adenine and a 5' monophosphate, a 5' diphosphate or a 5' triphosphate. In some embodiments, the modified ribonucleotide has the following structure:

[0222]

[0223] In some embodiments, the modified ribonucleotide comprising a 2'-O-acetylated ribose comprises guanine and a 5' monophosphate, a 5' diphosphate or a 5' triphosphate. In some embodiments, the modified ribonucleotide has the following structure:

[0224]

[0225] In some embodiments, the modified ribonucleotide comprising a 2'-O-acetylated ribose comprises a cytosine and a 5' monophosphate, a 5' diphosphate or a 5' triphosphate. In some embodiments, the modified ribonucleotide has the following structure:

[0226]

[0227] In some embodiments, the modified ribonucleotide comprising a 2'-O-acetylated ribose comprises uracil and a 5' monophosphate, a 5' diphosphate or a 5' triphosphate. In some embodiments, the modified ribonucleotide has the following structure:

[0228]

[0229] In some embodiments, the modified ribonucleotide comprising a 2'-O-acetylated ribose comprises N4-acetylcytidine and a 5' monophosphate, a 5' diphosphate or a 5' triphosphate. In some embodiments, the modified ribonucleotide has the following structure:

[0230]

[0231] In some embodiments, the modified ribonucleotide comprising a 2'-O-acetylated ribose comprises 5-hydroxymethyluridine and a 5' monophosphate, a 5' diphosphate or a 5' triphosphate. In some embodiments, the modified ribonucleotide has the following structure:

[0232]

[0233] In some embodiments, the modified ribonucleotide comprising a 2'-O-acetylated ribose comprises N1-methyl pseudouridine and a 5' monophosphate, a 5' diphosphate or a 5' triphosphate. In some embodiments, the modified ribonucleotide has the following structure:

[0234]

[0235] Also provided herein are polyribonucleotides comprising one or more modified ribonucleotides (eg, nucleotides comprising 2-O'-acetylated ribose). In some embodiments, the nucleotides comprise modified nucleotides or unmodified nucleotides, eg, as described herein.

[0236] In some embodiments, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the ribose moieties in the polyribonucleotides are acetylated (2'-O-acetylated).

[0237] In some embodiments, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the ribose moieties in the polyribonucleotides are acetylated (2'-O-acetylated).

[0238] In some embodiments, 100% of the ribose moieties in the polyribonucleotide are acetylated (2'-O-acetylated).

[0239] In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 10%, about 15% to 20%, about 15% to 25 ... Between 0% and 99%, about 15% and 99%, about 20% and 99%, about 25% and 99%, about 30% and 99%, about 35% and 99%, about 40% and 99%, about 45% and 99%, about 50% and 99%, about 55% and 99%, about 60% and 99%, about 65% and 99%, about 70% and 99%, about 80% and 99%, about 85% and 99%, about 90% and 99%, or about 95% and 99% of the ribose moieties are acetylated (2'-O-acetylated).

[0240] In some embodiments, about 76% to about 100%, about 77% to about 100%, about 78% to about 100%, about 79% to about 100%, about 80% to about 100%, about 81% to about 100%, about 82% to about 100%, about 83% to about 100%, about 84% to about 100%, about 85% to about 100%, about 86% to about 100%, about 87% to about 100% of the polyribonucleotides. , about 88% to about 100%, about 89% to about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to 100%, about 97% to 100%, about 98 to 100%, and about 99% to 100% of the ribose moieties are acetylated (2'-O-acetylated).

[0241] In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 10%, about 15% to 20%, about 15% to 25 ... Between 0% and 99%, about 15% and 99%, about 20% and 99%, about 25% and 99%, about 30% and 99%, about 35% and 99%, about 40% and 99%, about 45% and 99%, about 50% and 99%, about 55% and 99%, about 60% and 99%, about 65% and 99%, about 70% and 99%, about 80% and 99%, about 85% and 99%, about 90% and 99%, or about 95% and 99% of the ribose moieties are acetylated (2'-O-acetylated).

[0242] In some embodiments, about 76% to about 99%, about 76% to about 98%, about 76% to about 97%, about 76% to about 96%, about 76% to about 95%, about 76% to about 94%, about 76% to about 93%, about 76% to about 92%, about 76% to about 91%, about 76% to about 90%, about 76% to about 89%, about 76% to about 88%, about 76% to about 87%, about 76% to about 86%, about 76% to about 85%, about 76% to about 84%, about 76% to about 83%, about 76% to about 82%, about 76% to about 81%, about 76% to about 80%, about 76% to about 79%, about 76% to about 78%, about 76% to about 77% of the ribose moieties in the polyribonucleotides are acetylated (2'-O-acetylated).

[0243] In some embodiments, the polyribonucleotide comprises a cap structure, and the cap structure does not comprise a 2'-O-acetylated ribose.

[0244] In some embodiments, the polyribonucleotide is completely 2-O-acetylated (100% of the ribose moieties are 2-O-acetylated) except for the cap structure. In some embodiments, the cap structure of the polyribonucleotide comprises a hydroxyl group on carbon 2 of the ribose.

[0245] In some embodiments, the 2-O-acetylation of polyribonucleotide is less than 100% (less than 100% ribose moiety is 2-O-acetylated) and comprises a cap structure that does not comprise 2'-O-acetylated ribose.In some embodiments, the cap structure of polyribonucleotide comprises the hydroxyl group on ribose carbon 2.

[0246] In some embodiments, the polyribonucleotide is at least 5% 2-O-acetylated (at least 5% of the ribose moieties are 2-O-acetylated) and comprises a cap structure that does not comprise 2'-O-acetylated ribose. In some embodiments, the cap structure of the polyribonucleotide comprises a hydroxyl group on the ribose carbon 2.

[0247] In some embodiments, the polyribonucleotide comprises a cap structure, and the cap structure comprises a 2'-O-acetylated ribose.

[0248] In some embodiments, the polyribonucleotide is fully 2-O-acetylated (100% of the ribose moieties are 2-O-acetylated) and comprises a 2-O-acetylated cap structure.

[0249] In some embodiments, the polyribonucleotide is less than 100% 2-O-acetylated (less than 100% of the ribose moieties are 2-O-acetylated) and comprises a 2'-O-acetylated cap structure.

[0250] In some embodiments, the polyribonucleotide is at least 5% 2-O-acetylated (at least 5% of the ribose moieties are 2-O-acetylated) and comprises a 2'-O-acetylated cap structure.

[0251] In some embodiments, the length of polyribonucleotide can be at least 5 nucleotide or longer.In some embodiments, the length of polyribonucleotide can be at least 5 nucleotide, at least 10 nucleotide, at least 15 nucleotide, at least 20 nucleotide, at least 25 nucleotide, at least 30 nucleotide, at least 35 nucleotide, at least 40 nucleotide, at least 45 nucleotide, at least 50 nucleotide, at least 55 nucleotide, at least 60 nucleotide, at least 65 nucleotide, at least 70 nucleotide, at least 75 nucleotide, at least 80 nucleotide, at least 85 nucleotide, at least 90 nucleotide, at least 95 nucleotide, at least 100 nucleotide, at least 200 nucleotide, at least 300 nucleotide, at least 400 nucleotide, at least 500 nucleotide, at least 1000 nucleotide, at least 2000 nucleotide, at least 5000 nucleotide or longer.

[0252] In some embodiments, the length of the polyribonucleotide can be from about 5 nucleotides to about 200,000 nucleotides, from about 5 nucleotides to about 150,000 nucleotides, from about 5 nucleotides to about 100,000 nucleotides, from about 5 nucleotides to about 50,000 nucleotides, from about 5 nucleotides to about 10,000 nucleotides, from about 5 nucleotides to about 5000 nucleotides, from about 5 nucleotides to about 1000 nucleotides, from about 5 nucleotides to about 500 nucleotides, from about 5 nucleotides to about 400 nucleotides, from about 5 nucleotides to about 300 nucleotides, from about 5 nucleotides to about 200 nucleotides, from about 5 nucleotides to about 100 nucleotides, from about 5 nucleotides to about 90 nucleotides. nucleotides, about 5 nucleotides to about 85 nucleotides, about 5 nucleotides to about 80 nucleotides, about 5 nucleotides to about 75 nucleotides, about 5 nucleotides to about 70 nucleotides, about 5 nucleotides to about 65 nucleotides, about 5 nucleotides to about 60 nucleotides, about 5 nucleotides to about 55 nucleotides, about 5 nucleotides to about 50 nucleotides, about 5 nucleotides to about 45 nucleotides, about 5 nucleotides to about 40 nucleotides, about 5 nucleotides to about 35 nucleotides, about 5 nucleotides to about 30 nucleotides, about 5 nucleotides to about 25 nucleotides, about 5 nucleotides to about 20 nucleotides, about 5 nucleotides to about 15 nucleotides, about 5 nucleotides to about 10 nucleotides.

[0253] In some embodiments, the length of the polyribonucleotide can be from about 5 nucleotides to about 200,000 nucleotides, from about 10 nucleotides to about 200,000 nucleotides, from 15 nucleotides to about 200,000 nucleotides, from about 20 nucleotides to about 200,000 nucleotides, from about 30 nucleotides to about 200,000 nucleotides, from about 40 nucleotides to about 200,000 nucleotides, from about 50 nucleotides to about 200,000 nucleotides, from about 100 nucleotides to about 200,000 nucleotides, from about 200 nucleotides to about 200,000 nucleotides, from about 300 nucleotides to about 200,000 nucleotides, from about 400 nucleotides to about 200,000 nucleotides, from about 500 nucleotides to about 200,000 nucleotides, from about 1000 nucleotides to about 200,000 nucleotides, About 200,000 nucleotides, about 2000 nucleotides to about 200,000 nucleotides, about 3000 nucleotides to about 200,000 nucleotides, about 4000 nucleotides to about 200,000 nucleotides, about 5000 nucleotides to about 200,000 nucleotides, about 10,000 nucleotides to about 200,000 nucleotides, about 20,000 nucleotides to about 200,000 nucleotides, about 30,000 nucleotides to about 200,000 nucleotides, about 40,000 nucleotides to about 200,000 nucleotides, about 50,000 nucleotides to about 200,000 nucleotides, about 100,000 nucleotides to about 200,000 nucleotides, about 150,000 nucleotides to about 200,000 nucleotides.

[0254] In some embodiments, the polyribonucleotide may be no more than 200,000 nucleotides, no more than 150,000 nucleotides, no more than 100,000 nucleotides, or no more than 50,000 nucleotides in length.

[0255] Additional nucleotide modifications

[0256] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose further comprises modifications, including a modified backbone, a modified nucleobase, or any combination thereof.

[0257] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose further comprises a modified backbone.

[0258] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises a modified nucleobase. The modification on the nucleobase comprises modification of one or more of the following: adenine, cytosine, uracil or guanine.

[0259] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises a modified adenine. In some embodiments, the modified adenine comprises: 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino- Purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2-methylthio-N6-methyl-adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6-isopentenyl-adenosine (ms2i6 A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycylcarbamoyl-adenosine (g6A), N6-threonylcarbamoyl-adenosine (t6A), N6-methyl-N6-threonylcarbamoyl-adenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms2g6A), N6,N6-dimethyl-adenosine (m\A), N6-hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N 6-hydroxynorvalylcarbamoyladenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2'-0-methyl-adenosine (Am), N6,2'-0-dimethyl-adenosine (m6Am), N6,N6,2'-0-trimethyl-adenosine (m62Am), 1,2'-0-dimethyl-adenosine (m1Am), 2'-0-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azidoadenosine, 2'-F-arabino-adenosine, 2'-F-adenosine, 2'-0H-arabino-adenosine, N6-(1 9-amino-pentaoxanonadecyl)-adenosine, or any combination thereof.

[0260] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose and a modified adenine further comprises one or more modified nucleobases other than the modified adenine, eg, as described herein.

[0261] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose further comprises a modified cytosine. In some embodiments, the modified cytosine includes: 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolopseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 1-methyl-1-deazapseudoisocytidine, zebularine, 5- aza-zebulin, 5-methyl-zebulin, 5-aza-2-thio-zebulin, 2-thio-zebulin, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), α-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5,2'-O-dimethyl- Cytidine (m5Cm), N4-acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m\Cm), 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine, 2'-OH-ara-cytidine or any combination thereof.

[0262] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose comprises a modified cytosine including N4-acetyl-cytidine (ac4C).

[0263] In some embodiments, a polyribonucleotide comprising a 2'-O-acetylated ribose and a modified cytosine further comprises one or more modified nucleobases other than the modified cytosine, eg, as described herein.

[0264] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose and a modified cytosine (including Ac4C) further comprises one or more modified nucleobases other than the modified cytosine comprising Ac4C, eg, as described herein.

[0265] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises a modified uracil. In some embodiments, the modified uracil comprises: 5-hydroxymethyl uridine, pseudouridine, pyridine-4-ketone ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl uridine, 5-halogenated-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U ), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (nmm5U), 5-methylaminomethyl-2-thio-uridine (nmm5s2U), 5-methylaminomethyl-2-seleno-uridine (nmm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylamino methyl-2-thio-uridine (cnmm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurine methyl-uridine (TITI5U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uridine (TITI5s2U), 1-taurine methyl-4-thio-pseudouridine, 5-methyl-uridine (m5U, i.e., with the nucleobase deoxythymine), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine Uridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyldihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methylpseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), l-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thiouridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine, 2-thio-2'-O-methyl-uridine (s2Um), 5-methoxycarboxymethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um) and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'-F-arabinouridine, 2'-F-uridine, 2'-OH-arabinouridine, 5-(2-carbonylmethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine or any combination thereof. ,

[0266] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises a modified uracil comprising 5-hydroxymethyluridine.

[0267] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose further comprises a modified uracil comprising N1-methylpseudouridine.

[0268] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose and a modified uracil further comprises one or more modified nucleobases other than the modified uracil, eg, as described herein.

[0269] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose and modified uracil (comprising 5-hydroxymethyluridine) further comprises one or more modified nucleobases other than modified uracil comprising 5-hydroxymethyluridine, e.g., as described herein.

[0270] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose and modified uracil (comprising N1-methylpseudouridine) further comprises one or more modified nucleobases other than the modified uracil comprising N1-methylpseudouridine, e.g., as described herein.

[0271] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises modified guanine. In some embodiments, the modified guanine comprises: inosine (I), 1-methyl-inosine (m1 I), wyoside (imG), methyl wyoside (mimG), 4-demethyl-wyoside (imG-14), isowyoside (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosylqueuosine, mannosylqueuosine (manQ), 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanosine, 6-thioguanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7 G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2,N2-dimethyl-guanosine (m\G), N2,7-dimethyl-guanosine (m27G), N2,N2,7-dimethyl-guanosine (m2'2'7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), l-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methylguanosine (m2'7Gm), 2'-O-methyl-inosine (Im), l,2'-O-dimethyl-inosine (m1Im), 2'-O-ribosylguanosine (phosphate) (Gr(p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-arabino-guanosine, 2'-F-guanosine or any combination thereof.

[0272] In some embodiments, the polyribonucleotide comprising a 2'-O-acetylated ribose and a modified guanine further comprises one or more modified nucleobases other than the modified guanine, eg, as described herein.

[0273] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises a purine analog and / or a pyrimidine analog. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises a nucleobase comprising naturally occurring and synthetic base derivatives, including pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propargyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogen (e.g., 8-bromo), 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5 triazone, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine; 1,3,5 triazine; or any combination thereof.

[0274] Exemplary nucleotide modifications, including nucleobase modifications, include those provided in International Patent Application WO 2013 / 052523, filed October 3, 2012, the entire contents of which are incorporated herein by reference.

[0275] N4-Acetylcytidine Modified Nucleotides

[0276] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises a base comprising an acetyl group, wherein the nucleoside is N4-acetylcytidine, and the modified ribonucleotide has the following structure:

[0277]

[0278] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues. In some embodiments, at least 1% of the cytidine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the cytidine residues comprise 2-O acetylated ribose.

[0279] In some embodiments, polyribonucleotide disclosed herein comprises cytidine residues, and at least 5% of cytidine residues comprise N4-acetylcytidine. In some embodiments, at least 1% of N4-acetylcytidine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of N4-acetylcytidine residues comprise 2-O acetylated ribose.

[0280] In some embodiments, polyribonucleotide disclosed herein comprises cytidine residues, and the cytidine residues less than 100% comprise N4-acetylcytidine. In some embodiments, at least 1% of N4-acetylcytidine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of N4-acetylcytidine residues comprise 2-O acetylated ribose.

[0281] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 5% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 10% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 15% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 20% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 25% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 30% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 35% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 40% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 45% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 50% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 55% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and at least 60% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and at least 65% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and at least 70% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and at least 75% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and at least 80% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and at least 85% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine.In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and at least 90% of the cytidine residues in the polyribonucleotides include N4-acetylcytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and at least 95% of the cytidine residues in the polyribonucleotides include N4-acetylcytidine. In some embodiments, at least 1% of the N4-acetylcytidine residues include 2-O acetylated ribose. In some embodiments, no more than 90% of the N4-acetylcytidine residues include 2-O acetylated ribose.

[0282] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues. In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 1 ... About 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the cytidine residues contain N4-acetylcytidine. In some embodiments, at least 1% of the N4-acetylcytidine residues contain 2-O acetylated ribose. In some embodiments, no more than 90% of the N4-acetylcytidine residues contain 2-O acetylated ribose.

[0283] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and no more than 60% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and no more than 65% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and no more than 70% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and no more than 75% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and no more than 80% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and no more than 85% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and no more than 90% of the cytidine residues in the polyribonucleotides include N4-acetylcytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and no more than 95% of the cytidine residues in the polyribonucleotides include N4-acetylcytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and no more than 99% of the cytidine residues in the polyribonucleotides include N4-acetylcytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and about 5% of the cytidine residues in the polyribonucleotides include N4-acetylcytidine. In some embodiments, at least 1% of the N4-acetylcytidine residues include 2-O acetylated ribose. In some embodiments, no more than 90% of the N4-acetylcytidine residues include 2-O acetylated ribose.

[0284] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 10% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 15% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 20% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 25% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 30% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 35% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 40% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 45% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 50% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 55% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 60% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 65% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and about 75% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and about 80% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and about 85% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and about 90% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and about 95% of the cytidine residues in the polyribonucleotides include N4-acetyl cytidine.In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and about 99% of the cytidine residues in the polyribonucleotides include N4-acetylcytidine. In some embodiments, polyribonucleotides disclosed herein include cytidine residues, and 100% of the cytidine residues in the polyribonucleotides include N4-acetylcytidine. In some embodiments, at least 1% of the N4-acetylcytidine residues include 2-O acetylated ribose. In some embodiments, no more than 90% of the N4-acetylcytidine residues include 2-O acetylated ribose.

[0285] In some embodiments, the polyribonucleotide wherein at least 5% of the cytidine residues are N4-acetylcytidine comprises at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% 2'-O-acetylated ribose. In some embodiments, at least 1% of the N4-acetylcytidine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the N4-acetylcytidine residues comprise 2-O acetylated ribose.

[0286] In some embodiments, the polyribonucleotide wherein at least 5% of the cytidine residues are N4-acetylcytidine comprises at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% 2'-O-acetylated ribose. In some embodiments, at least 1% of the N4-acetylcytidine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the N4-acetylcytidine residues comprise 2-O acetylated ribose.

[0287] In some embodiments, the polyribonucleotide wherein at least 5% of the cytidine residues are N4-acetylcytidine comprises 100% 2'-O-acetylated ribose.

[0288] In some embodiments, the polyribonucleotides wherein at least 5% of the cytidine residues are N4-acetyl cytidine comprise about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 50%. In some embodiments, at least 1% of the N4-acetylcytidine residues contain 2-O acetylated ribose. In some embodiments, no more than 90% of the N4-acetylcytidine residues contain 2-O acetylated ribose.

[0289] In some embodiments, the polyribonucleotides wherein at least 5% of the cytidine residues are N4-acetyl cytidine comprise about 76% to about 100%, about 77% to about 100%, about 78% to about 100%, about 79% to about 100%, about 80% to about 100%, about 81% to about 100%, about 82% to about 100%, about 83% to about 100%, about 84% to about 100%, about 85% to about 100%, about 86% to about 100%. 100%, about 87% to about 100%, about 88% to about 100%, about 89% to about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to 100%, about 95% to 100%, about 96 to 100%, about 97% to 100%, about 98% to about 100%, about 99% to about 100% 2'-O-acetylated ribose. In some embodiments, at least 1% of the N4-acetylcytidine residues contain 2-O acetylated ribose. In some embodiments, no more than 90% of the N4-acetylcytidine residues contain 2-O acetylated ribose.

[0290] In some embodiments, a polyribonucleotide comprising 2-O acetylated ribose and a cytidine residue comprising N4-acetylcytidine (eg, a portion of N4-acetylcytidine having 2-O ribose acetylation) further comprises one or more modified nucleotides.

[0291] 5-Hydroxymethyl modified nucleotides

[0292] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises a base comprising a hydroxymethyl group, wherein the nucleoside is 5-hydroxymethyluridine, and the modified ribonucleotide has the following structure:

[0293]

[0294] In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues. In some embodiments, at least 1% of the uridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the uridine residues comprise 2-O acetylated ribose.

[0295] In some embodiments, polyribonucleotide disclosed herein comprises uridine and at least 5% of uridine residues comprise 5-hydroxymethyluridine. In some embodiments, at least 1% of 5-hydroxymethyluridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

[0296] In some embodiments, polyribonucleotide disclosed herein comprises uridine and uridine residues less than 100% comprise 5-hydroxymethyluridine. In some embodiments, at least 1% of 5-hydroxymethyluridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

[0297] In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 5% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 10% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 15% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 20% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 25% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 30% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 35% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 40% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 45% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 50% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 55% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and at least 60% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and at least 65% of the uridine residues in the polyribonucleotides include 5-hydroxymethyluridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and at least 70% of the uridine residues in the polyribonucleotides include 5-hydroxymethyluridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and at least 75% of the uridine residues in the polyribonucleotides include 5-hydroxymethyluridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and at least 80% of the uridine residues in the polyribonucleotides include 5-hydroxymethyluridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and at least 85% of the uridine residues in the polyribonucleotides include 5-hydroxymethyluridine.In some embodiments, polyribonucleotides disclosed herein include uridine residues and at least 90% of the uridine residues in the polyribonucleotides include 5-hydroxymethyluridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and at least 95% of the uridine residues in the polyribonucleotides include 5-hydroxymethyluridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and at least 99% of the uridine residues in the polyribonucleotides include 5-hydroxymethyluridine. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues include 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues include 2-O acetylated ribose.

[0298] In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues. In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 10% of the polyribonucleotides. , about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the uridine residues contain 5-hydroxymethyluridine. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues contain 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues contain 2-O acetylated ribose.

[0299] In some embodiments, polyribonucleotides disclosed herein comprise uridine residues and more than 60% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, polyribonucleotides disclosed herein comprise uridine residues and more than 65% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, polyribonucleotides disclosed herein comprise uridine residues and more than 70% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, polyribonucleotides disclosed herein comprise uridine residues and more than 75% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, polyribonucleotides disclosed herein comprise uridine residues and more than 80% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, polyribonucleotides disclosed herein comprise uridine residues and more than 85% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyl uridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and more than 90% of the uridine residues in the polyribonucleotide include 5-hydroxymethyluridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and more than 95% of the uridine residues in the polyribonucleotide include 5-hydroxymethyluridine. In some embodiments, polyribonucleotides disclosed herein include uridine residues and more than 99% of the uridine residues in the polyribonucleotide include 5-hydroxymethyluridine. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues include 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues include 2-O acetylated ribose.

[0300] In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 5% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 10% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 15% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 20% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 25% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 30% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 35% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 40% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 45% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 50% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 55% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 60% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 65% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 75% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 80% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 85% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 90% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, the polyribonucleotides disclosed herein comprise uridine residues and about 95% of the uridine residues in the polyribonucleotides comprise 5-hydroxymethyluridine.In some embodiments, polyribonucleotide disclosed herein comprises uridine residues and about 99% of the uridine residues in the polyribonucleotide comprise 5-hydroxymethyluridine. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

[0301] In some embodiments, polyribonucleotide disclosed herein comprises uridine residues and 100% uridine residues in the polyribonucleotide comprise 5-hydroxymethyluridine. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

[0302] In some embodiments, the polyribonucleotides wherein at least 5% of the uridine residues are 5-hydroxymethyluridine comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% 2'-O-acetylated ribose. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

[0303] In some embodiments, the polyribonucleotides wherein at least 5% of the uridine residues are 5-hydroxymethyluridine comprise at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% 2'-O-acetylated ribose. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

[0304] In some embodiments, the polyribonucleotide wherein at least 5% of the uridine residues are 5-hydroxymethyluridine comprises 100% 2'-O-acetylated ribose.

[0305] In some embodiments, the polyribonucleotides wherein at least 5% of the uridine residues are 5-hydroxymethyluridine comprise about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 50%. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues contain 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues contain 2-O acetylated ribose.

[0306] In some embodiments, the polyribonucleotides wherein at least 5% of the uridine residues are 5-hydroxymethyluridine comprise about 76% to about 100%, about 77% to about 100%, about 78% to about 100%, about 79% to about 100%, about 80% to about 100%, about 81% to about 100%, about 82% to about 100%, about 83% to about 100%, about 84% to about 100%, about 85% to about 100%, about 86% to about 100%. 100%, about 87% to about 100%, about 88% to about 100%, about 89% to about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to 100%, about 95% to 100%, about 96 to 100%, about 97% to 100%, about 98% to about 100%, about 99% to about 100% 2'-O-acetylated ribose. In some embodiments, at least 1% of the 5-hydroxymethyluridine residues contain 2-O acetylated ribose. In some embodiments, no more than 90% of the 5-hydroxymethyluridine residues contain 2-O acetylated ribose.

[0307] In some embodiments, a polyribonucleotide comprising a 2-O acetylated ribose and a uridine residue comprising 5-hydroxymethyluridine (eg, a portion of a 5-hydroxymethyluridine having 2-O ribose acetylation) further comprises one or more modified nucleotides.

[0308] N1-methylpseudouridine modified nucleotides

[0309] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose further comprises a base comprising a methyl group, wherein the nucleoside is N1-methylpseudouridine (m1Ψ), and the modified ribonucleotide has the following structure:

[0310]

[0311] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 5% of the uridine residues comprise N1-methyl pseudouridine. In some embodiments, at least 1% of the N1-methyl pseudouridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the N1-methyl pseudouridine residues comprise 2-O acetylated ribose.

[0312] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues, and less than 100% of the uridine residues in the polyribonucleotide comprise N1-methyl pseudouridine. In some embodiments, at least 1% of the N1-methyl pseudouridine residues comprise 2-O acetylated ribose. In some embodiments, no more than 90% of the N1-methyl pseudouridine residues comprise 2-O acetylated ribose.

[0313] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% of the uridine residues comprise N1-methyl pseudouridine in the polyribonucleotide. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 10% of the uridine residues comprise N1-methyl pseudouridine in the polyribonucleotide.

[0314] In some embodiments, the polyribonucleotides comprising 2'-O-acetylated ribose comprise uridine residues and about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15 In some embodiments, the polyribonucleotides comprising 2'-O-acetylated ribose comprise uridine residues and at least 10% of the uridine residues in the polyribonucleotides comprise N1-methyl pseudouridine.

[0315] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and more than 60%, no more than 70%, no more than 80%, no more than 90%, no more than 95% or no more than 99% uridine residues comprise N1-methyl pseudouridine. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 10% uridine residues in the polyribonucleotide comprise N1-methyl pseudouridine.

[0316] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or about 99% of the uridine residues comprise N1-methyl pseudouridine in the polyribonucleotide. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 10% of the uridine residues comprise N1-methyl pseudouridine in the polyribonucleotide.

[0317] In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and 100% of the uridine residues in the polyribonucleotide comprise N1-methyl pseudouridine. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 10% of the uridine residues in the polyribonucleotide comprise N1-methyl pseudouridine.

[0318] In some embodiments, the polyribonucleotide wherein at least 5% of the uridine residues are N1-methyl pseudouridine comprises at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% 2'-O-acetylated ribose. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 10% of the uridine residues in the polyribonucleotide comprises N1-methyl pseudouridine.

[0319] In some embodiments, the polyribonucleotide wherein at least 5% of the uridine residues are N1-methyl pseudouridine comprises at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% 2'-O-acetylated ribose. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 10% of the uridine residues in the polyribonucleotide comprises N1-methyl pseudouridine.

[0320] In some embodiments, the polyribonucleotides wherein at least 5% of the uridine residues are N1-methyl pseudouridines comprise 100% 2'-O-acetylated ribose. In some embodiments, the polyribonucleotides comprising 2'-O-acetylated riboses comprise uridine residues and at least 10% of the uridine residues in the polyribonucleotides comprise N1-methyl pseudouridine.

[0321] In some embodiments, the polyribonucleotides wherein at least 5% of the uridine residues are N1-methylpseudouridine comprise about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 50%. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 10% of the uridine residues in the polyribonucleotide comprise N1-methyl pseudouridine.

[0322] In some embodiments, the polyribonucleotides wherein at least 5% of the uridine residues are N1-methylpseudouridine comprise about 76% to about 100%, about 77% to about 100%, about 78% to about 100%, about 79% to about 100%, about 80% to about 100%, about 81% to about 100%, about 82% to about 100%, about 83% to about 100%, about 84% to about 100%, about 85% to about 100%, about 86% to about 100%. 100%, about 87% to about 100%, about 88% to about 100%, about 89% to about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to 100%, about 95% to 100%, about 96 to 100%, about 97% to 100%, about 98% to about 100%, about 99% to about 100% 2'-O-acetylated ribose. In some embodiments, the polyribonucleotide comprising 2'-O-acetylated ribose comprises uridine residues and at least 10% of the uridine residues in the polyribonucleotide comprise N1-methyl pseudouridine.

[0323] In some embodiments, a polyribonucleotide comprising a 2-O acetylated ribose and a uridine residue comprising N1-methylpseudouridine (eg, a portion of N1-methylpseudouridine having 2-O ribose acetylation) further comprises one or more modified nucleotides.

[0324] Composition

[0325] The present disclosure provides, among other things, compositions.The compositions disclosed herein comprise one or more polyribonucleotides comprising one or more modified ribonucleotides comprising a 2'-O-acetylated ribose sugar.

[0326] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is or comprises a pharmaceutical composition.

[0327] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is or comprises an immunogenic composition.An immunogenic composition is a composition for inducing an immune response.In some embodiments, the immunogenic composition comprising one or more polyribonucleotides itself does not induce an immune response, but one or more polyribonucleotides encode for example one or more polypeptides for inducing an immune response.

[0328] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is or comprises a vaccine.

[0329] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is or comprises a gene therapy.

[0330] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is or comprises chemotherapy.

[0331] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is or comprises a protein replacement therapy.

[0332] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is or comprises an immunotherapy.

[0333] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is or comprises a genetic engineering therapy.

[0334] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose comprises double-stranded RNA.

[0335] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose does not comprise double-stranded RNA.

[0336] In some embodiments, the composition comprising polyribonucleotides disclosed herein is characterized in that when evaluating in cells, tissues or organisms in which polyribonucleotides have been applied, immunogenicity reduction is observed relative to appropriate reference comparators. In some embodiments, reference comparators include cells, tissues or organisms similar to other aspects of the composition comprising comparable polyribonucleotides comprising 2'-O-acetylated ribose (for example, not comprising any 2'-O-acetylated ribose) less than the polyribonucleotides in the composition. In some embodiments, immunogenicity reduction includes activation reduction of the toxicity induced by innate immune response. In some embodiments, activation reduction of immune response includes activation reduction of NFkb or NFkb pathways, IRF or IRF pathways and / or other inflammatory cytokines in cells, tissues or organisms. In some embodiments, immune response activation reduction includes detection reduction of uncapped RNA by molecular sensors (for example, RIG-I).

[0337] In some embodiments, immunogenicity reduction allows repeated administration to cells, tissues or subjects, for example, using at least two dosages of the compositions comprising polyribonucleotide disclosed herein. In some embodiments, repeated administration includes the compositions comprising polyribonucleotide disclosed herein of using at least two dosages, at least three dosages, at least four dosages, at least five dosages, at least six dosages, at least seven dosages, at least eight dosages, at least nine dosages or at least ten dosages. In some embodiments, repeated administration includes the compositions of the same dosage compared with the dosage of previously using the compositions. In some embodiments, repeated administration includes the compositions of different dosages compared with the dosage of previously using the compositions.

[0338] In some embodiments, repeated administration of a composition disclosed herein comprises administering a first dose at a first time point and then administering a subsequent dose at a second time point. In some embodiments, the first time point is about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months earlier than the second time point.

[0339] In some embodiments, a second or subsequent dose of a composition comprising polyribonucleotides disclosed herein has substantially similar efficacy in a cell, tissue, or subject as compared to the first dose of a composition comprising polyribonucleotides disclosed herein.

[0340] In some embodiments, immunogenicity reduction allows to use the compositions comprising polyribonucleotide disclosed herein of higher dosage relative to suitable reference comparator.In some embodiments, reference comparator includes the comparable polyribonucleotide that comprises less 2'-O-acetylated ribose (for example, does not comprise any 2'-O-acetylated ribose) compared with polyribonucleotide disclosed herein.

[0341] In some embodiments, the composition comprising polyribonucleotide disclosed herein is characterized in that when assessing in the cell, tissue or organism using polyribonucleotide, relative to suitable reference comparator, observe that cell viability increases.In some embodiments, reference comparator is the cell viability of the cell, tissue or organism using the comparable polyribonucleotide that comprises less 2'-O-acetylated ribose (for example, not including any 2'-O-acetylated ribose) compared with polyribonucleotide disclosed herein.

[0342] In some embodiments, cell viability is a measure of the length of time that one or more cells of a cell, tissue, or subject survive.

[0343] In some embodiments, cell viability is a measure of the number of cells, tissues, or cells of a subject that are viable at one or more time points.

[0344] In some embodiments, the compositions disclosed herein are or comprise in vitro transcribed polyribonucleotides comprising modified ribonucleotides disclosed herein.

[0345] In some embodiments, a composition disclosed herein is or comprises an expression vector comprising one or more polynucleotides disclosed herein.

[0346] In some embodiments, the compositions disclosed herein comprise polyribonucleotides comprising one or more modified ribonucleotides disclosed herein.

[0347] In some embodiments, compositions disclosed herein include multiple polyribonucleotides, each polyribonucleotide includes one or more modified ribonucleotides disclosed herein. In some embodiments, compositions include multiple ribonucleotides, wherein the first polyribonucleotide includes the first modified ribonucleotide, and the second polyribonucleotide includes the second modified ribonucleotide. In some embodiments, the first modified ribonucleotide and the second modified ribonucleotide are identical modified ribonucleotides. In some embodiments, the first modified ribonucleotide and the second modified ribonucleotide are different modified ribonucleotides. In some embodiments, the first polyribonucleotide and / or the second polyribonucleotide also include one or more modified nucleotides.

[0348] In some embodiments, the compositions disclosed herein are administered at a dose of about 5 ng to about 1000 ng, about 5 ng to about 900 ng, about 5 ng to about 800 ng, about 5 ng to about 700 ng, about 5 ng to about 600 ng, about 5 ng to about 500 ng, about 5 ng to about 400 ng, about 5 ng to about 300 ng, about 5 ng to about 200 ng, about 5 ng to about 100 ng, about 5 ng to about 90 ng, about 5 ng to about 80 ng, about 5 ng to about 70 ng, about 5 ng to about 60 ng, about 5 ng to about 50 ng, about 5 ng to about 40 ng, about 5 ng to about 30 ng, about 5 ng to about 20 ng, or about 5 ng to about 10 ng. In some embodiments, the compositions disclosed herein are administered at a dose of about 10 ng to about 1000 ng, about 20 ng to about 1000 ng, about 30 ng to about 1000 ng, about 40 ng to about 1000 ng, about 50 ng to about 1000 ng, about 60 ng to about 1000 ng, about 70 ng to about 1000 ng, about 80 ng to about 1000 ng, about 90 ng to about 1000 ng, about 100 ng to about 1000 ng, about 200 ng to about 1000 ng, about 300 ng to about 1000 ng, about 40 ng to about 1000 ng, about 50 ng to about 1000 ng, about 60 ng to about 1000 ng, about 700 ng to about 1000 ng, about 800 ng to about 1000 ng, or about 900 ng to about 1000 ng.

[0349] In some embodiments, the compositions disclosed herein are administered at a dose of about 5 ng, about 10 ng, about 20 ng, about 30 ng, about 40 ng, about 50 ng, about 60 ng, about 70 ng, about 80 ng, about 90 ng, about 100 ng, 150 ng, about 200 ng, about 250 ng, about 300 ng, about 350 ng, about 400 ng, about 450 ng, about 500 ng, about 550 ng, about 600 ng, about 650 ng, about 700 ng, about 750 ng, about 800 ng, about 850 ng, about 900 ng, about 950 ng, or about 1000 ng.

[0350] In some embodiments, the compositions disclosed herein are administered at a dose of at least 5 ng, at least 10 ng, at least 20 ng, at least 30 ng, at least 40 ng, at least 50 ng, at least 60 ng, at least 70 ng, at least 80 ng, at least 90 ng, at least 100 ng, at least 150 ng, at least 200 ng, at least 250 ng, at least 300 ng, at least 350 ng, at least 400 ng, at least 450 ng, at least 500 ng, at least 550 ng, at least 600 ng, at least 650 ng, at least 700 ng, at least 750 ng, at least 800 ng, at least 850 ng, at least 900 ng, at least at least 950 ng, or at least 1000 ng.

[0351] Pharmaceutical composition

[0352] In some embodiments, the composition comprising one or more polyribonucleotides comprising 2'-O-acetylated ribose is a pharmaceutical composition. In some embodiments, the pharmaceutical composition also comprises a pharmaceutically acceptable excipient. The pharmaceutical composition of the present disclosure comprises a polypeptide disclosed herein, a polynucleotide disclosed herein, or an expression vector comprising a polynucleotide disclosed herein.

[0353] In some embodiments, the pharmaceutical composition may include a pharmaceutically acceptable carrier or excipient, as used herein, including any and all solvents, dispersion media, diluents or other liquid vehicles, dispersion or suspension aids, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, etc., as suitable for the specific dosage form required. Remington's The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference) discloses various excipients for preparing pharmaceutical compositions and known preparation techniques thereof. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline solutions (e.g., NaCl), saline, buffered saline, glycerol, sugars (such as mannitol, sucrose or others), dextrose, fatty acid esters, etc., and combinations thereof.

[0354] If necessary, the pharmaceutical composition can be mixed with auxiliary agents (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for affecting osmotic pressure, buffers, colorants, flavoring agents and / or aromatic substances, etc.), which do not react harmfully with the active compound or interfere with its activity. In certain embodiments, a water-soluble carrier suitable for intravenous administration is used. In some embodiments, the pharmaceutical composition can be sterile.

[0355] If desired, suitable pharmaceutical compositions may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.The pharmaceutical composition may be a liquid solution, suspension or emulsion.

[0356] The pharmaceutical composition can be formulated as a pharmaceutical composition suitable for application to humans according to conventional procedures. The preparation of the pharmaceutical composition should be suitable for the mode of administration. For example, in some embodiments, the composition for intravenous administration is generally a solution in a sterile isotonic aqueous buffer. If necessary, the composition may also include a solubilizer and a local anesthetic to alleviate the pain at the injection site. Generally speaking, each component is provided separately or mixed together in a unit dose form, for example, as a dry lyophilized powder or anhydrous concentrate in a sealed container such as an ampoule or a pouch indicating the amount of the active agent. When the pharmaceutical composition is administered by infusion, an infusion bottle containing sterile pharmaceutical grade water, saline or dextrose / water may be used for distribution. When the pharmaceutical composition is administered by injection, an ampoule of sterile water for injection or saline may be provided so that the components may be mixed before administration.

[0357] Although the description of pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for ethical administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for in vitro or ex vivo administration to all kinds of animals or cells. It is well known to modify pharmaceutical compositions suitable for administration to humans in order to make the compositions suitable for in vitro or ex vivo administration to various animals or cells, and such modifications can be designed and / or performed by those of ordinary skill in the art, such as veterinary pharmacologists, using only ordinary experimentation (if any).

[0358] The formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparation methods include the steps of bringing the active ingredient into association with a diluent or another excipient and / or one or more other auxiliary ingredients, and then, if necessary and / or desired, shaping and / or packaging the product into the desired single or multiple dose units.

[0359] Pharmaceutical compositions according to the present disclosure may be prepared, packaged, and / or sold in bulk as a single unit dose and / or as multiple unit doses.As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition described herein.

[0360] Method for preparing polyribonucleotide containing 2-O-acetylated ribose

[0361] The present disclosure especially provides the method for preparing polyribonucleotides comprising 2-O-acetylated ribose. In some embodiments, the method for producing polyribonucleotides is disclosed herein, which comprises the step of incubating an in vitro transcription mixture, wherein the in vitro transcription mixture comprises: (i) a DNA template; (ii) at least one RNA polymerase or its variant or fragment; and (iii) a plurality of ribonucleotides comprising at least one modified ribonucleotide comprising 2'-O-acetylated ribose; thereby producing polyribonucleotides comprising 2'-O-acetylated ribose.

[0362] Also disclosed herein is an in vitro transcription mixture that can be used to produce a polyribonucleotide comprising 2'-O-acetylated ribose. In some embodiments, disclosed herein is an in vitro transcription mixture that comprises: (i) a DNA template; (ii) at least one RNA polymerase or its variant or fragment; and (iii) a plurality of ribonucleotides comprising at least one modified ribonucleotide comprising 2'-O-acetylated ribose.

[0363] In some embodiments, the method or in vitro transcription mixture produces a plurality of polyribonucleotides. In some embodiments, each polyribonucleotide in the plurality of polyribonucleotides comprises a 2'-O-acetylated ribose.

[0364] In some embodiments, the RNA polymerase is selected from: bacteriophage RNA polymerase, mitochondrial RNA polymerase, eukaryotic RNA polymerase, bacterial RNA polymerase, or any combination thereof. In some embodiments, the RNA polymerase comprises T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, viral RNA polymerase, N4 virion RNA polymerase, or a variant of any of the foregoing.

[0365] In some embodiments, the polyribonucleotide produced by method disclosed herein or using in vitro transcription mixture comprises coding region.In some embodiments, coding region encoding gene product, for example, as described herein.

[0366] In some embodiments, the polyribonucleotides produced by the method disclosed herein or using an in vitro transcription mixture do not include a coding region. In some embodiments, the polyribonucleotides not including a coding region may also be referred to as non-coding RNA. Exemplary non-coding RNA includes but is not limited to long non-coding RNA (lncRNA), microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, rRNA and tRNA.

[0367] In some embodiments, the polyribonucleotides produced by the methods disclosed herein or using an in vitro transcription mixture include guide RNA, short hairpin RNA, siRNA, microRNA, long noncoding RNA, circular RNA, or messenger RNA (mRNA), or any combination thereof.

[0368] In some embodiments, the polyribonucleotide encoding payload is produced by the methods disclosed herein or using an in vitro transcription mixture. In some embodiments, the payload comprises one or more target polypeptides.

[0369] In some embodiments of the methods of producing ribonucleotides disclosed herein, the incubating step occurs at a temperature of at least 37°C.

[0370] In some embodiments of the methods of producing ribonucleotides disclosed herein, the incubation step occurs at a temperature of about 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C or more.

[0371] In some embodiments of the methods of producing ribonucleotides disclosed herein, the incubating step is performed for at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, or longer.

[0372] RNA preparation

[0373] Provided herein are, among other things, compositions comprising polyribonucleotides comprising 2'-O-acetylated ribose and formulations thereof. In some embodiments, the compositions comprising polyribonucleotides disclosed herein are formulated into lipid nanoparticle (LNP) formulations.

[0374] In some embodiments, polyribonucleotide encoding polypeptide disclosed herein.In some embodiments, polyribonucleotide disclosed herein is or comprises messenger RNA.In some embodiments, the compositions comprising the polyribonucleotide comprising messenger RNA is formulated into lipid nanoparticle (LNP) preparation.

[0375] In some embodiments, polyribonucleotide disclosed herein is or comprises gRNA.In some embodiments, the composition comprising polyribonucleotide comprising gRNA is formulated into lipid nanoparticle (LNP) formulation.

[0376] In some embodiments, the polyribonucleotide disclosed herein is or comprises an inhibitory RNA.In some embodiments, the composition comprising the polyribonucleotide comprising an inhibitory RNA is formulated into a lipid nanoparticle (LNP) formulation.

[0377] In some embodiments, the polyribonucleotide disclosed herein is or comprises miRNA or siRNA.In some embodiments, the composition comprising the polyribonucleotide comprising miRNA or siRNA is formulated into a lipid nanoparticle (LNP) formulation.

[0378] In some embodiments, the polyribonucleotide disclosed herein is or comprises an antisense oligonucleotide.In some embodiments, the composition comprising the polyribonucleotide comprising an antisense oligonucleotide is formulated into a lipid nanoparticle (LNP) formulation.

[0379] In some embodiments, the present disclosure provides LNP formulations comprising the polyribonucleotides disclosed herein for use in pharmaceutical compositions, e.g., immunogenic compositions.

[0380] Methods of using the compositions disclosed herein

[0381] The present disclosure provides, inter alia, methods for using the polyribonucleotides disclosed herein or compositions comprising the same.

[0382] In some embodiments, provided herein is a method of administering a polyribonucleotide disclosed herein or a composition comprising a polyribonucleotide disclosed herein to a cell, tissue, or subject.

[0383] In some embodiments, provided herein is a method of vaccination comprising administering a polyribonucleotide disclosed herein or a composition comprising a polyribonucleotide disclosed herein to a cell, a tissue, or a subject.

[0384] In some embodiments, disclosed herein is a gene therapy method, which includes administering polyribonucleotides disclosed herein or compositions comprising polyribonucleotides disclosed herein to cells, tissues or subjects. In some embodiments, the gene therapy method includes delivering one or more components of gene therapy, for example, guide RNA and / or Cas polypeptides.

[0385] In some embodiments, provided herein is a method for stimulating an immune response, comprising administering a polyribonucleotide disclosed herein or a composition comprising a polyribonucleotide disclosed herein to a cell, a tissue, or a subject.

[0386] In some embodiments, disclosed herein is a cell therapy engineering method comprising administering a polyribonucleotide disclosed herein or a composition comprising a polyribonucleotide disclosed herein to a cell, a tissue, or a subject.

[0387] In some embodiments, there is provided herein a method of immunotherapy, comprising administering polyribonucleotides disclosed herein or compositions comprising polyribonucleotides disclosed herein to cells, tissues or subjects. In some embodiments, immunotherapy methods include delivering antibody therapy and / or immune checkpoint therapy.

[0388] In some embodiments, disclosed herein is a protein replacement therapy method comprising administering to a cell, tissue or subject a polyribonucleotide disclosed herein or a composition comprising a polyribonucleotide disclosed herein. In some embodiments, protein replacement therapy comprises delivering an enzyme replacement therapy.

[0389] In some embodiments, provided herein is a chemotherapeutic method comprising administering a polyribonucleotide disclosed herein or a composition comprising a polyribonucleotide disclosed herein to a cell, a tissue, or a subject.

[0390] In some embodiments, the methods or uses disclosed herein include determining the cell viability of a cell, tissue, or subject. In some embodiments, cell viability is a measure of the length of time that one or more cells of a cell, tissue, or subject survive. In some embodiments, cell viability is a measure of the number of cells of a cell, tissue, or subject that survive at one or more time points.

[0391] In some embodiments, compared with reference cell viability, cell, tissue or subject of polyribonucleotide or the compositions comprising it are used and show cell viability improvement.In some embodiments, reference cell viability is to use the cell, tissue or subject of the comparable polyribonucleotide or the compositions comprising it comprising less 2'-O-acetylated ribose (for example, not comprising any 2'-O-acetylated ribose) compared with polyribonucleotide disclosed herein.

[0392] In some embodiments, the methods or uses disclosed herein also include determining that the cells, tissues or subjects to which polyribonucleotides or compositions comprising them have been administered have an immune system response. In some embodiments, the immune response includes an innate immune system response including toxicity induced by the innate immune system. In some embodiments, determining that the innate immune system responds includes determining the level and / or activation of NF-κB or NF-κB pathways, IRF or IRF pathways, or inflammatory cytokines or any combination thereof in cells, tissues or subjects. In some embodiments, determining that the innate immune system responds includes determining the level of uncapped RNA detection in cells, tissues or subjects.

[0393] In some embodiments, compared with reference, the cell, tissue or subject of polyribonucleotide or the composition comprising it has been used shows the innate immune system response of reduction.In some embodiments, reference is to have used the innate immune system response of the cell, tissue or subject of polyribonucleotide or the composition comprising it that comprises less 2'-O-acetylated ribose (for example, does not comprise any 2'-O-acetylated ribose) compared with polyribonucleotide disclosed herein or the comparable polyribonucleotide that comprises it, tissue or subject.

[0394] In some embodiments, the methods or uses disclosed herein further comprise determining the efficacy of the polyribonucleotide or a composition comprising the same in a cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered.

[0395] In some embodiments, determining efficacy includes determining the antibody response or cellular response in a cell, tissue or subject. In some embodiments, compared with reference, the cell, tissue or subject of polyribonucleotide or the composition comprising it shows an antibody response or cellular response increase. In some embodiments, reference is to have used a comparable polyribonucleotide comprising less 2'-O-acetylated ribose (for example, not comprising any 2'-O-acetylated ribose) compared with polyribonucleotide disclosed herein or the antibody response or cellular response of the cell, tissue or subject of the composition comprising it.

[0396] In some embodiments, method disclosed herein or purposes include applying polyribonucleotides or comprising its compositions at least twice to cells, tissues or subjects.In some embodiments, method disclosed herein includes applying polyribonucleotides or comprising its compositions at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times or at least 10 times to cells, tissues or subjects.

[0397] In some embodiments, method disclosed herein or purposes comprise the polyribonucleotide of multiple dosage or the compositions comprising it to cell, tissue or experimenter.In some embodiments, the polyribonucleotide of the second dosage or subsequent dosage or the compositions comprising it have the effect substantially similar to the compositions comprising polyribonucleotide of the first dosage in cell, tissue or experimenter.

[0398] In some embodiments of any method disclosed herein or purposes, compared with suitable reference comparator, polyribonucleotide or the compositions comprising it are applied to cell, tissue or experimenter with higher dosage.In some embodiments, reference comparator includes the comparable polyribonucleotide that comprises less 2'-O-acetylated ribose (for example, does not comprise any 2'-O-acetylated ribose) compared with polyribonucleotide disclosed herein.

[0399] In some embodiments of any of the methods or uses disclosed herein, the composition is administered via any of the following routes of administration: intramuscular, intravenous, subcutaneous, intrathecal, intradermal, ocular, intranasal, sublingual, or oral.

[0400] In some embodiments of any of the methods or uses disclosed herein, the cell is a mammalian cell.

[0401] In some embodiments of any of the methods or uses disclosed herein, the tissue is mammalian tissue.

[0402] In some embodiments of any of the methods or uses disclosed herein, the subject is a mammal. In some embodiments, the mammal is a human.

[0403] Reagent test kit

[0404] Another aspect of the present disclosure also provides pharmaceutical packaging or test kit. In some embodiments, the test kit may include polyribonucleotides or compositions as described herein. In some embodiments, the test kit may be used for any applicable method, such as the method described herein.

[0405] illustration

[0406] Example 1: Using 2-O-acetylated NTPs as substrates for in vitro transcription by T7 RNA polymerase

[0407] This example shows that wild-type T7 RNA polymerase can use 2'-O-acetylated nucleotide triphosphates as substrates for RNA in vitro transcription and that the resulting RNA is translationally active.

[0408] method:

[0409] Example 3 discloses a method for preparing the 2'-O-acetylated nucleotide triphosphates used in this example and disclosed herein.

[0410] In vitro transcription (IVT) of Luc2 RNA for A549 assay

[0411] Luc2 RNA was synthesized in a 20 μL IVT reaction consisting of 200 ng Luc2 T7 template, 20 mM MgCl2, 7.5 mM each of natural NTPs or 2-O-acetyl NTPs, 7.5 mM CleanCap AG (TriLink), 1X HiScribe transcription buffer, and 2 uL HiScribe polymerase mix (NEB) and incubated at 37°C for 4 hours.

[0412] All IVT products were cleaned up using the Monarch 500 μg RNA cleanup kit (NEB) and eluted into 88 μL of nuclease-free water. The eluted products were then digested in a 100 μL reaction consisting of 1X DNase I buffer and 10 U DNase I (RNase-free) (New England Biolabs) at 37°C for 5 minutes to degrade the DNA template. DNase I treated samples were cleaned up using the Monarch 500ug RNA cleanup kit (New England Biolabs) and eluted into 88 μL of nuclease-free water.

[0413] The DNAse I-treated product, which had the Cap 1 structure co-transcriptionally added, was treated with 1X DNase I buffer (NEB) and 100 U calf intestinal alkaline phosphatase (CIAP) (Promega) at 37°C for 5 min as a polishing step to remove rare immunogenic 5' triphosphates from RNA transcripts that did not incorporate CleanCap AG. DNase I buffer was used in this enzymatic step because we found that CIAP enzyme performed better in DNAse I buffer for this RNA polishing step (unpublished data).

[0414] CIAP-treated RNA was cleaned up using the Monarch 500ug RNA Cleanup Kit (NEB) and eluted into 100uL of nuclease-free water.

[0415] RNA quantification: RNA concentration was determined using a NanoDrop OneC spectrophotometer (Thermo Scientific).

[0416] A549 cell culture method: A549-Dual (InvivoGen) was cultured in high-glucose GlutaMAX Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum, 100 units / mL penicillin, 100 μg / mL streptomycin, 10 μg / mL blasticidin, and 100 μg / mL zeocin, and maintained at 37°C and 5% CO. 2 Down.

[0417] Cells were plated at 2,000 cells / well in 96-well plates 1 day before transfection. 50 or 100 ng of each RNA was transfected using Lipofectamine MessengerMAX transfection reagent (ThermoFisher) using a 1:1.5 μg:uL RNA:MessengerMAX ratio. Transfections were performed in triplicate.

[0418] Vitality and luciferase expression were determined using ONE-Glo+Tox luciferase reporter gene and cell viability assay (Promega). According to the manufacturer's instructions, NF-κB activation was measured via SEAP reporter gene using QUANTI-Blue detection reagent (InvivoGen). According to the manufacturer's instructions, IRF pathway activation was measured via the activity of Lucia luciferase gene using QUANTI-Luc detection reagent (InvivoGen).

[0419] result:

[0420] In the case of 2-O-acetylated RNA, immunogenicity was reduced and cell viability was improved. As shown in Table 1, T7 RNA polymerase uses 2-O-acetyl analogs to produce appreciable amounts of fully 2-O-acetylated full-length RNA, albeit at reduced yields compared to native nucleotides.

[0421] Table 1

[0422] In vitro transcribed RNA Yield Native Luc2 RNA 1142.4 ng / uL in 100 uL H2O 100% 2-O-acetylated Luc2 RNA 202.1 ng / uL in 75 uL H2O 100% 2-O-acetylated, Ac4C Luc2 RNA 90.4 ng / uL in 75 uL H2O

[0423] Fully 2-O-acetylated full-length RNA is not only translationally active but also outperforms unmodified RNA in terms of reporter gene expression, cell viability, and immunogenicity. Figure 2 It was shown that fully 2-O-acetylated RNA can be introduced into eukaryotic cells and translated by the eukaryotic ribosomal machinery and expressed better than unmodified RNA. Without wishing to be bound by any particular theory, it is expected that this observation is due to improved stability and / or extended half-life of 2-O-acetylated RNA.

[0424] The experimental results further showed that 2-O-acetylated RNA is less immunogenic than unmodified RNA. Figure 3 The results showed that 2-O-acetylated RNA improved cell viability compared with unmodified RNA. The trend of improved viability was consistent with the expression of two immunogenicity markers, NF-Kb ( Figure 5 ) and IRF( Figure 4 ) showed a similar decreasing trend.

[0425] In an assay testing the immunogenicity of 2-O-acetylated RNA (see Figure 4-5), found enhanced immunogenicity of 100ng 2-O-acetylated RNA. Without wishing to be bound by any particular theory, it is hypothesized that the increased immunogenicity at higher doses of 2-O-acetylated RNA may be due to novel RNA structures detected by cytoplasmic RNA sensors, increased cellular protein load due to longer RNA half-life, or a combination of the above factors. To test this hypothesis, 2-O-acetyl analogs of the base-modified nucleotide N4-acetylcytidine, which have previously been shown to reduce innate immunogenicity (see Figure 4 and Figure 5 , the last column on the right is labeled "50 ng 100% 2-O-acetylated, Ac4C Luc2"). In some embodiments, this data provides support for using 2-O-acetyl nucleotide triphosphates that are also base modified to further improve RNA performance when using higher doses of 2-O-acetyl RNA.

[0426] Characterization of 2-O-acetylation of nucleotides: To confirm complete 2-O-acetylation of the nucleotides used, NMR data for purified ribose acetylated NTPs were obtained. The data showed that the purified ribose acetylated NTPs consisted of a mixture of 2-O-acetyl and 3-O-acetyl NTPs only (see Examples 3 and Figure 6-61 ). This mixing is apparently due to the spontaneous switching of the acetyl groups in solution as triphosphates. However, this spontaneous switching and the resulting structural mixture does not indicate that the RNA used in this example is not completely 2-O-acetylated. This is because RNA transcription requires the 3'OH of the ribose to be available for chain extension. Therefore, any RNA product produced when transcribed using 2-O-acetylated NTPs must have only 2-O modifications, because the 3-O-acetyl group will act as a transcription terminator.

[0427] Conclusion: In summary, this example and the data herein demonstrate for the first time that 2'-O-acetylated RNA can be transcribed by wild-type T7 RNA polymerase and that the resulting RNA outperforms unmodified RNA. These findings reveal a new class of nucleotide triphosphates that can be readily used for in vitro RNA transcription for a variety of applications, including as therapeutic agents in medical applications.

[0428] Example 2: In vivo gene expression of 2-O-ribose acetylated RNA delivered by LNPs is comparable to that of N1-methylpseudouridine-modified RNA delivered by LNPs

[0429] This example describes in vivo gene expression in animals administered LNP formulations containing 2-O ribose acetylated RNA or N1-methylpseudouridine modified RNA.

[0430] Methods: Luc2 IVT template generation: The luc2 gene encoding an optimized version of firefly luciferase was amplified from pGL4.10[luc2] (Promega). Amplification was performed at an annealing temperature of 70°C in a 20 μL reaction consisting of 0.25 μM primers Luc2_fwd and Luc2_rev, 1X Herculase II buffer, 25 mM each dNTP, 15 ng pGL4.10[luc2] plasmid (Promega), 0.25 M betaine, and 0.4 μL Herculase II enzyme. The PCR product was purified using a DNA Clean and Concentrator-25 kit (Zymo Research) according to the manufacturer's protocol and eluted into 45 μL nuclease-free water. 42.5 uL of the eluted product was subjected to 125 U Dpn1 enzyme (New England Biolabs) in a 50 μL reaction to digest the template plasmid. According to the manufacturer's protocol, the digested product was purified again using a DNA clean and concentrator-25 kit (Zymo Research) and eluted into 40 μL nuclease-free water. The digested primary PCR product was then amplified at 50°C in a 20 μL reaction consisting of 0.25 μM each primer T7-AGG_fwd and 120 pA_rev, 1X Herculase II buffer, 25 mM each dNTP, 15 ng Luc2 primary amplification product, and 0.4 μL Herculase II enzyme. According to the manufacturer's protocol, this second PCR product was cleaned up using a DNA clean and concentrator-25 kit (Zymo Research) and eluted into nuclease-free water.

[0431] The primer sequences used are as follows:

[0432] Luc2_fwd:

[0433] CTTGTTCTTT TTGCAGAAGC TCAGAATAAA CGCTCAACTT TGGCCACCat ggaagatgccaaaaacatta agaagggc(SEQ ID NO:1)

[0434] Luc2_rev

[0435] AGAATGTGAA GAAACTTTCT TTTTATTAGG AGCAGATACG AATGGCTACA TTTTGGGGGACAACATTTTG TAAAGTGTAA GTTGGTATTA TGTAGCTTAG AGACTCCATT CGGGTGTTCT TGAGGCTGGTCTATCATTAc acggcgatct tgccgcc(SEQ ID NO:2)

[0436] T7-AGG_fwd:

[0437] gaattTAATACGACTCACTATAAGGcttgttctttttgcagaagc(SEQ ID NO:3)

[0438] 120pA_rev

[0439] TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT agaatgtgaagaaactttct ttttattag(SEQ ID NO:4)

[0440] In vitro transcription (IVT) of Luc2 RNA for A549 assay: Luc2 RNA was synthesized in a 20 μL IVT reaction consisting of 200 ng Luc2 T7 template, 20 mM MgCl2, 7.5 mM each natural NTP or 2-O-acetyl NTP, 7.5 mM CleanCap AG (TriLink), 1X HiScribe transcription buffer, and 2 uL HiScribe polymerase mix (NEB) and incubated at 37°C for 4 hours.

[0441] All IVT products were cleaned up using the Monarch 500 μg RNA cleanup kit (NEB) and eluted into 88 μL of nuclease-free water. The eluted products were then digested in a 100 μL reaction consisting of 1X DNase I buffer and 10 U DNase I (RNase-free) (New England Biolabs) at 37°C for 5 minutes to degrade the DNA template. DNase I treated samples were cleaned up using the Monarch 500ug RNA cleanup kit (New England Biolabs) and eluted into 88 μL of nuclease-free water.

[0442] The DNAse I-treated product, which had the Cap 1 structure co-transcriptionally added, was treated with 1X DNase I buffer (NEB) and 100 U calf intestinal alkaline phosphatase (CIAP) (Promega) at 37°C for 5 min as a polishing step to remove rare immunogenic 5' triphosphates from RNA transcripts that did not incorporate CleanCap AG. DNase I buffer was used in this enzymatic step because we found that CIAP enzyme performed better in DNAse I buffer for this RNA polishing step (unpublished data).

[0443] CIAP-treated RNA was cleaned up using the Monarch 500ug RNA Cleanup Kit (NEB) and eluted into 100uL of nuclease-free water.

[0444] RNA quantification: RNA concentration was determined using a NanoDrop OneC spectrophotometer (Thermo Scientific).

[0445] A549 cell culture method: A549-Dual (InvivoGen) was cultured in high-glucose GlutaMAX Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum, 100 units / mL penicillin, 100 μg / mL streptomycin, 10 μg / mL blasticidin, and 100 μg / mL zeocin, and maintained at 37°C and 5% CO. 2 Down.

[0446] Cells were plated at 2,000 cells / well in 96-well plates 1 day before transfection. 50 or 100 ng of each RNA was transfected using Lipofectamine MessengerMAX transfection reagent (ThermoFisher) using a 1:1.5 μg:uL RNA:MessengerMAX ratio. Transfections were performed in triplicate.

[0447] Vitality and luciferase expression were determined using ONE-Glo+Tox luciferase reporter gene and cell viability assay (Promega). According to the manufacturer's instructions, NF-κB activation was measured via SEAP reporter gene using QUANTI-Blue detection reagent (InvivoGen). According to the manufacturer's instructions, IRF pathway activation was measured via the activity of Lucia luciferase gene using QUANTI-Luc detection reagent (InvivoGen).

[0448] In vitro transcription (IVT) of Luc2 RNA for in vivo studies: For 2-O-acetylated Luc2 mRNA, mRNA was synthesized in a 20 μL IVT reaction consisting of 200 ng Luc2 T7 template, 20 mM MgCl2, 7.5 mM of each 2-O-acetyl NTP, 7.5 mM CleanCap AG (TriLink), 1X HiScribe transcription buffer, and 2 uL HiScribe polymerase mix (NEB) and incubated at 37°C for 4 hours.

[0449] For N1-methylpseudouridine-modified Luc2 mRNA, mRNA was synthesized in a 20 μL IVT reaction consisting of 200 ng Luc2 T7 template, 20 mM MgCl2, 7.5 mM each NTP (N1-methylpseudouridine triphosphate completely replaced uridine triphosphate), 7.5 mM CleanCap AG (TriLink), 1X HiScribe transcription buffer, and 2 uL HiScribe polymerase mix (NEB), and incubated at 37°C for 4 hours.

[0450] All IVT products were cleaned up using the Monarch 500 μg RNA cleanup kit (NEB) and eluted into 88 μL of nuclease-free water. The eluted products were then digested in a 100 μL reaction consisting of 1X DNase I buffer and 10 U DNase I (RNase-free) (New England Biolabs) at 37°C for 5 minutes to degrade the DNA template. DNase I treated samples were cleaned up using the Monarch 500ug RNA cleanup kit (New England Biolabs) and eluted into 88 μL of nuclease-free water.

[0451] The DNAse I-treated product, which had the Cap 1 structure co-transcriptionally added, was treated with 1X DNase I buffer (NEB) and 100 U calf intestinal alkaline phosphatase (CIAP) (Promega) at 37°C for 5 min as a polishing step to remove rare immunogenic 5' triphosphates from RNA transcripts that did not incorporate CleanCap AG. DNase I buffer was used in this enzymatic step because we found that CIAP enzyme performed better in DNAse I buffer for this RNA polishing step (unpublished data).

[0452] The IVT product was cleaned up using the Monarch 500 μg RNA Cleanup Kit (NEB) and eluted into 100 μL 1 mM sodium citrate, pH 6.5 (ThermoFisher).The IVT product was cleaned up using the Monarch 500 μg RNA Cleanup Kit (NEB) and eluted into 100 μL 1 mM sodium citrate, pH 6.5 (ThermoFisher).

[0453] RNA quantification: RNA concentration was determined using a NanoDrop OneC spectrophotometer (Thermo Scientific).

[0454] mRNA-LNP preparation.Use Ignite microfluidic mixer (Precision Nanosystems, Vancouver, BC) to prepare the preparation (mRNA-LNP) of mRNA in lipid nanoparticles.In brief, using the preparation parameters recommended by the manufacturer, GenVoy-ILM lipid mixture (PrecisionNanosystems NWW0042) is diluted to 12.5mM in absolute ethanol, and merged with the mRNA aqueous solution (0.14mg / mL) in PNI buffer (Precision Nanosystems NWW0043).Immediately, the preparation is diluted with 30:1 in phosphate buffered saline (Gibco 10010023), concentrated and adjusted to the final volume estimated using PBS using Amicon centrifugal filter (MilliporeSigma UFC901008).Next, on Stunner UV-VIS / DLS instrument (Unchained Labs), the preparation is characterized, and then further diluted to accurate payload concentration (ug / mL) with PBS as needed. The formulations were stored at 4°C until in vivo administration.

[0455] mRNA administration studies in mice. Animal experiments were performed according to the guidelines set forth by the Charles River Accelerator Development Lab (CRADL, Cambridge, MA, USA) and approved by the CRADL Institutional Animal Care and Use (IACUC) committee. Female BALB / C mice (7-9 weeks old) were purchased from Charles River Laboratories (Wilmington, MA, USA) and housed at CRADL. Mice (n=5 in each case) were acclimated for at least 2 days before the start of the study. For single administration studies ( Figure 6 ), animals received one IM mRNA-LNP administration. At three time points after mRNA injection (about 6 hours, about 24 hours and about 48 hours after administration), mice were imaged via whole-body bioluminescence imaging. All mRNA injections consisted of 50uL mRNA-LNP preparations (1ug Luc2 mRNA dosage per animal), delivered via left IM injection. For whole-body bioluminescence imaging, 10 minutes before the imaging time point, animals were injected with 200uL of D-luciferin K+ salt (PerkinElmer122799) diluted to 15mg / mL in PBS via intraperitoneal (IP) injection. Three minutes before imaging, mice were placed in an induction chamber under 3% isoflurane anesthesia, and then moved to an isoflurane delivery nose cone (nosecone) in an imaging chamber (IVIS-Spectrum model 124262; Perkin Elmer, Waltham, MA) immediately before imaging. The left side of the mouse was placed in the imaging chamber facing up, and 3% isoflurane was maintained throughout the imaging process. Images were acquired using field of view D and exposure was continued until 30,000 photons were collected or 1 min had elapsed, whichever occurred first. After imaging, animals were returned to their home cages to recover.

[0456] result: Fig.62A and 62B The reporter gene expression of fully 2-O-acetylated RNA delivered by LNP was shown to be comparable to that of RNA modified with N1-methylpseudouridine, a modification commonly used in RNA therapeutics. The reporter gene expression levels of both RNAs were comparable at 6, 24, and 48 hours after administration. These data suggest that 2-O-acetylated RNA has similar in vivo persistence compared to the in vivo persistence of RNA modified with N1-methylpseudouridine.

[0457] This result was unexpected for several reasons, one being that in vitro data showed residual IRF and NK-κB signaling from 2-O-acetylated RNA without base modifications (Examples 1 and Figure 4-5 ). Because IRF and NF-kB activity can lead to upregulation of nucleases in antiviral responses, and the reporter gene expression levels seen with 2-O-acetylated RNA were similar to those seen with RNA modified with N1-methylpseudouridine, without wishing to be bound by any particular theory, this data suggests that the use of 2-O-acetylated NTPs for in vitro transcription can provide RNA with increased persistence, e.g., increased resistance to nuclease degradation.

[0458] In some embodiments, 2-O-acetylated derivatives of NTPs with known base modifications are used for in vitro transcription, which can provide RNA with increased persistence compared to mRNA modified with commonly used N1-methyl pseudouridine. Without wishing to be bound by any particular theory, polyribonucleotides with increased persistence can be achieved by combining reduced immunogenicity from base modifications (e.g., Ac4C, 5hmU, N1-methyl pseudouridine, etc.) and nuclease resistance from ribosome-compatible backbone modifications (e.g., 2-O ribose acetylation as described herein).

[0459] Example 3: Synthesis of 2-O-acetylated NTP

[0460] This example describes an exemplary synthesis of the 2-O-acetylated NTPs used in Examples 1 and 2 and disclosed herein. Figure 6-61 Exemplary structures generated using the synthetic methods disclosed below are provided.

[0461] Solvents and reagents were purchased from Sigma-Aldrich, VWR or Fisher Scientific and used without further purification. Substrates were purchased from Combi-blocks and used without further purification. Reactions were monitored by thin layer chromatography (TLC) or by analytical liquid chromatography-mass spectrometry (LC-MS) using a Waters Acquity UltraPerformance LC system and a Synapt high-definition mass spectrometer. 1H NMR and 31P NMR spectra were recorded on a Varian Unity INOVA spectrometer (300 MHz). All chemical shifts are reported in ppm and coupling constants J are reported in Hertz (Hz). NMR solvent peaks are referenced as follows: (1H NMR) CDCl3: 7.27 ppm, DMSO-d6: 2.50 ppm, D2O: 4.65 ppm. Compounds were purified by flash column chromatography on a Teledyne ISCO Combi-Flash system using normal phase silica gel (SiliCycle Inc.) or reverse phase (Teledyne Gold-C18 or C18Aq) prepacked columns and an AKTA avant chromatography system on a HiTrap TM Purification on DEAE FF prepacked column. The purity of the compound was determined by analytical HPLC (Waters Acquity Ultra Performance) using an Acquity UPLC CSH C18 1.7 μm (50 mm × 2.1 mm) column and a flow rate of 0.3 mL / min. Gradient conditions: solvent A (0.05% formic acid in water) and solvent B (0.05% formic acid in acetonitrile): 0–0.1 min 95% A, 0.1–4.0 min 5–95% B (linear gradient), 4.0–5.0 min 95% B, UV detection at 254 nm and 220 nm and Waters Spherisorb, SAX column 5μm 4.6mm×250mm.

[0462] Synthesis of TIPD Silyl-Protected Cytidine (2)

[0463]

[0464] Scheme 1. Synthesis of silyl-protected cytidine 2

[0465] Cytidine 1 (3.0 g, 12.34 mmol) is dissolved in pyridine and co-evaporated (3 × 30 mL) to a white suspension. Co-evaporated substrate 1 is dissolved in pyridine (40 mL), followed by addition of 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (TIPDSCl2) (4.3428 mL, 13.575 mmol) and 4-dimethylaminopyridine (DMAP) (0.7539 g, 6.171 mmol). The reaction mixture is stirred at room temperature for about 24 h and monitored by TLC. Once the starting material is not detected, the mixture is diluted with CH2Cl2 (25 mL). The resulting solution is transferred to a separatory funnel and washed with water (1 × 25 mL). The aqueous layer is then extracted with additional CH2Cl2 (2 × 25 mL). The organic layers were combined, washed with brine, and dried over MgSO4 to provide crude silyl-protected 2 as a white solid, and purified by silica gel flash chromatography (CH2Cl2 / CH3OH, 5% modified with Et3N) to yield 2 (3.91 g, 65%). TLC (CH2Cl2:CH3OH=95 / 5, v / v): Rf=0.75. 1H NMR (300 MHz, DMSO-d6, δ): 7.69 (d, 3J=7.4 Hz, 1H), 7.15 (d, 3J=13.0 Hz, 2H), 5.63 (t, 3J=5.9 Hz, 2H), 5.52 (s, 1H), 4.16-3.85 (m, 5H), 1.04-0.94 (m, 28H). MS (ESI+, 100% CH3OH, TOF): m / z calculated value [C21H40N3O6Si2]+[M+H]+ 486.2450; found value 486.2000.

[0466] Synthesis of diacetylated silyl-protected cytidine 3

[0467]

[0468] Scheme 2. Synthesis of diacetylated silyl-protected cytidine 3

[0469] In an oven-dried RBF (25 mL), cytidine 2 (0.2 g, 0.412 mmol) was dissolved in anhydrous CH 3 CN (10mL) to form a white emulsion. Add 4-dimethylaminopyridine (DMAP) (0.2518g, 2.061mmol), then add acetyl chloride (AcCl) (29.3μl, 4.122mmol). The solution is dissolved and the reactant is stirred for 10min under argon and room temperature. Once the reaction is complete, the reaction mixture is concentrated and the crude material is dissolved in dichloromethane (CH 2 Cl 2(25 mL). The resulting solution was transferred to a separatory funnel and washed with water (1×25 mL). The aqueous layer was then washed with additional CH 2 Cl 2 (2×25 mL). The organic layers were combined, washed with brine, and purified by MgSO 4 Drying provided crude silyl protected 3 as a white solid. The residue was purified by flash column chromatography (ethyl acetate / methanol 9:1) to give major fraction compound 3 in 82% yield and minor compound 4 in 18% yield. TLC (ethyl acetate: CH 3 OH=9 / 1, volume / volume):Rf=0.90; 1 H NMR (300 MHz, DMSO-d 6 ,δ):10.94(s,1H),8.01(d, 3 J=7.6Hz,1H),7.18(d, 3 J=7.5Hz,1H),5.68(s,1H),5.44(d, 3 J=5.1Hz,1H),4.41–4.37(m,1H),4.16–4.10(m,1H),3.94–3.89(m,2H),2.06(s,6H),0.93(m,27H). MS(ESI + ,100%CH 3 OH,TOF): m / z calculated value [C 25 H 44 N 3 O 8 Si 2 ] + [M+H] + 570.2661; measured value 570.2802.

[0470] Synthesis of mono-2'O-acetylated silyl-protected cytidine 4

[0471]

[0472] Scheme 3. Synthesis of mono-2'O-acetylated silyl-protected cytidine 4

[0473] Alternatively, compound 4 was synthesized as follows. Cytidine 2 (0.2 g, 0.412 mmol) was dissolved in anhydrous CH 3CN (10mL) and form a white emulsion.Add 4-dimethylaminopyridine (DMAP) (0.2518g, 2.061mmol), then add acetyl chloride (AcCl) (29.3μl, 4.122mmol).The solution is dissolved and the reactant is stirred for 3h under argon and room temperature.Once the starting material is not observed, the reaction mixture is concentrated, and the crude material is dissolved in dichloromethane, CHCl and 4% HCl. 2 Cl 2 (25 mL). The resulting solution was transferred to a separatory funnel and washed with water (1×25 mL). The aqueous layer was then washed with additional CH 2 Cl 2 (2×25 mL). The organic layers were combined, washed with brine, and purified by MgSO 4 Drying provided the crude silyl protected product as a white solid. The residue was purified by flash column chromatography (ethyl acetate / methanol 9:1) to yield the major fraction compound 4 (yield 63%) and minor compounds 3 (yield 13%) and 5 (yield 18%). TLC (ethyl acetate: CH 3 OH = 9 / 1, volume / volume): Rf = 0.54; 1 H NMR (300 MHz, DMSO-d 6 ,δ):10.86(s,1H),8.09(d, 3 J=7.3Hz,1H),7.16(d, 3 J=7.3Hz,1H),5.74–5.71(m,1H),5.55–5.53(m,1H),4.20–4.13(m,1H), 4.02–3.94(m,3H),3.94–3.86(m,1H),2.05(s,3H),1.02–0.91(m,31H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 23 H 42 N 3 O 7 Si 2 ] + [M+H] + 528.2556; measured value 528.2685.

[0474] Synthesis of N-Ac,2'-OAc Cytidine 6

[0475]

[0476] Scheme 4. Synthesis of N,O-diacetylated cytidine 6 (forming a mixture of 2'-OAc and 3'-OAc regioisomers)

[0477] Cytidine 3 (1.2 g, 2.11 mmol) was dissolved in anhydrous methanol (21 mL) in an oven-dried RBF (25 mL). Acetic acid (0.277 mL, 4.85 mmol) and ammonium fluoride (NH4F) were added to the solution. 4 The reaction mixture was stirred at room temperature for 48 h. Once the starting material was not observed, the reaction mixture was concentrated, and the crude material was dry loaded onto silica. The compound was purified by flash column chromatography (ethyl acetate / methanol 9: 1) to produce compound 6 (0.352 g, 51%) as a white solid. 1 H NMR (300 MHz, DMSO-d 6 ,δ):(mixture of 2'-OAc and 3'-OAc regioisomers)10.91(s,1.2H),8.41–8.32(m,1.4H),7.20–7.14(m,1.4H),5.91(d, 3 J=3.8Hz,0.4H),5.82(d, 3 J=4.8Hz,1H),5.13(t, 3 J=4.5Hz,0.4H),4.98(t, 3 J=5.0Hz,1H),4.26(t, 3 J=4.9Hz,1H),4.18(t, 3 J=5.6Hz,0.4H),4.09(dt, 3 J=4.8, 4 J=2.5Hz,1H),3.89–3.87(m,0.5H),3.69(m,1.4H),3.59–3.51(m,1.4H),2.06(m,8.4H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 13 H 18 N 3 O 7 ] + [M+H] + 328.1139; measured value 328.2317.

[0478] Synthesis of monoacetylcytidine 7

[0479]

[0480] Scheme 5. Synthesis of monoacetylcytidine 7

[0481] Cytidine analog 4 (0.61 g, 1.16 mmol) was dissolved in anhydrous methanol (12 mL) in oven-dried RBF (25 mL). Acetic acid (0.153 mL, 2.68 mmol) and ammonium fluoride (NH4F) were added to the solution. 4 F (0.095 g, 2.56 mmol). The reaction was stirred at room temperature for 48 h. Once no starting material was observed, the reaction mixture was concentrated and the crude material was dry loaded onto silica. The compound was purified by flash column chromatography (ethyl acetate / methanol 9:1) to produce compound 7 as a white solid (0.216 g, 46%) 1 H NMR (300 MHz, DMSO-d 6 ,δ):(mixture of 2'-OAc and 3'-OAc regioisomers)7.81(t, 3 J=8.0Hz,1.8H(signal overlap)),7.26–7.11(m,4H),5.95(d, 3 J=5.1Hz,0.3H),5.81(d, 3 J=5.9Hz,1H),5.72(m,2.3H),5.61(d, 3 J=5.7Hz,1H),5.05–4.98(m,2H),4.21(m,1.3H),4.04–3.97(m,2H),3.91(d, 3 J=3.1Hz,1H),3.84–3.79(m,1H),3.65–3.50(m,4H),2.06(s,3H),2.03(s,1H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 11 H 16 N 3 O 6 ] + [M+H] + 286.1034; measured value 286.1571.

[0482] Triphosphorylation of Cytidine Derivatives

[0483]

[0484] Scheme 6. Triphosphorylation and salt exchange to form diacetylated cytidine triphosphate sodium salt 9.

[0485] Method adapted from the literature (see Kore, AR; et al. Curr. Protoc. Nucleic Acid Chem. 2012, Unit 13.10). In a dried vial, tributylammonium pyrophosphate (0.143 g, 0.26 mmol) was dissolved in anhydrous acetonitrile (1.1 mL). Tributylamine (0.44 mL, 1.83 mmol) was added and the mixture was kept at -20 ° C. Cytidine derivative 6 (0.10 g, 0.31 mmol) was added to a separate dried, argon-filled round-bottom flask equipped with a stirring bar and dissolved in trimethyl phosphate (1.4 mL). The reaction mixture was evacuated, refilled with argon three times, and stirred at room temperature for 10 min. The RBF / vial was cooled in an ice bath (5 ° C to 0 ° C) and stirred for 30 min. The first portion of phosphorus oxychloride (20 μl, 0.21 mmol) was added and stirred for 10 min. A second portion of phosphorus oxychloride (20 μl, 0.21 mmol) was added and stirred for 35 min. The pyrophosphate solution was then added dropwise to the mixture, the flask was cooled with an ice / NaCl bath (-5°C to -10°C) and stirred for 15 min. The septum was removed and water (7.3 mL) was added dropwise to the mixture. The solution was transferred to a separatory funnel and the aqueous layer was separated with CH 2 Cl 2 The product was purified by HPLC.(3 × 2mL) extraction, and the organic layer was discarded. The pH of the aqueous layer was adjusted to 6.5 using ammonium hydroxide, and stored overnight at 4 ° C. The pH of the solution was rechecked and readjusted if necessary. The compound was purified on an AKTA purification system. The column was connected to an AKTA purifier equipped with a programmable gradient pump system and a UV detector, and washed with water, 2.0M NaCl and then washed with water. The product solution was loaded onto the column at a flow rate of 75ml / min, and UV detection was performed at 254nm. The column was eluted with a linear gradient of 0 to 1M triethylammonium bicarbonate (TEAB) buffer. Appropriate fractions were analyzed by analytical HPLC using mobile phase A and mobile phase B. 10 μl fractions were injected through a 5 μM Hypersil SAX column (4.6mm × 25cm) at a flow rate of 1.0mL / min, using the following gradient conditions:

[0486] 0% to 50% mobile phase B in 5 min

[0487] 50% to 75% mobile phase B within 5 min

[0488] 75% to 100% mobile phase B in 2 min

[0489] 100% mobile phase B for 2 min

[0490] 100% to 0% mobile phase B in 2 min.

[0491] The appropriate fractions containing phosphate were combined and concentrated (35°C to 38°C water bath and vacuum 1 to 10 mm). The residue was co-evaporated with water (3 x 2 ml) and dried under vacuum overnight. The triethylamine salt of cytidine triphosphate was dissolved in water (2.6 mL).

[0492] Sodium perchlorate (0.422 g, 3.46 mmol) was dissolved in acetone (7.6 mL) in a centrifuge bottle, and the CTP solution was added dropwise to the sodium perchlorate / acetone solution over a period of 5 min. The resulting mixture was centrifuged at 704 × g, 4 ° C for 10 min, and the supernatant was discarded. The resulting pellet was dried under vacuum for 1 hour, dissolved in water (2.6 mL), dissolved in sodium perchlorate / acetone solution, and the centrifugation process was repeated. The resulting solid was dried overnight under high vacuum at ambient temperature and weighed to produce CTP 9 sodium salt (0.027 g, 14%) as a white solid. 1 H NMR (300 MHz, D 2 O,δ):(regioisomer mixture)8.23(d, 3 J=7.4Hz,1H),7.77(d, 3 J=7.6Hz,1H),7.20(d, 3 J=7.7Hz,1H),5.97–5.94(m,1H),5.83–5.80(m,2H),4.23–4.10(m,11H),2.07–2.03(m,6H). 31 P NMR (121MHz, D 2 O,δ):-5.49(d, 3 J=16.1Hz,1P),-10.68(dd, 3 J=15.7, 4 J=7.4Hz,1P),-19.13–-19.62(m,1P).

[0493] Triphosphorylation of 2'-O-acetyl-cytidine

[0494]

[0495] Scheme 7. Triphosphorylation and salt exchange to form 2'-O-acetylcytidine triphosphate sodium salt 11 (mixture of 2'-OAc and 3'-OAc regioisomers)

[0496] General procedure for triphosphorylation Error! Bookmark not defined. Carry out as described above in the ratio described. In a dried vial, tributylammonium pyrophosphate (0.164g, 0.30mmol) is dissolved in anhydrous acetonitrile (1.3mL) and tributylamine (0.50mL, 2.10mmol) and the mixture is stored at -20°C. Cytidine derivative (0.10g, 0.35mmol) is added to a dried, argon-filled round-bottom flask or vial equipped with a stirring rod, and dissolved in trimethyl phosphate (1.60mL). The reaction mixture is evacuated and refilled with argon three times. The reaction mixture is stirred at room temperature for 10min. The RBF / vial is cooled in an ice bath (5°C to 0°C), and stirred for 30min. Add the first portion of phosphorus oxychloride (22.9μl, 0.25mmol), and stir for 10min. A second portion of phosphorus oxychloride (22.9 μl, 0.25 mmol) was added to the vial and stirred for 35 min. The pyrophosphate solution was added to the mixture. The flask was cooled with an ice / NaCl bath (-5°C to -10°C) and stirred for 15 min. The septum was removed and water (7.3 mL) was added dropwise to the mixture. The solution was transferred to a separatory funnel and the aqueous layer was separated with CH 2 Cl 2 (3 x 2 mL) and the organic layer was discarded. The pH of the aqueous layer was adjusted to 6.5 using ammonium hydroxide. Purification and salt exchange were performed as described in the above procedure to give 11 (0.025 g, 14%) as a white solid. 1 H NMR (300 MHz, D 2 O,δ):7.82(d, 3 J=7.56Hz,1H),5.97(d, 3 J=7.7Hz,1H),5.84(d, 3 J=4.4Hz,1H),4.28–4.24(m,1H),4.16(t, 3 J=4.75Hz,1H),4.11–4.05(m,4H),2.06–2.02(m,3H). 31 P NMR (121 MHz; D 2 O,δ):-7.55–-7.86(m,1P),-11.30(d, 3 J=19.1Hz,1P),-22.36(m,1P).

[0497] TIPDSi protection of uridine

[0498]

[0499] Scheme 8. Synthesis of silyl-protected uridine 13

[0500] Uridine 12 (3.0 g, 12.30 mmol) was dissolved in pyridine and co-evaporated (3 x 30 mL) to a white suspension. The co-evaporated substrate 12 was dissolved in pyridine (40 mL) and TIPDSCl was added. 2 (4.260 mL, 13.52 mmol) and DMAP (0.7508 g, 6.14 mmol). The reaction mixture was stirred at room temperature for about 24 h and monitored by TLC. Once no starting material was detected, CH 2 Cl 2 The mixture was diluted with 4% paraformaldehyde (25 mL). The resulting solution was transferred to a separatory funnel and washed with water (1×25 mL). The aqueous layer was then washed with additional CH 2 Cl 2 (2×25 mL). The organic layers were combined, washed with brine, and purified by MgSO 4 Drying provided crude silyl protected 13 as a white solid which was purified by flash chromatography on silica gel (CH 2 Cl 2 / CH 3 OH, with 5% Et 3 N modified) was purified with a yield of 3.67 g, 61%. Compound 13 was stored at -20°C until use. TLC (CH 2 Cl 2 :CH 3 OH=95 / 5, volume / volume):Rf=0.75; 1 HNMR (300 MHz, DMSO-d 6 ,δ):11.36(s,1H),8.54(dd, 3 J=5.8, 4 J=1.7Hz,1H),7.66(d, 3 J=8.1Hz,1H),5.60(d, 3 J=4.4Hz,1H),4.12–4.07(m,4H),3.96–3.85(m,3H),1.01(d, 3 J = 3.9 Hz, 36H). MS (ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 21 H 39 N 2 O 7 Si 2 ] + [M+H] + 487.2290; measured value 487.3135.

[0501] Acetylation of Silyl-Protected Uridine

[0502]

[0503] Scheme 9. Synthesis of 2'-O-acetylsilyl-protected uridine 14

[0504] In an oven-dried RBF (25 mL), uridine 13 (2.0 g, 4.11 mmol) was dissolved in anhydrous CH 3 CN (40mL) and form a white emulsion.Add DMAP (1.16g, 9.46mmol), then add acetyl chloride AcCl (0.67mL, 9.46mmol).The solution is dissolved and the reactant is stirred for 35min under argon and room temperature.Once the reaction is completed (no starting material is detected), the reaction mixture is concentrated, and the crude material is dissolved in dichloromethane (CH 2 Cl 2 (25 mL). The resulting solution was transferred to a separatory funnel and washed with water (1×25 mL). The aqueous layer was then washed with additional CH 2 Cl 2 The organic layers were combined, washed with brine, and purified by MgSO 4 Drying provided the crude silyl protected 14 as a white solid. The residue was purified by flash column chromatography (ethyl acetate / methanol 9:1) to give the major compound 14 in good yield (1.88 g, 87%) TLC (ethyl acetate: CH 2 Cl 2 =1 / 1, volume / volume): Rf=0.75; 1 H NMR (300 MHz, DMSO-d 6 ,δ):11.40(s,1H),7.64(d, 3 J=8.1Hz,1H),5.63(d, 3 J=1.4Hz,1H),5.56(dd, 3 J=8.0, 4 J=2.0Hz,1H),5.49(dd, 3 J=5.7, 4 J=1.3Hz,1H),4.53(dd, 3 J=8.4, 4 J=5.8Hz,1H),4.04(m,1H),3.91(m,1H),3.81(dt, 3 J=7.8, 4 J=3.7Hz,1H),2.05(s,3H),1.02-0.93(m,28H). MS(ESI+ ,100%CH 3 OH,TOF): m / z calculated value [C 23 H 40 N 2 NaO 8 Si 2 ] + [M+Na] + 551.2215; measured value 551.2078

[0505] Silyl deprotection of acetylated uridine

[0506]

[0507] Scheme 10. Synthesis of 2'O-acetyluridine 15

[0508] Compound 14 (1.2 g, 2.27 mmol) was dissolved in anhydrous methanol (22 mL) in an oven-dried RBF (25 mL). Acetic acid (0.299 mL, 5.22 mmol) was added to the solution, followed by NH 4 The reaction mixture was stirred at room temperature for 48 h. Once the starting material was not observed, the reaction mixture was concentrated, and the crude material was dry loaded onto silica. The compound was purified by flash column chromatography (ethyl acetate / methanol 9: 1) to produce compound 15 (mixture of 2'-OAc and 3'-OAc regioisomers) as a white solid (0.222 g, 34%). 1 HNMR (300 MHz, DMSO-d 6 ,δ):11.37(s,1.4H),7.87(d, 3 J=12.2,d, 3 J = 8.1 Hz, (two overlapping doublets) 1.6H), 5.96 (d, 3 J=5.9Hz,0.6H),5.79(d, 3 J=6.8Hz,1H),5.74–5.64(m,2.6H),5.51(d, 3 J=5.4Hz,0.6H),5.27(t, 3 J=5.0Hz,1H),5.20(t, 3 J=4.8Hz,0.6H),5.11–5.06(m,1.6H),4.22(dq, 3 J=11.5, 4J=5.7Hz,1.6H),4.04–3.97(m,1.6H),3.87(m,0.6H),3.66–3.51(m,3H),2.07(s,3H),2.03(s,1.7H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 11 H 14 N 2 NaO 7 ] + [M+Na] + 309.0693; measured value 309.2410

[0509] Triphosphorylation of uridine derivatives

[0510]

[0511] Scheme 11. Triphosphorylation and salt exchange, synthesis of 2'-O-acetyluridine triphosphate sodium salt 17

[0512] Method adapted from literature. Error! Bookmark not defined. In a dried vial, dissolve tributylammonium pyrophosphate (0.114 g, 0.21 mmol) in anhydrous CH 3 CN (0.90mL). Tributylamine (0.35mL, 1.47mmol) is added and the mixture is stored at -20°C. Uridine derivative 15 (0.07g, 0.25mmol) and proton sponge (0.052g, 0.25mmol) are added to a separate drying, argon-filled round-bottom flask or vial equipped with a stirring rod, and dissolved in trimethyl phosphate (0.84mL). The reaction mixture is evacuated and refilled with argon three times. The reaction mixture is stirred at room temperature for 10min, then the RBF / vial is cooled in an ice / NaCl bath (-5°C to -10°C), and stirred for 30min. The first portion of phosphorus oxychloride (13.5μl, 0.14mmol) is added, and stirred for 5min. The second portion of phosphorus oxychloride (9.3μl, 0.10mmol) is added, and stirred for 10min. Then a cold pyrophosphate solution is added and stirred for 10min. The septum was removed and water (7.3 mL) was added dropwise to the mixture. The solution was transferred to a separatory funnel and the aqueous layer was washed with CH 2 Cl 2 (3 x 2 mL) and the organic layer was discarded. The pH of the aqueous layer was adjusted to 6.5 using ammonium hydroxide. Purification and salt exchange were performed as described in the general procedure above to give 17 (4.2 mg, 3%) as a white solid. 1 H NMR (300 MHz, D 2O,δ):7.81(d, 3 J=8.4Hz,2H),5.83–5.78(m,3H),4.30–4.21(m,3H),4.08(m,4H),3.50(d, 3 J=11.4Hz,1H),2.05(s,3H). 31 P NMR (121MHz, D 2 O,δ):-6.18(m,1P),-11.17(m,1P),-21.68(s,1P).

[0513] TIPDSi protection of adenosine

[0514]

[0515] Scheme 12. Synthesis of silyl-protected adenosine 19

[0516] Into a 100 mL round bottom flask, adenosine 18 (0.3 g, 1.12 mmol) was dissolved in pyridine and co-evaporated (3 x 5 mL) to a white suspension. The co-evaporated substrate 18 was dissolved in pyridine (4 mL) and TIPDSCl was added. 2 (0.40 mL, 1.25 mmol) and DMAP (0.0686 g, 0.561 mmol). The reaction mixture was stirred at room temperature for about 23 h and monitored by TLC. Once no starting material was detected, CH 2 Cl 2 The mixture was diluted with 4% paraformaldehyde (25 mL). The resulting solution was transferred to a separatory funnel and washed with water (1×25 mL). The aqueous layer was then washed with additional CH 2 Cl 2 The organic layers were combined, washed with brine, and purified by MgSO 4 Drying provided crude silyl protected 19 as a white solid which was purified by silica gel flash chromatography (CH 2 Cl 2 / CH 3 OH, 5%, 0.05% Et 3 N) purification, yield (0.885 g, 76%). Compound 19 was stored at -20°C until use. 1 H NMR (300 MHz, DMSO-d 6 ,δ):8.19(s,1H),8.05(s,1H),5.85(s,1H),5.63(d, 3 J=4.6Hz,1H),4.79–4.75(m,1H),4.49(t, 3J=4.7Hz,1H),4.06–3.88(m,3H),1.02(s,28H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 22 H 40 N 5 O 5 Si 2 ] + [M+H] + 510.2563; measured value 510.3010.

[0517] Acetylation of silyl-protected adenosine

[0518]

[0519] Scheme 13. Synthesis of 2'-OAc-adenosine 20

[0520] In an oven-dried RBF (25 mL), adenosine 19 (5.83 g, 11.44 mmol) was dissolved in anhydrous CH 3 CN (100mL) and form a white emulsion.Add 4-dimethylaminopyridine DMAP (3.214g, 26.31mmol), then add acetyl chloride AcCl (1.3mL, 18.30mmol).The solution is dissolved and the reactant is stirred for 1.5h under argon and room temperature.Once the reaction is complete, the reaction mixture is concentrated and the crude material is dissolved in dichloromethane (CH 2 Cl 2 (25 mL). The resulting solution was transferred to a separatory funnel and washed with water (1×25 mL). The aqueous layer was then washed with additional CH 2 Cl 2 The organic layers were combined, washed with brine (1×25 mL), and purified by MgSO 4 Drying provided crude silyl protected 20 as a white solid. The residue was purified by flash column chromatography (CH 2 Cl 2 / CH 3 OH, with 5% Et 3 N modified) to produce the main fraction compound 20, yield (5.567 g, 88%) TLC (CH 2 Cl 2 / CH 3 OH, with 5% Et 3 N modification, volume / volume): 1 H NMR (300 MHz, DMSO-d 6,δ):8.23(s,1H),8.02(s,1H),7.39(s,2H),6.07(s,1H),5.86(dd, 3 J=5.8, 4 J=1.0Hz,1H),5.24(dd, 3 J=8.4, 4 J=5.8Hz,1H),4.01–3.87(m,3H),2.08(s,3H),1.04–0.93(m,36H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 24 H 42 N 5 O 6 Si 2 ] + [M+H] + 552.2668; measured value 552.2981.

[0521] Silyl deprotection of acetylated adenosine

[0522]

[0523] Scheme 14. Synthesis of 2'-OAc adenosine 21

[0524] In an oven-dried RBF (50 mL), adenosine derivative 20 (0.50 g, 0.906 mmol) was dissolved in anhydrous methanol (10 mL). Acetic acid (1.2 mL, 2.08 mmol) was added to the solution, followed by ammonium fluoride (NH4F4). 4 F (0.074 g, 1.99 mmol). The reaction was stirred at 70 °C for 6 h. Once no starting material was observed, the reaction mixture was concentrated and the crude material was concentrated, redissolved in water (1 x 15 mL), filtered through a plug of celite, and the plug was rinsed with water (3 x 15 mL). The compound was purified by aqueous reverse phase flash chromatography (H 2 O / CH 3 CN 7:3) to yield 21 (minor) (0.0258 g, 9%, mixture of 2'-OAc and 3'-OAc isomers) as a white solid and 22 (major) (0.064 g, 23%, mixture of 2'-OAc and 3'-OAc isomers) as a white solid.

[0525] (Minor peak on reverse phase chromatography): 1 H NMR (300 MHz, DMSO-d 6,δ):(mixture of 2'-OAc and 3'-OAc regioisomers); 8.36(s,1H),8.12(s,1H),7.39(s,2H),6.13(d, 3 J=6.4Hz,1H),5.61(m,2H),5.48(dd, 3 J=7.0, 4 J = 4.5 Hz, 1H), 4.95 (m, 0.04H, corresponding to 3'-OAc regioisomer) 4.44–4.41 (m, 1H), 3.98 (m, 1H), 3.70–3.65 (m, 1H), 3.58–3.52 (m, 1H), 2.10 (s, 0.1H), 2.00 (s, 3H). MS (ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 12 H 16 N 5 O 5 ] + [M+H] + 310.1146; measured value 310.1014.

[0526] (Main peak on reverse phase chromatography): 1 H NMR (300 MHz, DMSO-d 6 ,δ):(mixture of 2'-OAc and 3'-OAc isomers):8.36(s,1H),8.12(s,1H),7.41(s,2H),6.145(d, 3 J = 6.47, 0.04H corresponding to 2'-OAc isomer), 5.87 (d, 3 J=7.2Hz,1H),5.80(d, 3 J=5.7Hz,1H),5.67(dd, 3 J=7.5, 4 J=4.5Hz,1H),5.26(dd, 3 J=5.2, 4 J=1.9Hz,1H),4.86(q, 3 J=5.9Hz,1H),4.12(d, 3 J=2.1Hz,1H),3.67(dt, 3 J=12.2, 4 J=4.0Hz,1H),3.57(ddd, 3 J=11.8, 4 J=7.9, 4 J=3.6Hz,1H),2.10(s,3H). MS(ESI+ ,100% CH 3 OH,TOF): m / z calculated value [C 12 H 16 N 5 O 5 ] + [M+H] + 310.1146; measured value 310.1075.

[0527] Triphosphorylation of adenosine derivatives

[0528]

[0529] Scheme 15. Synthesis of 2'-O-acetyladenosine triphosphate sodium salt 24 via triphosphorylation and salt exchange procedure

[0530] Method adapted from literature. Error! Bookmark not defined. In a dried, argon-filled vial, tributylammonium pyrophosphate (0.109 g, 0.199 mmol) was dissolved in anhydrous acetonitrile (0.85 mL) and tributylamine (0.33 mL, 1.391 mmol) and the mixture was stored at -20 ° C. Adenosine derivative mixture 21 / 22 (2'-OAc / 3'-OAc isomers) (0.0725 g, 0.234 mmol) and tributylamine (0.11 ml, 0.467 mmol) were added to a dried, argon-filled round-bottom flask or vial equipped with a stirring bar and dissolved in trimethyl phosphate (1 mL). The reaction mixture was evacuated and refilled with argon three times. The reaction mixture was stirred at room temperature for 10 min. The RBF / vial was cooled in an ice / NaCl bath (-5 ° C to -10 ° C) and stirred for 30 min. Add the first portion of phosphorus oxychloride (26 μl, 0.278 mmol) and stir for 3 min. Add the second portion of phosphorus oxychloride (13 μl, 0.139 mmol) to the vial and stir for 5 min. Add the pyrophosphoric acid solution and stir for 10 min. Monitor the reaction on an HPLC-SAX column. Remove the septum and add water (5 mL) dropwise to the mixture. Transfer the solution to a separatory funnel and separate the aqueous layer with CH 2 Cl 2 The mixture was extracted with 4% paraformaldehyde (3×2 mL) and the organic layer was discarded. The pH of the aqueous layer was adjusted to 6.5 using ammonium. Purification was performed on an AKTA column, and the appropriate fractions containing phosphates were combined and concentrated in a water bath (35° to 38° C. and vacuum 1 to 10 mm). The resulting residue was co-evaporated with water (3×2 ml) and dried under vacuum overnight. The resulting triethylamine salt of cytidine triphosphate was dissolved in water (2.6 mL).

[0531] Sodium perchlorate (0.062 g, 0.508 mmol) was dissolved in acetone (2.5 mL) in a 15 mL centrifuge bottle, and the ATP solution was added dropwise to the sodium perchlorate / acetone solution over a period of 5 min. The resulting mixture was centrifuged at 704 × g, 4 ° C for 10 min, and the supernatant was discarded. The resulting pellet was dried under vacuum for 1 hour, and dissolved in water (2.6 mL), dissolved in sodium perchlorate / acetone solution, and the centrifugation process was repeated. The resulting solid was dried overnight under high vacuum at ambient temperature and weighed to produce ATP 24 sodium salt (30.8 mg, 21%) as a white solid. 1 H NMR (300 MHz, D 2 O,δ):8.34(d, 3 J=10.3Hz,2H),8.27(s,1H),8.03(d, 3 J=2.3Hz,2H),8.00(s,1H),6.07(dd, 3 J=4.1, 4 J=1.8Hz,1H),5.96(d, 3 J=7.6Hz,1H),5.92–5.90(m,1H),5.37–5.33(m,1H),5.30(dd, 3 J=5.4, 4 J=1.7Hz,2H),4.84–4.79(m,2H),4.58(dd, 3 J=3.5, 4 J=1.6Hz,2H),4.38–4.33(m,2H),4.18–4.16(m,2H),4.12–4.08(m,3H),4.08–4.03(m,2H),4.01–3.95(m,2H),2.00(d, 3 J=5.3Hz,15H),1.94(s,3H). 31 P NMR (121MHz, D 2 O,δ):-8.68–-9.23(m,1P),-11.41(d, 3 J=19.5Hz,1P),-22.73(t, 3 J=19.6 Hz, 1P). MS (ESI - ,100% CH 3 OH,TOF): m / z calculated value [C 12 H 17 N 5 O 14 P 3 ] - [MH] -547.9990; measured value 547.7838.

[0532] TIPDSi protection of guanosine

[0533]

[0534] Scheme 16. Synthesis of silyl-protected guanosine 26

[0535] Into a 100 mL round bottom flask, guanosine 25 (1.5 g, 5.30 mmol) was dissolved in pyridine and co-evaporated (3 x 15 mL) as a white suspension. The co-evaporated substrate 25 was dissolved in pyridine (19 mL) and TIPDSCl was added. 2 (1.86 mL, 5.83 mmol) and DMAP (0.323 g, 2.65 mmol). The reaction mixture was stirred at room temperature for about 23 h and monitored by TLC. Once no starting material was detected, CH 2 Cl 2 The mixture was diluted with 25 mL of ethyl acetate. Water was added and precipitation occurred. The mixture was filtered on a short celite plug to provide crude silyl protected 26 as a white solid in yield (1.3916 g, 50%). Compound 26 was stored at -20 °C until use. 1 H NMR (300 MHz, DMSO-d 6 ,δ)10.64(s,1H),7.75(s,1H),6.49(s,2H),5.65(s,1H),5.59(s,1H),4.33(dd, 3 J=8.0, 3 J=5.1Hz,1H),4.24–4.23(m,1H),4.06(dd, 3 J=12.6, 3 J=2.9Hz,1H),3.97(dt, 3 J=7.9, 4 J=2.8Hz,1H),3.90(m,1H),1.02-0.98(m,28H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 22 H 40 N 5 O 6 Si 2 ] + [M+H] + 526.2512; measured value 526.3105

[0536] Acetylation of silyl-protected guanosine

[0537]

[0538] Scheme 17. Synthesis of 2'-O-acetyl-silyl-protected guanosine 27

[0539] In an oven-dried RBF (25 mL), guanosine 26 (1.084 g, 2.062 mmol) was dissolved in anhydrous CH 3 CN (20mL) and form a white emulsion.Add 4-dimethylaminopyridine DMAP (0.58g, 4.742mmol), then add acetyl chloride (AcCl) (0.23mL, 3.299mmol).The solution is dissolved and the reactant is stirred for 30min under argon and room temperature.Once the reaction is completed (monitored by TLC), the reaction mixture is concentrated, and the crude material is dissolved in CH 2 Cl 2 (25 mL). The resulting solution was transferred to a separatory funnel and washed with water (2 x 25 mL). The aqueous layer was then washed with additional CH 2 Cl 2 (2×25 mL). The organic layers were combined, washed with brine, and purified by MgSO 4 Drying provided crude silyl protected 27 as a white solid. The residue was purified by flash column chromatography (CH 2 Cl 2 / CH 3 OH, with 5% Et 3 N modified) to give a white solid (0.9295 g, 79%) 1 HNMR (300 MHz, DMSO-d 6 ,δ):10.68(s,1H),7.86(s,1H),6.41(s,2H),5.85(s,1H),5.73(s,0.3H),5.57(d, 3 J=2.3Hz,1H),4.63(s,1H),4.01–3.91(m,3H),2.07(s,3H),1.00(m,32H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 24 H 42 N 5 O 7 Si 2 ] + [M+H] + 568.2617; measured value 568.3389

[0540] Silyl deprotection of acetylated guanosine

[0541]

[0542] Scheme 18. Synthesis of 2'-OAc-guanosine 28

[0543] In an oven-dried RBF (50 mL), guanosine analog 27 (0.7239 g, 1.275 mmol) was dissolved in anhydrous methanol (13 mL). Acetic acid (170 μL, 2.932 mmol) was added to the solution followed by ammonium fluoride (NH4F). 4 F (0.1039 g, 2.805 mmol). The reaction was stirred at room temperature for 72 h. Once no starting material was observed on TLC, the reaction mixture was concentrated and the crude material was concentrated, redissolved in water (1×25 mL), filtered through a celite plug, and the plug was rinsed with water (3×25 mL). The compound was purified by aqueous reverse-phase flash chromatography (H 2 O / CH 3 CN 7:3) to give major compound 28 (0.011 g, 23%) as a white solid and minor compound 28 (0.0047 g, 4%) as a white solid 1 H NMR (300 MHz, DMSO-d 6 ,δ):10.66(s,1H),7.94(s,1H),6.49–6.45(m,3H),5.77–5.75(m,1H),5.66(d, 3 J=7.2Hz,1H),5.26–5.21(m,1H),5.20(dt, 3 J=5.4, 4 J=2.7Hz,1H),4.69–4.62(m,1H),4.36(dt, 3 J=3.2, 4 J=1.5Hz,),4.03–4.00(m,1H),3.62–3.51(m,3H),2.08(s,3H),2.01(s,0.05H). MS(ESI + ,100% CH 3 OH,TOF): m / z calculated value [C 12 H 16 N 5 O 5 ] + [M+H] + 326.1095; measured value 326.1147

[0544] Triphosphorylation of Guanosine Derivatives

[0545]

[0546] Scheme 19. Triphosphorylation and salt exchange, synthesis of 2'-OAc guanosine triphosphate sodium salt 30

[0547] Method adapted from literature. Error! Bookmark not defined. In a dried vial, tributylammonium pyrophosphate (0.136 g, 0.249 mmol) was dissolved in anhydrous acetonitrile (1.3 mL) and tributylamine (0.41 mL, 1.740 mmol) and the mixture was stored at -20 ° C. Guanosine derivative (0.0954 g, 0.293 mmol) and tributylamine (0.21 ml, 0.87 mmol) were added to a dried, argon-filled round-bottom flask or vial equipped with a stirring rod and dissolved in trimethyl phosphate (1 mL). The reaction mixture was evacuated and refilled with argon three times. The reaction mixture was stirred at room temperature for 10 min. The RBF / vial was cooled in an ice / NaCl bath (-5 ° C to -10 ° C) and stirred for 30 min. The first portion of phosphorus oxychloride (35 μl, 0.373 mmol) was added and stirred for 3 min. A second portion of phosphorus oxychloride (23 μl, 0.249 mmol) was added to the vial and stirred for 5 min. The pyrophosphoric acid solution was added and stirred for 10 min. The reaction was monitored on an HPLC-SAX column. The septum was removed and water (5 mL) was added dropwise to the mixture. The solution was transferred to a separatory funnel and the aqueous layer was separated with CH 2 Cl 2 The mixture was extracted with 4% guanosine triphosphate (3×2 mL) and the organic layer was discarded. The pH of the aqueous layer was adjusted to 6.5 using ammonium hydroxide. Purification was performed on an AKTA column, and the appropriate fractions containing phosphates were combined and concentrated in a water bath (35° to 38° C. and vacuum 1 to 10 mm). The residue was co-evaporated with water (3×2 ml) and dried under vacuum overnight. The triethylamine salt of guanosine triphosphate was dissolved in water (2.6 mL).

[0548] Sodium perchlorate (0.0954 g, 0.781 mmol) was dissolved in acetone (3 mL) in a 15 mL centrifuge bottle, and the GTP solution was added dropwise to the sodium perchlorate / acetone solution over a period of 5 min. The resulting mixture was centrifuged at 704 × g, 4 ° C for 10 min, and the supernatant was discarded. The resulting pellet was dried under vacuum for 1 hour and dissolved in water (2.6 mL), dissolved in the sodium perchlorate / acetone solution, and the centrifugation process was repeated. The resulting solid was dried overnight under high vacuum at ambient temperature and weighed to produce GTP 30 sodium salt (6.4 mg, 4%) as a white solid. 1 HNMR (300MHz, D 2O,δ):8.11(s,0.3H),8.08(s,2H),7.98(s,1H),6.02(d, 3 J=3.6Hz,1H),5.87(dd, 3 J=10.2, 3 J=7.2Hz,2H),5.57(d, 3 J=4.7Hz,1H),5.46(dd, 3 J=5.3, 3 J=0.6Hz,1H),5.04(t, 3 J=6.6Hz,1H),4.59–4.56(m,1H),4.45(s,1H),4.27–4.12(m,7H),2.19(s,1H),2.16(s,3H),2.11(s,1H). 31 P NMR (121MHz, D 2 O,δ):–6.27–-6.62(m,1P),-11.21(dt, 3 J=19.7, 3 J=7.7Hz,1P),-22.25(m,1P).

[0549] Exemplary embodiments

[0550] Embodiment 1. A modified ribonucleotide comprising a nucleoside, wherein the nucleoside comprises a ribose moiety comprising an acetyl group, wherein the ribose is 2'-O-acetylated, and the modified ribonucleotide has the following structure:

[0551]

[0552] (a) wherein X is a 5' monophosphate, a 5' diphosphate or a 5' triphosphate; and

[0553] (b) wherein R is a nucleobase selected from the group consisting of adenine or a modified form thereof, guanine or a modified form thereof, cytosine or a modified form thereof, or uracil or a modified form thereof.

[0554] Embodiment 2. The modified ribonucleotide of embodiment 1, wherein the nucleobase is adenine.

[0555] Embodiment 3. The modified ribonucleotide of embodiment 2, wherein the modified ribonucleotide has a 5' triphosphate and the following structure:

[0556]

[0557] Embodiment 4. The modified ribonucleotide of embodiment 1, wherein the nucleobase is guanine.

[0558] Embodiment 5. The modified ribonucleotide of embodiment 4, wherein the modified ribonucleotide has a 5' triphosphate and the following structure:

[0559]

[0560] Embodiment 6. The modified ribonucleotide of embodiment 1, wherein the nucleobase is cytosine.

[0561] Embodiment 7. The modified ribonucleotide of embodiment 6, wherein the modified ribonucleotide has a 5' triphosphate and the following structure:

[0562]

[0563] Embodiment 8. The modified ribonucleotide of embodiment 1, wherein the nucleobase is N4-acetylcytidine.

[0564] Embodiment 9. The modified ribonucleotide of embodiment 8, wherein the modified ribonucleotide has a 5' triphosphate and the following structure:

[0565]

[0566] Embodiment 10. The modified ribonucleotide of embodiment 1, wherein the nucleobase is uracil.

[0567] Embodiment 11. A modified ribonucleotide as described in embodiment 10, wherein the modified ribonucleotide has a 5' triphosphate and the following structure, and has the following structure:

[0568]

[0569] Embodiment 12. The modified ribonucleotide of embodiment 1, wherein the nucleobase is 5-hydroxymethyluridine.

[0570] Embodiment 13. A modified ribonucleotide as described in embodiment 12, wherein the modified ribonucleotide has a 5' triphosphate and the following structure, and has the following structure:

[0571]

[0572] Embodiment 14. The modified ribonucleotide of embodiment 1, wherein the nucleobase is N1-methylpseudouridine.

[0573] Embodiment 15. The modified ribonucleotide of embodiment 14, wherein the modified ribonucleotide has a 5' triphosphate and the following structure, and has the following structure:

[0574]

[0575] Embodiment 16. A polyribonucleotide comprising one or more modified ribonucleotides as described in any one of the preceding embodiments.

[0576] Embodiment 17. The polyribonucleotide of embodiment 16, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% of the ribose moieties in the polyribonucleotide are acetylated (2'-O-acetylated).

[0577] Embodiment 18. The polyribonucleotide of embodiment 16, wherein at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% of the ribose moieties are acetylated (2'-O-acetylated).

[0578] Embodiment 19. The polyribonucleotide of any one of embodiments 16 to 18, wherein 100% of the ribose moieties are acetylated (2'-O-acetylated).

[0579] Embodiment 20. The polyribonucleotide of embodiment 16, wherein about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 10 In some embodiments, the ribose moieties are acetylated (2'-O-acetylated) at about 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99%.

[0580] Embodiment 21. The polyribonucleotide of embodiment 20, wherein at least 95% of the ribose moieties are 2'-O-acetylated.

[0581] Embodiment 22. The polyribonucleotide of any one of embodiments 16 to 21, wherein the polyribonucleotide comprises a cap structure, and the cap structure does not comprise 2'-O-acetylated ribose.

[0582] Embodiment 23. The polyribonucleotide of any one of claims 16 to 21, wherein the polyribonucleotide comprises a cap structure, and the cap structure comprises 2'-O-acetylated ribose.

[0583] Embodiment 24. The polyribonucleotide of any one of embodiments 16 to 22, wherein the polyribonucleotide further comprises modifications comprising: a modified backbone, a modified nucleobase, or any combination thereof.

[0584] Embodiment 25. The polyribonucleotide of embodiment 24, wherein the polyribonucleotide comprises a modified nucleobase.

[0585] Embodiment 26. The polyribonucleotide of embodiment 25, wherein the nucleobase comprises a modification selected from adenine, guanine, cytosine or uracil.

[0586] Embodiment 27. The polyribonucleotide of embodiment 26, wherein the nucleobase is adenine.

[0587] Embodiment 28. The polyribonucleotide of embodiment 26, wherein the nucleobase is guanine.

[0588] Embodiment 29. The polyribonucleotide of embodiment 26, wherein the nucleobase is cytosine.

[0589] Embodiment 30. The polyribonucleotide of embodiment 26, wherein the nucleobase is uracil.

[0590] Embodiment 31. A polyribonucleotide as described in any one of embodiments 14 to 16, wherein the modification includes: N4-acetyl cytidine (ac4C), 5-hydroxymethyl uridine, N1-methyl pseudouridine, pseudouridine, pyridine-4-ketone ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 5-methyl cytidine (m5C), 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, inosine (I), 1-methyl-inosine (m1 I), wyosine (imG), methyl wyosine (mimG) or a combination thereof.

[0591] Embodiment 32. The polyribonucleotide of any one of embodiments 16 to 31, wherein the ribonucleotide comprises a nucleoside comprising an acetyl group, wherein the nucleoside is N4-acetyl cytidine.

[0592] Embodiment 33. A polyribonucleotide as described in any one of embodiments 16 to 31, wherein the ribonucleotide comprises a nucleoside comprising an acetyl group, wherein the nucleoside is N4-acetyl cytidine, and the modified ribonucleotide has the following structure:

[0593]

[0594] Embodiment 34. The polyribonucleotides of embodiment 32 or 33, wherein the polyribonucleotides comprise cytidine residues and wherein about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the cytidine residues contain N4-acetyl cytidine.

[0595] Embodiment 35. A polyribonucleotide as described in embodiment 32 or 33, wherein the polyribonucleotide comprises cytidine residues and wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% of the cytidine residues in the polyribonucleotide comprise N4-acetyl cytidine.

[0596] Embodiment 36. The polyribonucleotide of any one of embodiments 33 to 35, wherein at least 1% of the N4-acetylcytidine residues comprise 2-O acetylated ribose.

[0597] Embodiment 37. The polyribonucleotide of embodiment 33 or 34, wherein no more than 90% of the N4-acetylcytidine residues comprise 2-O acetylated ribose.

[0598] Embodiment 38. The polyribonucleotide of any one of embodiments 33 to 35, wherein in addition to N-acetyl cytidine, the polyribonucleotide further comprises one or more additional ribonucleotides, such as modified ribonucleotides.

[0599] Embodiment 39. The polyribonucleotide of embodiment 38, wherein the one or more ribonucleotides (eg, modified ribonucleotides) comprise a nucleoside selected from adenosine, guanosine, cytidine or uridine, or any combination thereof.

[0600] Embodiment 40. The polyribonucleotide of any one of embodiments 16 to 39, wherein the ribonucleotide comprises a nucleoside comprising a hydroxymethyl group, wherein the nucleoside is 5-hydroxymethyluridine.

[0601] Embodiment 41. A polyribonucleotide as described in any one of embodiments 16 to 39, wherein the ribonucleotide comprises a nucleoside comprising a hydroxymethyl group, wherein the nucleoside is 5-hydroxymethyluridine, and the modified ribonucleotide has the following structure:

[0602]

[0603] Embodiment 42. A polyribonucleotide as described in embodiment 40 or 41, wherein the polyribonucleotide comprises uridine residues and wherein about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 50% of the polyribonucleotides. From about 5% to 20%, about 5% to 15%, about 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the uridine residues comprise 5-hydroxymethyluridine.

[0604] Embodiment 43. A polyribonucleotide as described in embodiment 40 or 41, wherein the polyribonucleotide comprises uridine residues and wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% of the uridine residues in the polyribonucleotide comprise 5-hydroxymethyluridine.

[0605] Embodiment 44. The polyribonucleotide of any one of embodiments 41 to 43, wherein at least 1% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

[0606] Embodiment 45. The polyribonucleotide of any one of embodiments 41 to 43, wherein no more than 90% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

[0607] Embodiment 46. The polyribonucleotide of any one of embodiments 39 to 44, wherein in addition to 5-hydroxymethyluridine, the polyribonucleotide further comprises one or more additional ribonucleotides, such as modified ribonucleotides.

[0608] Embodiment 47. The polyribonucleotide of embodiment 46, wherein the one or more ribonucleotides (eg, modified ribonucleotides) comprise a nucleoside selected from adenosine, guanosine, cytidine or uridine, or any combination thereof.

[0609] Embodiment 48. The polyribonucleotide of any one of embodiments 16 to 46, wherein the ribonucleotide comprises a nucleoside comprising N1-methylpseudouridine.

[0610] Embodiment 49. The polyribonucleotide of any one of embodiments 16 to 46, wherein the ribonucleotide comprises a nucleoside comprising N1-methylpseudouridine, and the modified ribonucleotide has the following structure:

[0611]

[0612] Embodiment 50. The polyribonucleotides of embodiment 48 or 49, wherein the polyribonucleotides comprise uridine residues and wherein about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the uridine residues comprise N1-methylpseudouridine.

[0613] Embodiment 51. A polyribonucleotide as described in embodiment 48 or 49, wherein the polyribonucleotide comprises uridine residues and wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least about 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% of the uridine residues in the polyribonucleotide comprise N1-methylpseudouridine.

[0614] Embodiment 52. The polyribonucleotide of any one of claims 48 to 51, wherein at least 1% of the N1-methylpseudouridine residues comprise 2-O acetylated ribose.

[0615] Embodiment 53. A polyribonucleotide as described in any one of claims 48 to 51, wherein no more than 90% of the N1-methylpseudouridine residues contain 2-O acetylated ribose.

[0616] Embodiment 54. The polyribonucleotide of any one of claims 48 to 53, wherein in addition to N1-methylpseudouridine, the polyribonucleotide also comprises one or more additional ribonucleotides, such as modified ribonucleotides.

[0617] Embodiment 55. The polyribonucleotide of embodiment 54, wherein the one or more ribonucleotides (eg, modified ribonucleotides) comprise a nucleoside selected from adenosine, guanosine, cytidine or uridine, or any combination thereof.

[0618] Embodiment 56. The polyribonucleotide of any one of claims 16 to 55, wherein when the polyribonucleotide comprises one or more modified ribonucleotides of a specific type comprising 2-O acetylated ribose, at least 1% of the modified ribonucleotides of the specific type have 2-O acetylated ribose.

[0619] Embodiment 57. The polyribonucleotide of any one of claims 16 to 55, wherein when the polyribonucleotide comprises one or more modified ribonucleotides of a specific type comprising 2-O acetylated ribose, no more than 90% of the modified ribonucleotides of the specific type have 2-O acetylated ribose.

[0620] Embodiment 58. The polyribonucleotide of embodiment 56 or 57, wherein the polyribonucleotide further comprises: (i) one or more ribonucleotides; and / or (ii) one or more modified ribonucleotides.

[0621] Embodiment 59. A polyribonucleotide as described in any one of embodiments 16 to 58, characterized in that a reduction in immunogenicity is observed relative to an appropriate reference comparator when evaluated in a cell, tissue or organism to which the polyribonucleotide has been administered.

[0622] Embodiment 60. The polyribonucleotide of embodiment 59, wherein the reference comparator comprises an otherwise similar cell, tissue, or organism to which has been administered a comparable polyribonucleotide comprising less 2'-O-acetylated ribose (e.g., not comprising any 2'-O-acetylated ribose) than the polyribonucleotide in the composition.

[0623] Embodiment 61. The polyribonucleotide of embodiment 59, wherein the reduced immunogenicity comprises reduced activation of innate immune response-induced toxicity.

[0624] Embodiment 62. The polyribonucleotide of embodiment 61, wherein the reduced activation of the immune response comprises reduced activation of inflammation-induced NFkb, IRF and / or other cytokine pathways in the cell, tissue or organism.

[0625] Embodiment 63. The polyribonucleotide of any one of embodiments 60 to 62, wherein reduced immunogenicity allows for repeated administration of the polyribonucleotide.

[0626] Embodiment 64. The polyribonucleotide of any one of embodiments 60 to 63, wherein reduced immunogenicity permits administration of a higher dose of the polyribonucleotide relative to an appropriate reference comparator.

[0627] Embodiment 65. The polyribonucleotide of embodiment 64, wherein the reference comparator comprises a comparable polyribonucleotide that comprises less 2'-O-acetylated ribose (eg, does not comprise any 2'-O-acetylated ribose) than the polyribonucleotide in the composition.

[0628] Embodiment 66. A polyribonucleotide as described in any of the preceding embodiments, characterized in that when evaluated in a cell, tissue or organism to which the polyribonucleotide has been administered, an increase in cell viability is observed relative to an appropriate reference comparator.

[0629] Embodiment 67. The polyribonucleotide of embodiment 66, wherein the reference comparator is the cell viability of a cell, tissue or organism to which a comparable polyribonucleotide comprising less 2'-O-acetylated ribose (e.g., not comprising any 2'-O-acetylated ribose) has been administered.

[0630] Embodiment 68. The polyribonucleotide of embodiment 66 or 67, wherein cell viability is a measure of the length of time that one or more cells of the cell, tissue or subject survive.

[0631] Embodiment 69. The polyribonucleotide of embodiment 66 or 67, wherein cell viability is a measure of the number of cells of the cell, tissue or subject that are alive at one or more time points.

[0632] Embodiment 70. A polyribonucleotide as described in any of the preceding embodiments, characterized in that when evaluated in a cell, tissue or organism to which the polyribonucleotide has been administered, an increase in the persistence of the polyribonucleotide is observed relative to an appropriate reference comparator.

[0633] Embodiment 71. The polyribonucleotide of embodiment 70, wherein the reference comparator is the persistence of a comparable polyribonucleotide comprising less 2'-O-acetylated ribose (eg, not comprising any 2'-O-acetylated ribose).

[0634] Embodiment 72. A polyribonucleotide as in embodiment 70 or 71, wherein the persistence of the polyribonucleotide is increased by at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.

[0635] Embodiment 73. The polyribonucleotide of any one of embodiments 70 to 72, wherein the increased persistence is a result of increased resistance to one or more nucleases.

[0636] Embodiment 74. The polyribonucleotide of embodiment 73, wherein the one or more nucleases comprises an endonuclease.

[0637] Embodiment 75. The polyribonucleotide of embodiment 73, wherein the one or more nucleases comprises an exonuclease.

[0638] Embodiment 76. A polyribonucleotide as described in any one of embodiments 70 to 75, wherein the increased persistence allows the polyribonucleotide to be administered in less amount and / or frequency compared to an otherwise similar polyribonucleotide comprising less 2'-O-acetylated ribose (e.g., not comprising any 2'-O-acetylated ribose).

[0639] Embodiment 77. The polyribonucleotide of any one of the preceding embodiments, characterized in that when assessed in a cell, tissue or organism to which the polyribonucleotide has been administered, expression and / or an increase in activity of a gene product encoded by the polyribonucleotide is observed relative to an appropriate reference comparator.

[0640] Embodiment 78. The polyribonucleotide of embodiment 77, wherein the reference comparator is the expression and / or activity of the gene product in a cell, tissue or organism to which a comparable polyribonucleotide comprising less 2'-O-acetylated ribose (e.g., not comprising any 2'-O-acetylated ribose) has been administered.

[0641] Embodiment 79. The polyribonucleotide of embodiment 78, wherein the expression and / or activity of the gene product is increased by at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.

[0642] Embodiment 80. The polyribonucleotide of any one of embodiments 16 to 79, wherein the polyribonucleotide comprises a coding region.

[0643] Embodiment 81. The polyribonucleotide of embodiment 79, wherein the coding region encodes a gene product, such as a payload.

[0644] Embodiment 82: The polyribonucleotide of embodiment 81, wherein the gene product is or comprises a polypeptide.

[0645] Embodiment 83: The polyribonucleotide of embodiment 81, wherein the gene product is or comprises a transcript.

[0646] Embodiment 84. The polyribonucleotide of any one of embodiments 16 to 79, wherein the polyribonucleotide is messenger RNA (mRNA).

[0647] Embodiment 85. The polyribonucleotide of any one of embodiments 16 to 79, wherein the polyribonucleotide is a circular RNA.

[0648] Embodiment 86. The polyribonucleotide of any one of embodiments 16 to 79, wherein the polyribonucleotide is a gRNA.

[0649] Embodiment 87. The polyribonucleotide of any one of embodiments 16 to 79, wherein the polyribonucleotide is an inhibitory RNA.

[0650] Embodiment 88. The polyribonucleotide of any one of embodiments 16 to 79, wherein the polyribonucleotide is a miRNA or a siRNA.

[0651] Embodiment 89. The polyribonucleotide of any one of embodiments 16 to 79, wherein the polyribonucleotide is an antisense oligonucleotide.

[0652] Embodiment 90. The polyribonucleotide of any one of embodiments 16 to 79, wherein the polyribonucleotide is a long non-coding RNA.

[0653] Embodiment 91. A method of making an RNA composition, comprising introducing one or more modified ribonucleotides as described in any one of embodiments 1 to 15 into a polyribonucleotide.

[0654] Embodiment 92. The method of Embodiment 91, wherein the method does not comprise removing double-stranded RNA from the RNA composition.

[0655] Embodiment 93. A method as described in embodiment 91 or 92, wherein the method is an in vitro transcription reaction method.

[0656] Embodiment 94. The method of any one of Embodiments 91 to 94, wherein the method further comprises introducing one or more unmodified ribonucleotides.

[0657] Embodiment 95. A method for producing polyribonucleotides, comprising the step of incubating an in vitro transcription mixture, wherein the in vitro transcription mixture comprises: a DNA template; at least one RNA polymerase or a variant or fragment thereof; and a plurality of ribonucleotides comprising at least one modified ribonucleotide comprising 2'-O-acetylated ribose; thereby producing polyribonucleotides comprising 2'-O-acetylated ribose.

[0658] Embodiment 96. A method as described in embodiment 95, wherein the method produces a plurality of polyribonucleotides.

[0659] Embodiment 97. An in vitro transcription mixture comprising: (i) a DNA template; (ii) at least one RNA polymerase or a variant or fragment thereof; and (iii) a plurality of ribonucleotides comprising at least one modified ribonucleotide comprising a 2'-O-acetylated ribose.

[0660] Embodiment 98. An in vitro transcription mixture as described in Embodiment 97, wherein the mixture produces polyribonucleotides containing 2'-O-acetylated ribose.

[0661] Embodiment 99. An in vitro transcription mixture as described in Embodiment 49, wherein the mixture produces a plurality of polyribonucleotides.

[0662] Embodiment 100. The method of embodiment 96, or the mixture of embodiments 97 to 99, wherein each polyribonucleotide of the plurality of polyribonucleotides comprises a 2'-O-acetylated ribose.

[0663] Embodiment 101. The method or mixture of embodiment 100, wherein each polyribonucleotide in the plurality of polyribonucleotides has at least 5% 2'-O-acetylated ribose.

[0664] Embodiment 102. The method or mixture of embodiment 100, wherein each polyribonucleotide in the plurality of polyribonucleotides has no more than 90% 2'-O-acetylated ribose.

[0665] Embodiment 103. The method or mixture of embodiment 100, wherein each polyribonucleotide in the plurality of polyribonucleotides has 100% 2'-O-acetylated ribose.

[0666] Embodiment 104. The method of embodiment 95 or the mixture of embodiment 97, wherein the RNA polymerase is selected from: bacteriophage RNA polymerase, mitochondrial RNA polymerase, eukaryotic RNA polymerase, bacterial RNA polymerase, or a combination thereof.

[0667] Embodiment 105. The method of embodiment 104 or the mixture of embodiment 104, wherein the RNA polymerase comprises T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, N4 virion RNA polymerase, viral RNA polymerase, or a variant of any of the foregoing.

[0668] Embodiment 106. The method of embodiment 95 or the mixture of embodiment 97, wherein the polyribonucleotide comprises a coding region.

[0669] Embodiment 107. A method as described in embodiment 95 or a mixture as described in embodiment 97, wherein the polyribonucleotide comprises a guide RNA, a short hairpin RNA, a siRNA, a micro RNA, a long non-coding RNA, a circular RNA or a messenger RNA (mRNA), or a combination thereof.

[0670] Embodiment 108. The method of embodiment 106 or 107, or the mixture of embodiment 106 or 107, wherein the polyribonucleotides encode one or more target polypeptides.

[0671] Embodiment 109. A composition comprising one or more polyribonucleotides as described in any one of embodiments 16 to 90.

[0672] Embodiment 110. A composition comprising one or more polyribonucleotides prepared by the method of any one of embodiments 91 to 96 or 100 to 108.

[0673] Embodiment 111. A composition comprising one or more polyribonucleotides prepared using the in vitro transcription reaction mixture of any one of embodiments 97 to 108.

[0674] Embodiment 112. The composition of any one of Embodiments 109 to 111, wherein the composition is a pharmaceutical composition.

[0675] Embodiment 113. A composition as described in Embodiment 112, wherein the pharmaceutical composition is or comprises an immunogenic composition.

[0676] Embodiment 114. The composition of embodiment 112, wherein the pharmaceutical composition is or comprises a vaccine.

[0677] Embodiment 115. The composition of embodiment 112, wherein the pharmaceutical composition is or comprises a gene therapy.

[0678] Embodiment 116. The composition of embodiment 112, wherein the pharmaceutical composition is or comprises chemotherapy.

[0679] Embodiment 117. The composition of embodiment 112, wherein the pharmaceutical composition is or comprises a protein replacement therapy.

[0680] Embodiment 118. The composition of embodiment 112, wherein the pharmaceutical composition is or comprises an immunotherapy.

[0681] Embodiment 119. The composition of embodiment 112, wherein the pharmaceutical composition is or comprises a cell engineering therapy.

[0682] Embodiment 120. The composition of Embodiment 112, wherein the composition comprises double-stranded RNA.

[0683] Embodiment 121. A method comprising administering to a cell, a tissue, or a subject one or more polyribonucleotides as described in any one of embodiments 16 to 90, or a composition as described in any one of embodiments 109 to 120.

[0684] Embodiment 122. The method of embodiment 121, further comprising determining the cell viability of the cell, tissue or subject.

[0685] Embodiment 123. A method as described in Embodiment 122, wherein cell viability is a measure of the length of time that one or more cells of the cell, tissue or subject survive.

[0686] Embodiment 124. A method as described in Embodiment 122, wherein cell viability is a measure of the number of cells of the cell, tissue or subject that are alive at one or more time points.

[0687] Embodiment 125. The method of any one of embodiments 121 to 124, wherein the cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered exhibits improved cell viability compared to a reference cell viability.

[0688] Embodiment 126. A method as described in Embodiment 125, wherein the reference cell viability is the cell viability of a cell, tissue or subject to which a comparable polyribonucleotide containing less 2'-O-acetylated ribose (e.g., not containing any 2'-O-acetylated ribose) or a composition containing the same has been administered.

[0689] Embodiment 127. The method of embodiments 121 to 126, further comprising determining the immune system response of the cell, tissue or subject to which the polyribonucleotide or composition comprising the same has been administered.

[0690] Embodiment 128. A method as described in Embodiment 127, wherein the immune response includes an innate immune system response including innate immune system-induced toxicity.

[0691] Embodiment 129. The method of embodiment 128, wherein determining the innate immune system response comprises determining the level of NF-κB, IRF, and / or other inflammatory cytokines in the cell, tissue, or subject.

[0692] Embodiment 130. The method of any one of embodiments 127 to 129, wherein the cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered exhibits a reduced innate immune system response compared to a reference.

[0693] Embodiment 131. A method as described in Embodiment 130, wherein the reference is the innate immune system response of a cell, tissue, or subject to which a comparable polyribonucleotide comprising less 2'-O-acetylated ribose (e.g., not comprising any 2'-O-acetylated ribose) or a composition comprising the same has been administered.

[0694] Embodiment 132. The method of any one of embodiments 121 to 131, further comprising determining the efficacy of the polyribonucleotide or the composition comprising the polyribonucleotide in the cell, tissue or subject to which the polyribonucleotide or the composition comprising the polyribonucleotide has been administered.

[0695] Embodiment 133. A method as described in Embodiment 132, wherein determining efficacy comprises determining an antibody response or a cellular response in the cell, tissue or subject.

[0696] Embodiment 134. The method of embodiment 132 or 133, wherein the cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered exhibits an increased antibody response or cellular response compared to a reference.

[0697] Embodiment 135. A method as described in Embodiment 134, wherein the reference is an antibody response or a cellular response of a cell, tissue, or subject to which a comparable polyribonucleotide comprising less 2'-O-acetylated ribose (e.g., not comprising any 2'-O-acetylated ribose) or a composition comprising the same has been administered.

[0698] Embodiment 136. The method of any one of Embodiments 121 to 135, further comprising determining the persistence of polyribonucleotides in the cell, tissue or subject compared to a reference.

[0699] Embodiment 137. A method as described in Embodiment 136, wherein the reference is the persistence of a comparable polyribonucleotide or a composition comprising the same that has been administered to a cell, tissue or subject and contains less 2'-O-acetylated ribose (e.g., does not contain any 2'-O-acetylated ribose).

[0700] Embodiment 138. A method as described in embodiment 136 or 137, wherein administration of the polyribonucleotide results in increased persistence of the polyribonucleotide compared to a reference.

[0701] Embodiment 139. A method as described in embodiment 138, wherein the persistence of the polyribonucleotide is increased by at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.

[0702] Embodiment 140. The method of any one of Embodiments 121 to 139, further comprising determining the expression and / or activity of a gene product encoded by the polyribonucleotide in the cell, tissue or subject compared to a reference.

[0703] Embodiment 141. A method as described in Embodiment 140, wherein the reference is the expression and / or activity of a comparable polyribonucleotide or a composition comprising the same that has been administered to a cell, tissue or subject and contains less 2'-O-acetylated ribose (e.g., does not contain any 2'-O-acetylated ribose).

[0704] Embodiment 142. A method as described in embodiment 141 or 142, wherein administration of the polyribonucleotide results in increased expression and / or activity of the polyribonucleotide compared to a reference.

[0705] Embodiment 143. A method as described in embodiment 142, wherein the expression and / or activity of the gene product is increased by at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.

[0706] Embodiment 144. The method of any one of Embodiments 121 to 143, wherein the method comprises administering the polyribonucleotide or a composition comprising the same to the cell, tissue or subject at least twice.

[0707] Embodiment 145. A method as described in any one of embodiments 121 to 144, wherein the method comprises administering the polyribonucleotide or a composition comprising the same to the cell, tissue or subject at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times or at least 10 times.

[0708] Embodiment 146. A method as described in any one of embodiments 144 or 145, wherein administering the polyribonucleotide or a composition comprising the polyribonucleotide at least twice to the cell, tissue or subject does not result in a decrease in the efficacy of the polyribonucleotide or a composition comprising the polyribonucleotide compared to administering one dose of the polyribonucleotide or a composition comprising the polyribonucleotide.

[0709] Embodiment 147. The method of any one of Embodiments 121 to 146, wherein the method comprises administering to the cell, tissue or subject the polyribonucleotide or a composition comprising the same at a higher dose compared to an appropriate reference comparator.

[0710] Embodiment 148. A method as described in Embodiment 147, wherein the reference comparator comprises a comparable polyribonucleotide that contains less 2'-O-acetylated ribose (eg, does not contain any 2'-O-acetylated ribose).

[0711] Embodiment 149. The method of any one of Embodiments 121 to 148, wherein the cell is a mammalian cell, the tissue is a mammalian tissue, or the subject is a mammal.

[0712] Embodiment 150. The method of embodiment 149, wherein the mammal is a human.

[0713] Embodiment 151. The method of any one of Embodiments 121 to 150, wherein the method is a method of stimulating an immune response.

[0714] Embodiment 152. The method of any one of Embodiments 121 to 150, wherein the method is a vaccination method.

[0715] Embodiment 153. The method of any one of Embodiments 121 to 150, wherein the method is a gene therapy method.

[0716] Embodiment 154. A method as described in Embodiment 153, wherein the gene therapy method includes delivering one or more components of gene therapy, such as gRNA.

[0717] Embodiment 155. The method of any one of Embodiments 121 to 150, wherein the method is a cell therapy engineering method.

[0718] Embodiment 156. The method of any one of Embodiments 121 to 150, wherein the method is an immunotherapy method.

[0719] Embodiment 157. The method of Embodiment 156, wherein the immunotherapy method comprises delivering antibody therapy and / or immune checkpoint therapy.

[0720] Embodiment 158. The method of any one of Embodiments 121 to 150, wherein the method is a protein replacement therapy method.

[0721] Embodiment 159. The method of embodiment 158, wherein the protein replacement therapy method comprises delivering enzyme replacement therapy.

[0722] Embodiment 160. The method of any one of Embodiments 121 to 150, wherein the method is a chemotherapeutic method.

[0723] Embodiment 161. A method of vaccination comprising administering to a cell, a tissue or a subject one or more polyribonucleotides as described in any one of embodiments 16 to 90, or a composition as described in any one of embodiments 109 to 120.

[0724] Embodiment 162. A method of immunotherapy comprising administering to a cell, a tissue or a subject one or more polyribonucleotides as described in any one of embodiments 16 to 90, or a composition as described in any one of embodiments 109 to 120.

[0725] Embodiment 163. A method of gene therapy comprising administering to a cell, tissue or subject one or more polyribonucleotides as described in any one of embodiments 16 to 90, or a composition as described in any one of embodiments 109 to 120.

[0726] Embodiment 164. A method of protein replacement therapy comprising administering to a cell, a tissue or a subject one or more polyribonucleotides as described in any one of embodiments 16 to 90, or a composition as described in any one of embodiments 109 to 120.

[0727] Embodiment 165. A method of cell engineering therapy, comprising administering to a cell, a tissue or a subject one or more polyribonucleotides as described in any one of embodiments 16 to 90, or a composition as described in any one of embodiments 109 to 120.

[0728] Embodiment 166. A method of increasing the persistence of a polyribonucleotide in a cell, tissue or subject, comprising administering to the cell, tissue or subject one or more polyribonucleotides as described in any one of embodiments 16 to 90, or a composition as described in any one of embodiments 109 to 120.

[0729] Embodiment 167. A method of increasing the expression and / or activity of a gene product encoded by a polyribonucleotide in a cell, tissue or subject, comprising administering to the cell, tissue or subject one or more polyribonucleotides as described in any one of embodiments 16 to 90, or a composition as described in any one of embodiments 109 to 120.

[0730] Embodiment 168. A cell comprising the polyribonucleotide of any one of embodiments 116 to 90, or the composition of any one of embodiments 109 to 120.

[0731] Embodiment 169. Use of the modified ribonucleotides as described in embodiment 1 in the production of polyribonucleotides.

[0732] Embodiment 170. Use of the polyribonucleotide of any one of embodiments 16 to 90, or the composition of any one of embodiments 109 to 120, to stimulate an immune response.

[0733] Embodiment 171. Use of the polyribonucleotide of any one of embodiments 16 to 90, or the composition of any one of embodiments 109 to 120 as a vaccine.

[0734] Embodiment 172. Use of the polyribonucleotide of any one of embodiments 16 to 90, or the composition of any one of embodiments 109 to 120 as an immunotherapy.

[0735] Embodiment 173. Use of the polyribonucleotide of any one of embodiments 16 to 90, or the composition of any one of embodiments 109 to 120 as a gene therapy.

[0736] Embodiment 174. Use of the polyribonucleotide of any one of embodiments 16 to 90, or the composition of any one of embodiments 109 to 120 as a protein replacement therapy.

[0737] Embodiment 175. Use of the polyribonucleotide of any one of embodiments 116 to 90, or the composition of any one of embodiments 109 to 120 as a cell engineering therapy.

[0738] Embodiment 176. Use of the polyribonucleotide of any one of embodiments 16 to 90, or the composition of any one of embodiments 109 to 120 as chemotherapy.

[0739] Embodiment 177. The use of any one of embodiments 169 to 176, wherein the polyribonucleotide or a composition comprising the same is administered to a cell, a tissue or a subject.

[0740] Embodiment 178. The use of Embodiment 177, wherein the cell is a mammalian cell, the tissue is a mammalian tissue, or the subject is a mammal.

[0741] Embodiment 179. The use of embodiment 178, wherein the mammal is a human.

[0742] Equivalent solutions

[0743] Those skilled in the art will recognize or be able to determine many equivalents of the specific embodiments of the invention described herein using only routine experimentation. It should be understood that, unless otherwise noted or unless it is obvious to one of ordinary skill in the art that a contradiction or inconsistency will occur, the present invention covers all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc. from one or more of the listed claims are introduced into another claim that is subordinate to the same base claim (or any other claim that is related). In addition, it should also be understood that any embodiment or aspect of the present invention may be explicitly excluded from the claims, regardless of whether a specific exclusion is described in the specification. The scope of the present invention is not intended to be limited to the above description, but is set forth in the appended claims.

Claims

1. A modified ribonucleotide comprising a nucleoside, wherein the nucleoside comprises a ribose moiety comprising an acetyl group, wherein the ribose is 2'-O-acetylated, and the modified ribonucleotide has the following structure: (a) wherein X is a 5' monophosphate, a 5' diphosphate or a 5' triphosphate; and (b) wherein R is a nucleobase selected from the group consisting of adenine or a modified form thereof, guanine or a modified form thereof, cytosine or a modified form thereof, or uracil or a modified form thereof.

2. The modified ribonucleotide of claim 1, wherein the nucleobase is adenine and the modified ribonucleotide has a 5' triphosphate and the following structure:

3. The modified ribonucleotide of claim 1, wherein the nucleobase is guanine and the modified ribonucleotide has a 5' triphosphate and the following structure:

4. The modified ribonucleotide of claim 1, wherein the nucleobase is cytosine and the modified ribonucleotide has a 5' triphosphate and the following structure:

5. The modified ribonucleotide of claim 1, wherein the nucleobase is N4-acetylcytidine and the modified ribonucleotide has a 5' triphosphate and the following structure:

6. The modified ribonucleotide of claim 1, wherein the nucleobase is uracil and the modified ribonucleotide has a 5' triphosphate and the following structure:

7. The modified ribonucleotide of claim 1, wherein the nucleobase is 5-hydroxymethyluridine and the modified ribonucleotide has a 5' triphosphate and the following structure:

8. The modified ribonucleotide of claim 1, wherein the nucleobase is N1-pseudomethyluridine and the modified ribonucleotide has a 5' triphosphate and the following structure:

9. A polyribonucleotide comprising one or more modified ribonucleotides as claimed in any one of the preceding claims.

10. The polyribonucleotide of claim 9, wherein: (i) at least 5% of the ribose moieties are acetylated (2'-O-acetylated), or (ii) about 5% to 99% of the ribose moieties are acetylated (2'-O-acetylated).

11. polyribonucleotide as claimed in claim 9 or 10, wherein said polyribonucleotide comprises cap structure, and said cap structure does not comprise 2 '-O-acetylated ribose.

12. polyribonucleotide as claimed in claim 9 or 10, wherein said polyribonucleotide comprises cap structure, and said cap structure comprises 2 '-O-acetylated ribose.

13. polyribonucleotides as described in any one in claim 9 to 12, wherein said polyribonucleotides also comprise one or more ribonucleotides that do not comprise 2-O acetylated ribose.

14. polyribonucleotide as described in any one in claim 9 to 13, wherein said polyribonucleotide also includes and comprises following modification: the main chain of modification, the core base of modification or its combination.

15. polyribonucleotide as claimed in claim 14, wherein said polyribonucleotide comprises the core base of modification.

16. polyribonucleotide as claimed in claim 15, wherein the described core base that comprises modification is selected from adenine, guanine, cytosine or uracil.

17. The polyribonucleotide as claimed in any one of claims 14 to 16, wherein the modification comprises: N4-acetyl-cytidine (ac4C), 5-hydroxymethyl uridine, N1-methyl pseudouridine, pyridine-4-keto ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 5-methyl cytidine (m5C), 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, inosine (I), 1-methyl-inosine (m1 I), wyosine (imG), methyl wyosine (mimG), or any combination thereof.

18. polyribonucleotide as described in any one in claim 14 to 17, wherein said polyribonucleotide includes the nucleoside that comprises acetyl group, wherein said nucleoside is N4-acetyl cytidine, and the ribonucleotide of described modification has the described structure that claim 5 provides.

19. polyribonucleotides as claimed in claim 18, wherein said polyribonucleotides comprise cytidine residues and wherein in said polyribonucleotides at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% cytidine residues comprise N4-acetyl cytidine.

20. The polyribonucleotide of claim 18 or 19, wherein: (i) at least 1% of the N4-acetylcytidine residues contain 2-O-acetylated ribose; or (ii) no more than 90% of the N4-acetylcytidine residues contain 2-O-acetylated ribose.

21. polyribonucleotide as described in any one in claim 13 to 20, wherein said polyribonucleotide includes the nucleoside that comprises the hydroxymethyl group, wherein said nucleoside is 5-hydroxymethyl uridine, and the ribonucleotide of described modification has the described structure that claim 7 provides.

22. polyribonucleotide as claimed in claim 21. at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% uridine residues comprise 5-hydroxymethyluridine in the wherein said polyribonucleotide.

23. The polyribonucleotide of claim 21 or 22, wherein at least 1% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

24. A polyribonucleotide as claimed in claim 21 or 22, wherein no more than 90% of the 5-hydroxymethyluridine residues comprise 2-O acetylated ribose.

25. as described in any one in claim 13 to 24 polyribonucleotide, wherein said polyribonucleotide comprises N1-methyl pseudouridine, and the ribonucleotide of described modification has the described structure that claim 8 provides.

26. polyribonucleotides as claimed in claim 25, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% of the uridine residues comprise N1-methylpseudouridine in the wherein said polyribonucleotides.

27. The polyribonucleotide of claim 25 or 26, wherein at least 1% of the N1-methylpseudouridine residues comprise 2-O acetylated ribose.

28. A polyribonucleotide as claimed in claim 25 or 26, wherein no more than 90% of the N1-methyl pseudouridine residues comprise 2-O acetylated ribose.

29. The polyribonucleotide according to any one of claims 8 to 28, characterized in that When assessed in cells, tissues or organisms to which the polyribonucleotide has been administered, a reduction in immunogenicity is observed relative to an appropriate reference comparator.

30. polyribonucleotide as claimed in claim 29, wherein immunogenicity reduction comprises that the toxic activation reduction of innate immune response induction.

31. The polyribonucleotide of claim 29 or 30, wherein: (i) reduced activation of immune responses including reduced activation of inflammation-induced NFkb, IRF and / or other cytokine pathways in the cell, tissue or organism; (ii) reduced immunogenicity allows repeated administration of the polyribonucleotide; and / or (iii) Reduced immunogenicity allows for administration of higher doses of the polyribonucleotide relative to an appropriate reference comparator.

32. The polyribonucleotide according to any one of claims 8 to 31, characterized in that When assessed in a cell, tissue or organism to which the polyribonucleotide has been administered, an increased persistence of the polyribonucleotide is observed relative to an appropriate reference comparator.

33. polyribonucleotides as claimed in claim 32, the persistence of wherein said polyribonucleotide increases by at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.

34. as claim 32 or 33 described polyribonucleotides, wherein persistence increases and is the result that resistance to one or more nucleases increases.

35. The polyribonucleotide according to any one of claims 8 to 34, characterized in that When assessed in a cell, tissue or organism to which the polyribonucleotide has been administered, an increase in the expression and / or activity of the gene product encoded by the polyribonucleotide is observed relative to an appropriate reference comparator.

36. polyribonucleotide as claimed in claim 35, wherein expression of gene product and / or the activity increase at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.

37. as described in any one in claim 29 to 36 polyribonucleotide, wherein comprise using the similar cell, tissue or the organism of other aspects of the comparable polyribonucleotide that comprise 2'-O-acetylated less than the polyribonucleotide in the compositions with reference to the comparison thing.

38. polyribonucleotides as described in any one in claim 8 to 37, wherein said polyribonucleotides comprise coding region.

39. The polyribonucleotide of any one of claims 8 to 37, wherein the polyribonucleotide comprises an RNA oligonucleotide; a messenger RNA, a gRNA; an inhibitory RNA; a miRNA or a siRNA; an antisense oligonucleotide; Long noncoding RNA, circular RNA, or any combination thereof.

40. A method of making an RNA composition comprising introducing at least one modified ribonucleotide as claimed in any one of claims 1 to 8 into a polyribonucleotide.

41. The method of claim 40, wherein the method does not comprise removing double-stranded RNA from the RNA composition.

42. The method of claim 40 or 41, wherein: (i) the method is an in vitro transcription reaction method; and / or (ii) The method produces a plurality of polyribonucleotides.

43. An in vitro transcription mixture comprising: (i) DNA template; (ii) at least one RNA polymerase or variant or fragment thereof; and (iii) a plurality of ribonucleotides comprising at least one modified ribonucleotide comprising a 2'-O-acetylated ribose sugar.

44. The method of claim 42 or the mixture of claim 43, wherein the RNA polymerase is selected from the group consisting of: bacteriophage RNA polymerase, mitochondrial RNA polymerase, eukaryotic RNA polymerase, bacterial RNA polymerase, or any combination thereof.

45. The method of claim 44 or the mixture of claim 44, wherein the RNA polymerase comprises T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, N4 virion RNA polymerase, viral RNA polymerase, or a variant of any of the foregoing.

46. ​​A composition comprising one or more polyribonucleotides as described in any one of claims 9 to 39.

47. The composition of any one of claims 46, wherein the composition is a pharmaceutical composition.

48. The composition of claim 47, wherein the pharmaceutical composition is or comprises an immunogenic composition; a vaccine, gene therapy, chemotherapy, protein replacement therapy, immunotherapy, antibody therapy, immunomodulatory therapy, cell engineering therapy, or a combination thereof.

49. A method comprising administering to a cell, tissue or subject one or more polyribonucleotides as described in any one of claims 9 to 39, or a composition as described in any one of claims 46 to 48.

50. The method of claim 49, further comprising determining the cell viability of the cell, tissue or experimenter to which the polyribonucleotide or a composition comprising the polyribonucleotide has been applied, Optionally, the cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered exhibits improved cell viability compared to a reference cell viability.

51. as claimed in claim 49 or 50 described methods, it also comprises confirming to have used the described cell, tissue or experimenter's immune system response of described polyribonucleotide or the composition comprising it, Optionally, the cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered exhibits a reduced innate immune system response compared to a reference.

52. as described in any one in claim 49 to 51 method, it also comprises determining to use described polyribonucleotide or comprise the effect of the polyribonucleotide described in the described cell, tissue or experimenter of its composition, Optionally, the cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered exhibits increased efficacy of the polyribonucleotide compared to a reference.

53. as described in any one in claim 49 to 52 method, it also comprises determining to have used described polyribonucleotide or comprise the persistence of the polyribonucleotide or the composition thereof in described cell, tissue or experimenter, Optionally, the cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered exhibits increased persistence of the polyribonucleotide compared to a reference.

54. as described in any one in claim 49 to 53 method, it also comprises determining to use described polyribonucleotide or comprise the expression of the gene product of its composition encoding by described polyribonucleotide or tissue or experimenter and / activity, Optionally, the cell, tissue or subject to which the polyribonucleotide or a composition comprising the same has been administered exhibits increased expression and / or activity of a gene product encoded by the polyribonucleotide, compared to a reference.

55. The method of claim 54, wherein the gene product is or comprises: (i) a polypeptide encoded by said polyribonucleotide comprising one or more modified ribonucleotides; or (ii) a polyribonucleotide located in said polyribonucleotide comprising one or more modified ribonucleotides.

56. The method of claim 54 or 55, wherein determining the expression of a payload comprises determining the expression of polyribonucleotides, or polypeptides, or both.

57. methods as described in any one in claim 49 to 56, wherein said method comprises using said polyribonucleotide or comprising its compositions to said cell, tissue or experimenter: (i) at least twice; And / or (ii) compared with higher dosage with suitable reference comparator.

58. The method of any one of claims 49 to 57, wherein the cell is a mammalian cell, the tissue is a mammalian tissue, or the subject is a mammal.

59. The method of any one of claims 49 to 58, wherein the method is: (i) methods of stimulating an immune response; (ii) antibody therapy methods; (iii) immunomodulatory methods; (iv) vaccination method; (v) gene therapy approaches; (vi) cell therapy engineering methods; (vii) immunotherapy methods; (viii) protein replacement therapy approaches; (ix) chemotherapy; or (x) A combination of (i)-(ix).

60. A cell comprising the polyribonucleotide of any one of claims 9 to 39, or the composition of any one of claims 46 to 48.

61. A polyribonucleotide as described in any one of claims 9 to 39 or the purposes of the compositions as described in any one of claims 46 to 48, which is used in the preparation of following medicines: (i) methods of stimulating an immune response; (ii) antibody therapy methods; (iii) immunomodulatory methods; (iv) vaccination method; (v) gene therapy approaches; (vi) cell therapy engineering methods; (vii) immunotherapy methods; (viii) protein replacement therapy approaches; (ix) chemotherapy; or (x) A combination of (i)-(ix).

62. A composition comprising the polyribonucleotides as described in any one of claims 9 to 39, or a composition as described in any one of claims 46 to 48, for: (i) methods of stimulating an immune response; (ii) antibody therapy methods; (iii) immunomodulatory methods; (iv) vaccination method; (v) gene therapy approaches; (vi) cell therapy engineering methods; (vii) immunotherapy methods; (viii) protein replacement therapy approaches; (ix) chemotherapy; or (x) A combination of (i)-(ix).

63. A method for producing a polyribonucleotide comprising the step of using a modified ribonucleotide as described in any one of claims 1 to 8.

64. purposes as claimed in claim 61 or 63, or the compositions used as claimed in claim 62, wherein the polyribonucleotide or the compositions comprising it are applied to a cell, a tissue or a subject.

65. The use of claim 64, or the composition for use, wherein the cell is a mammalian cell, the tissue is a mammalian tissue, or the subject is a mammal.

66. The use according to claim 65, or the composition for use, wherein the mammal is a human.

Images