Application of reagent for inhibiting expression of circular RNA hsacirc0001360 in preparation of medicine for treating preeclampsia

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a reagent for inhibiting expression of circular RNA hsacirc0001360 in preparation of a medicine for treating preeclampsia, the medicine inhibits inflammation, by conducting CircRNAs sequencing and subsequent verification on placenta tissue, hsacirc0001360 is determined as a research object, the relation between hsacirc0001360 and PE is disclosed, and the action mechanism of ncRNAs in PE is perfected.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the use of a reagent for inhibiting the expression of circular RNAhsa_circ_0001360 in the preparation of a drug for treating preeclampsia. Background Art

[0002] Preeclampsia, abbreviated as PE, is a systemic syndrome idiopathic to pregnancy, which can affect multiple organs such as the heart, brain, liver, and kidneys. It is the main cause of maternal and neonatal morbidity and mortality worldwide. PE usually occurs after 20 weeks of pregnancy, with the main clinical manifestations of hypertension and proteinuria. Its complications mainly include neurological symptoms such as headaches and epilepsy that cannot be relieved by drugs, blood system symptoms such as thrombocytopenia, disseminated intravascular coagulation, liver dysfunction, HELLP syndrome, etc. PE can also reduce the quality of life of pregnant women after delivery, increase the risk of postpartum depression, and bring serious burdens to family life and social development. At present, the pharmacological intervention measures for PE are mainly anti-inflammatory and immunomodulatory, such as oral aspirin, etc. The only cure is to deliver the placenta after the fetus is delivered, which can relieve symptoms, but this largely leads to premature fetal delivery. Therefore, preventing the occurrence of PE and finding means of early treatment are difficult problems that researchers urgently need to solve.

[0003] Circular RNA is a new type of non-coding RNA with a single-stranded circular structure. The biggest difference from linear RNA is that it lacks a 3'-terminal poly (A) tail and a 5'-terminal cap. Due to its special structure, CircRNAs are more stable than other non-coding RNAs and can resist degradation by ribonucleases. According to the biogenesis of CircRNAs, they can be divided into exon CircRNAs, intron CircRNAs, and exon-intron CircRNAs. Studies have found that CircRNAs can regulate cell processes such as cell cycle, cell carcinogenesis, and cell stress response. Based on the important role of CircRNAs in gene regulation and the characteristics of its own stable structure, it has become a research hotspot in the current medical research field. Recent literature shows that CircRNAs play a role in a variety of malignant tumors, cardiovascular diseases, intervertebral disc degeneration and other diseases. In addition, multiple literatures point out that CircRNAs are closely related to the occurrence and development of pregnancy-related diseases. For example, RNA-seq results show that compared with normal pregnant women, there is abnormal expression of CircRNAs in the placental tissue of PE patients. According to the latest literature, CircRNAs are also highly correlated with inflammatory responses. For example, the loss of circRasGEF1B prevents leukocyte migration to the inflammatory site and interferes with the healing process by reducing the expression level of ICAM1; CircRNAPIP5K1A sponges microRNA-552-3p and regulates the inflammation and oxidative damage of pancreatic INS-1β cells induced by glucolipid toxicity through Janus kinase 1; circ-GNB4 affects the proliferation, inflammation and oxidative stress of human mesangial cells by regulating the circ-GNB4 / miR-23c / EGR1 axis, thereby reducing the damage of mesangial cells. In addition, circular RNAs have multiple biological functions and can participate in the regulation of multiple life activities by acting as microRNA sponges, binding to RNA-binding proteins, and regulating the expression of parental genes. For example, circ_0011232 participates in the progression of hepatocellular carcinoma through the miR-503-5p / AKT3 axis; silencing circCHFR can inhibit ox-LDL-induced endothelial cell damage by regulating the miR-15b-5p / GADD45G axis, thereby inhibiting the occurrence of atherosclerosis. However, there is currently no research on the use of CircRNAs in PE. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides the use of a reagent for inhibiting the expression of circular RNAhsa_circ_0001360 in the preparation of a drug for treating preeclampsia.

[0005] Use of reagents for inhibiting circular RNA hsa_circ_0001360 in the preparation of drugs for treating preeclampsia.

[0006] Preferably, the reagent that inhibits circular RNAhsa_circ_0001360 is an interfering lentivirus of the hsa_circ_0001360 gene.

[0007] Preferably, the interfering lentivirus has a nucleotide sequence as shown in SEQ ID NO.2-3.

[0008] Preferably, the interfering lentivirus has a nucleotide sequence as shown in SEQ ID NO.4-5.

[0009] Preferably, the interfering lentivirus has a nucleotide sequence as shown in SEQ ID NO.6-7.

[0010] Preferably, the reagent for inhibiting circular RNAhsa_circ_0001360 also includes a transfection-aiding reagent and a screening reagent for screening successfully infected lentivirus.

[0011] Preferably, the transfection aid is Polybrene.

[0012] Preferably, the screening agent is 1.8-2.2 μg / mL of puromycin.

[0013] Preferably, the medicament inhibits inflammation.

[0014] Preferably, the drug inhibits inflammation of trophoblastic cells.

[0015] Compared with the prior art, the present invention is beneficial in that:

[0016] The present invention provides an application of an agent for inhibiting the expression of circular RNA hsa_circ_0001360 in the preparation of a drug for treating preeclampsia, reveals the relationship between hsa_circ_0001360 and PE, provides a potential target for early clinical prediction and precise treatment of PE, and improves the action mechanism of ncRNAs in PE.

[0017] The present invention finds that the inflammatory response of trophoblast cells is activated when PE occurs. By sequencing CircRNAs of placental tissue and subsequent verification, hsa_circ_0001360 is determined as the research object. It is found that after interfering with hsa_circ_0001360, the levels of IL-1β, IL-6, IL-8, and TNF-α mRNA are significantly reduced, and the concentrations of IL-1β, IL-6, and TNF-α are also significantly reduced, suggesting the relationship between hsa_circ_0001360 and the inflammatory response of placental trophoblast cells, thereby proposing an agent that inhibits the expression of circular RNA hsa_circ_0001360 for the treatment of preeclampsia. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The expression of inflammation-related factors in placental tissue of PE patients.

[0019] Figure 2 Figure 3 shows the effects of hypoxia on the mRNA expression levels and concentrations of inflammatory factors in HTR-8 / SVneo cells. A shows the mRNA expression levels of inflammatory factors detected by qRT-PCR after different periods of hypoxia, and B shows the concentration changes of inflammatory factors in cell culture medium detected by ELISA.

[0020] Figure 3 Screening of circRNAs differentially expressed in placental tissues of PE patients for circRNA sequencing.

[0021] Figure 4 qRT-PCR was used to detect the expression of differentially expressed CircRNAs in placental tissue.

[0022] Figure 5 qRT-PCR was used to detect the expression of differentially expressed CircRNAs in HTR-8 / SVneo cells.

[0023] Figure 6 The structure and stability of hsa_circ_0001360, where A is Sanger sequencing, B is the detection of the expression levels of hsa_circ_0001360 and the corresponding linear RNAPHC3 after RNase enzyme treatment, C is the detection of the expression of hsa_circ_0001360 and the corresponding linear RNAPHC3 after treating HTR-8 / SVneo cells with actinomycin D at 0h, 4h, 8h, 12h, and 24h, D is to verify that hsa_circ_0001360 has the characteristics of circularization, design divergent and convergent primers, perform ordinary PCR amplification, and then perform agarose gel electrophoresis. Represents PHC3, Represents hsa_circ_0001360.

[0024] Figure 7 Figure 3 is the subcellular localization of hsa_circ_0001360 in HTR-8 / SVneo cells. A shows the nuclear and cytoplasmic RNA of HTR-8 / SVneo cells were extracted using a nuclear and cytoplasmic RNA isolation kit, and the expression of hsa_circ_0001360 was detected by qRT-PCR. B shows the distribution of hsa_circ_0001360 in the nucleus and cytoplasm by RNAFISH experiment.

[0025] Figure 8To construct hsa_circ_0001360 overexpression and interference stable cell lines, A is the stable cell lines of OE-hsa_circ_0001360, Sh1-hsa_circ_0001360, Sh2-hsa_circ_0001360, Sh3-hsa_circ_0001360, OE-NC, Sh-NC and the fluorescence transfection efficiency of lentiviral infection for 48 hours, B is the self-expression level after overexpression detected by qRT-PCR, C is the self-expression level after interference with hsa_circ_0001360 detected by qRT-PCR, OE-NC is the overexpression control, and Sh-NC is the interference control.

[0026] Fig. 9 Figure 3 shows the effect of hsa_circ_0001360 on the inflammatory response in HTR-8 / SVneo cells, where A is the mRNA expression level of inflammation-related factors detected by qRT-PCR after overexpression of hsa_circ_0001360, B is the concentration change of inflammation-related factors detected by ELISA after overexpression of hsa_circ_0001360, C is the mRNA expression level of inflammation-related factors detected by qRT-PCR after interfering with hsa_circ_0001360, and D is the concentration change of inflammation-related factors detected by ELISA after interfering with hsa_circ_0001360.

[0027] Fig.10 Flow chart of the ELISA assay.

[0028] Fig.11 Flow chart for extracting protein and RNA in RNA pull down experiment. DETAILED DESCRIPTION

[0029] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0030] Placental tissue was collected immediately after cesarean section in normal and PE pregnant women. Samples were taken from the umbilical cord centered at 2 cm around the umbilical cord. The sample size was approximately 1 cm × 1 cm × 1 cm. Three samples were immediately washed with saline to remove blood stains on the surface, placed in cryopreservation tubes and stored in liquid nitrogen. The samples were collected with the informed consent of the patients and their families and the approval of the Ethics Committee of Ningxia Medical University. Cases were selected according to the inclusion and exclusion criteria. Inclusion criteria: (1) PE cases that met the disease diagnosis criteria; (2) Cesarean section cases of single pregnancy. Exclusion criteria: (1) Multiple pregnancy; (2) Cases with complications of cardiovascular diseases such as hypertension, metabolic diseases such as diabetes, autoimmune diseases, liver cirrhosis, blood system diseases, etc. The normal control group was: cases that underwent cesarean section due to "abnormal fetal position, scarred uterus, advanced maternal age, social factors, etc." during the same period.

[0031] Human placental trophoblast HTR-8 / SVneo cells were purchased from Shanghai Mingjin Biotechnology Co., Ltd. and stored in a liquid nitrogen tank.

[0032] Table 1 Comparison table of names involved in the present invention

[0033] Chinese name English name abbreviation Preeclampsia preeclampsia PE Circular RNA circularRNA CircRNAs Noncoding RNA non-coding RNA ncRNAs RNase Ribonuclease RNase Exonic CircRNAs / ECircRNA Intronic CircRNAs / cirRNA Exon-intron CircRNAs / EIciRNA MicroRNA microRNA miRNA RNA binding proteins RNA binding protein RBP

[0034] In the present invention, the nucleotide sequence of hsa_circ_0001360 is: ATCAACCTCTCCACTTCT CCTACACCTGCACAGTTAATAAGCCGTTCCCAGGCTTCCAGTTCTACCAGCGGCAGTATTACCCAACAGACTATGTTACTAGGGAGTACTTCCCCTACCCTAACGGCAAGCCAAGCTCAAATGTATCTCCGAGCTCAAATGCTGATTTTCACACCCGCTACCACTGTGGCTGCTGTACAGTCTGACATTCCTGTTGTCTCGTCGTCATCGTCATCTTCCTGTCAGTCTGCAGCTACTCAG, recorded as SEQ ID NO.1.

[0035] The experimental operations involved in the present invention are carried out according to the following methods:

[0036] 1. Cell Culture

[0037] 1. Cell recovery

[0038] First, take out the cells from liquid nitrogen, quickly place them in 37°C warm water, put them in the intercellular transfer window, turn on the centrifuge, quickly use a pipette to aspirate the thawed cryopreservation solution in the clean bench, add the pre-prepared 1640 culture medium with a fetal bovine serum concentration of 10%, mix well and transfer to a 15mL centrifuge tube, centrifuge at 800rpm for 5min, aspirate the supernatant after centrifugation with a pipette, add 6mL of pre-prepared culture medium to the 15mL centrifuge tube, use a pipette to gently blow the cell pellet to mix well, transfer to a T25 culture flask, and gently transfer to a CO2 cell constant temperature incubator for culture.

[0039] 2. Cell culture medium replacement and cell passaging

[0040] Take out the revived cells from the incubator for observation. When the cells are in good condition and the density is less than 80%, replace with new culture medium and continue to culture. This is cell replacement. When the cell density reaches 80% to 90%, the cells need to be passaged. When the cells are passaged, use a pipette to remove the liquid in the culture bottle, add 2mL of pure culture medium to each culture bottle, gently wash the adherent cells and discard the liquid, repeat the washing 3 times, add 1mL of trypsin to each bottle for digestion, and observe the cell changes closely under the microscope at this time. When the cell gap widens, the morphology tends to be round, and a small number of cells change from the adherent state to the suspended state, immediately stop the digestion with 3mL of culture medium, and gently blow down the adherent cells with a pipette. After mixing evenly, transfer to 3 new culture bottles, add 5mL of liquid to each bottle and continue to culture.

[0041] 3. Cell cryopreservation

[0042] When the cell density reaches about 90%, cells in good growth state need to be frozen. When freezing cells, each bottle of cells needs to be washed 3 times with 2mL of pure culture medium, and 1mL of trypsin is added to digest the cells. After digestion, 3mL of culture medium is used to stop digestion and blow it off, and then transferred to a new 15mL centrifuge tube, centrifuged at 800rpm for 5min, and after centrifugation, the liquid in the tube is discarded with a pipette, and 2mL of freezing solution is added to the cell pellet. DMSO: serum in the cell freezing solution is 1:9, and after mixing, it is transferred to the cryopreservation tube, and the cells are frozen in the order of 4℃30min, -20℃2h, and -80℃. The cryopreservation tube can also be directly placed in a gradient freezing box and placed in an ultra-low temperature freezing environment of -80℃ to freeze the cells, and then transferred to liquid nitrogen for storage after 30h.

[0043] 2. Real-time fluorescence quantitative polymerase chain reaction, abbreviated as qRT-PCR

[0044] 1. Extraction of total RNA

[0045] (1) Place the items needed for RNA extraction, such as micropipettes of various specifications, sterile pipette tips, waste liquid bags, RZ lysis buffer, anhydrous ethanol, chloroform, RNA extraction kit, test tube rack, and gloves, in a clean bench in advance and irradiate with ultraviolet light for 30 minutes. (2) Add 1 mL of lysis buffer RZ to each bottle of cells or weigh 70 mg of tissue, transfer to a 1.5 mL centrifuge tube, mix with a pipette, and let stand at room temperature for 5 minutes to allow for full lysis; (3) Add 200 μL of chloroform to each tube of cell lysis buffer, vortex and mix for 30 seconds, and let stand at room temperature for 3 minutes to allow for full reaction; (4) Turn on the centrifuge in advance, adjust the temperature to 4°C, and centrifuge at 12,000×g for 10 minutes. At this time, prepare a new 1.5 mL centrifuge tube and adsorption column CR3, and put CR3 on the collection tube, and mark the grouping with a marker; (5) After centrifugation, the liquid in the tube is divided into three layers. Gently use a 200 μL pipette to transfer the top aqueous phase to the pre-labeled centrifuge tube. The RNA is in the aqueous phase, and the volume of the aqueous phase is approximately 500 μL; (6) Add half the volume of ethanol to the centrifuge tube that has absorbed the aqueous phase, and invert the centrifuge tube to mix. After several times, transfer to the adsorption column CR3 marked with groups in advance, and centrifuge at 4°C, 12000×g for 30 seconds; (7) After centrifugation, pour out the waste liquid in the collection tube, add 500μL of eluent RD to the adsorption column CR3, and centrifuge at 4°C, 12000×g for 30 seconds; (8) After centrifugation, pour out the waste liquid in the collection tube, add 500μL of eluent RW to the adsorption column CR3, and centrifuge at 4°C, 12000×g for 30 seconds. Repeat the operation once; (9) After pouring out the waste liquid, do not add any liquid, centrifuge the adsorption column CR3 at 12000×g for 2 minutes, and completely remove the eluent on the adsorption column by centrifugation. After the centrifugation, let it stand at room temperature or place it in a fume hood for ventilation and drying for 5 minutes to make it fully dry, add RNase-free ddH2O, and let it stand at room temperature for 2 minutes; (10) Centrifuge at 4°C, 12000×g for 2 minutes. The resulting solution is RNA, which can be stored at -80°C.

[0046] 2. Determination of RNA Concentration and Quality

[0047] (1) Add 1 μL of H2O to the detection platform and adjust to zero; (2) Add 1 μL of RNA sample to the detection platform and perform concentration detection; (3) Read the A260 / 280 ratio and RNA concentration, record the results, and turn off the instrument.

[0048] 3. Reverse transcription

[0049] (1) Prepare RT reaction solution on ice according to Table 2; (2) Vortex the prepared RT reaction solution in the tube and mix it evenly. Centrifuge briefly to remove bubbles and perform reverse transcription reaction according to the conditions in Table 3. After the reverse transcription reaction is completed, RNA is reverse transcribed into cDNA, and the cDNA sample is stored in a -20°C refrigerator.

[0050] Table 2 Preparation of RT reaction solution

[0051] Reverse transcription reagents Usage Final concentration 5× PrimeScriptRTMasterMix 4μL 1× Total RNA * <![CDATA[RNaseFreedH2O]]> up to 20 μL

[0052] Note: *1 μg of total RNA is used in a 20 μL reaction system.

[0053] Table 3 Reverse transcription reaction conditions

[0054] Reverse transcription reaction temperature Reverse transcription reaction time 37℃ 15min, for reverse transcription reaction 85℃ 5sec 4℃ ∞

[0055] 4. Real-time fluorescence quantitative PCR reaction

[0056] (1) Prepare the reagents required for the PCR reaction in advance, prepare the reaction solution according to Table 4, and perform the reaction in an ice-cold constant temperature module; (2) Use a vortexer to oscillate and mix, centrifuge to completely remove bubbles, and perform PCR amplification. The procedure is as shown in Table 5.

[0057] Table 4 Preparation of reaction solution

[0058] Reagents Usage 2×SYBR Green PCR Master Mix 10μL 10 μM upstream primer 1μL 10 μM downstream primer 1μL cDNA 2μL <![CDATA[ddH2O]]> up to 20 μL

[0059] Table 5 PCR amplification program

[0060] Cycle steps temperature time Number of cycles Pre-denaturation 95℃ 2min 1 transsexual 95℃ 5sec 39 Annealing, extension 60℃, for collecting signals 10sec

[0061] 3. hsa_circ_0001360 overexpression and interference lentiviral infection of HTR-8 / SVneo cells

[0062] Take out the lentivirus from the -80°C ultra-low temperature freezer and place it in the cell-to-cell transfer window.

[0063] 1. Preliminary experiment of lentivirus infection in HTR-8 / SVneo cells

[0064] In order to clarify the efficiency of hsa_circ_0001360 overexpression and interference lentivirus infection of HTR-8 / SVneo cells and the optimal multi-infection index MOI value, the cells were divided into 10 groups based on MOI: MOI=0, MOI=1, MOI=2, MOI=5, MOI=10, MOI=20, MOI=30, MOI=40, MOI=50, MOI=100;

[0065] (1) Preparation of cell suspension: Dilute the cells to 1×10 in a culture medium containing 7% fetal bovine serum. 5 / mL, prepare a 96-well plate, add 100 μL of the diluted cell suspension to each well, repeat the experiment three times for each of the 10 groups of cells divided according to the MOI value, and culture at 37°C for 24 hours;

[0066] (2) Dilute the virus with culture medium to the following titers and corresponding MOI values, as shown in Table 6:

[0067] Table 6 Virus dilution titer and corresponding MOI value

[0068]

[0069] (3) Remove the cell culture supernatant from each well, add 90 μL of pure culture medium to each well except the MOI=0 group, then add 10 μL of virus of corresponding titer, and mix well. Add 100 μL of pure culture medium to the MOI=0 group, and continue to place the 96-well plate in a 37°C cell culture incubator for 24 h;

[0070] (4) 24 hours after virus infection, the cell culture medium to which the virus has been added is removed with a pipette, and a culture medium with a fetal bovine serum concentration of 10% is added, and the culture is continued for 24 to 48 hours. The present invention is cultured for 36 hours, during which the cell status and the fluorescence expression of the virus transferred into the cells are monitored in real time using a fluorescent inverted microscope. When the fluorescence expression efficiency is above 80% and the cell status is good, the MOI corresponding to the group is the optimal MOI value for the virus to infect HTR-8 / SVneo cells.

[0071] 2. Lentivirus formally infects HTR-8 / SVneo cells

[0072] Before the lentivirus officially infects cells, a preliminary experiment must be performed to determine the optimal MOI value.

[0073] (1) Day 1: Inoculation of cells. Prepare 1640 medium containing 10% fetal bovine serum. Digest the adherent cells with trypsin and dilute the cells directly with the medium to a cell suspension of 3 to 5 × 10 cells / mL. Inoculate the cells into a 6-well plate according to Table 7.

[0074] Table 7 Inoculation specifications

[0075] Specification Bottom area Inoculation volume 96-well plate <![CDATA[0.32cm 2 ]]> 0.10~0.20mL 24-well plate <![CDATA[1.90cm 2 ]]> 0.38~5.7mL 12-well plate <![CDATA[3.80cm 2 ]]> 0.76~1.14mL 6-well plate <![CDATA[9.50cm 2 ]]> 1.90~2.90mL T25 bottle <![CDATA[25.00cm 2 ]]> 5.00~7.50mL

[0076] (2) Day 2: Virus infection. Transfect the virus according to the conditions determined in the preliminary experiment and calculate according to the following formula:

[0077]

[0078] After adding the corresponding lentivirus according to the above formula, add the transfection reagent Polybrene (calculated according to the culture solution added to the six-well plate to a final concentration of 5 μg / mL), and continue culturing;

[0079] (3) Observe the fluorescence transfection efficiency. The fluorescence efficiency was observed according to the time when the cells were infected with the virus with the highest efficiency in the preliminary experiment. During this period, the culture medium was replaced, that is, the culture medium with the virus added was discarded and new culture medium was added to maintain a high cell activity;

[0080] (4) Puromycin cell selection. After the lentivirus-infected cells enter the logarithmic growth phase, add 2 μg / mL of puromycin to the culture medium to screen the cells successfully infected with the lentivirus and remove the cells that failed to be infected. When the fluorescence efficiency reaches 80% and the density reaches 80%, transfer the cells in the six-well plate to a 25T culture flask for culture. At this time, a stable cell line infected with hsa_circ_0001360 overexpression and interference lentivirus has been constructed. Cell subculture can be performed to expand the culture volume for seed preservation and subsequent experiments;

[0081] (5) qRT-PCR was used to verify the viral transfection effect and conduct subsequent experimental research.

[0082] IV. Fluorescence in situ hybridization

[0083] (1) Before the experiment, the cells were inoculated in a laser confocal dish and cultured with 1 mL of complete culture medium to ensure that the cell density reached about 50% during the experiment; the reagents and materials required for the experiment were prepared in advance: circular RNA probe, internal reference: 18S and U6 probes, pre-hybridization solution, hybridization solution, 4% paraformaldehyde, permeabilization solution SSC, waste liquid tube, micropipette shaker, etc.; (2) After taking out the cells, 1× PBS was added to the confocal dish, and the cells were washed on a shaker at 70 rpm for 5 minutes, and then 4% paraformaldehyde was allowed to stand at room temperature for 10 minutes to fix the cells on the confocal dish; (3) The permeabilization solution was prepared, and the permeabilization solution contained 0.5% Triton X-100 PBS was placed in a 4°C refrigerator for later use; (4) After the cells were fixed, the cells were washed with 1× PBS on a shaker at 70 rpm for 5 min, repeated 3 times, and 1 mL of pre-cooled permeabilization solution was added and placed in a 4°C environment for 5 min; (5) The permeabilization solution was discarded and the cells were washed with 1× PBS on a shaker at 70 rpm for 5 min, repeated 3 times; (6) The pre-hybridization solution was placed at 37°C for 1 h in advance, and the pre-heated pre-hybridization solution was added to the confocal dish. 00μL, place in a 37℃ incubator for 30min for blocking; (7) During pre-hybridization, preheat the hybridization solution at 37℃; (8) In the dark, take 100μL of pre-heated hybridization solution, add 2.5μL of circular RNA probe and 2.5μL of internal reference probe, mix well, then add the mixture to the confocal dish and place in a 37℃ incubator for 30h to allow the probe to fully bind to the cytoplasm or nucleus; (9) Preheat the hybridization wash solution I in a 42℃ environment in advance, discard the confocal dish After the cells were washed with hybridization solution I on a shaker at 70 rpm for 5 min, this was repeated 3 times to reduce the background signal. This step was performed in the dark. (10) Hybridization solution II was preheated in a 42°C environment, hybridization solution I in the confocal dish was discarded, and the cells were washed with hybridization solution II on a shaker at 70 rpm for 5 min. This step was performed in the dark. (11) Hybridization solution II was preheated in a 42°C environment, hybridization solution I in the confocal dish was discarded, and hybridization solution II was used to wash the cells on a shaker at 70 rpm. Wash the cells at 70 rpm on a shaker for 5 min. This step is performed in the dark. (12) Recover 1×PBS to room temperature in advance and wash the cells for 5 min. This step is performed in the dark. (13) Add 1×DAPI staining solution to the confocal dish in the dark and stain for 10 min. (14) Wash the cells with 1×PBS at 70 rpm on a shaker in the dark for 5 min. Repeat 3 times. Add sealing agent to the center of the confocal dish and detect with a laser confocal microscope. Among them, hybridization wash solution I and hybridization wash solution II are both reagents in the Guangzhou Jisai Fish kit.

[0084] 5. Extraction of Cell Genomic DNA

[0085] (1) Place the items needed for DNA extraction, such as micro-pipette pipettes of various specifications, boxed sterile pipette tips, waste liquid bags, DNA extraction kits, EP tube racks, and gloves, in the clean bench in advance and expose to ultraviolet light for 30 minutes. Turn on the water bath to 70°C in advance. (2) HTR-8 / SVneo cells with good growth conditions were selected for genomic DNA extraction. 1 mL of PBS was added to the adherent cells, which were scraped off the bottle wall with a cell scraper and transferred to a 1.5 mL centrifuge tube. The cell pellet was collected after centrifugation at 10,000 rpm for 1 min. (3) 200 μL of buffer GA was added to the tube, and the mixture was mixed by vortexing. Then 200 μL of cell lysis solution Proteinase K was added to the tube and mixed. (4) 200 μL of GB was added to the tube, and the mixture was mixed by vortexing. The mixture was reacted at 70°C for 10 min. (5) 200 μL of ethanol was added to the tube, and the mixture was mixed by vortexing for 15 sec. (6) All the above solutions were transferred to the adsorption column CB3, and the adsorption column was placed in the collection tube. The mixture was centrifuged at 12,000 rpm for 30 sec. The waste liquid was discarded and repeated once. (7) The mixture was centrifuged at 12,000 rpm for 2 min and the waste liquid was discarded. Let stand at room temperature for 5 minutes; (8) prepare a new centrifuge tube, transfer CB3 to the centrifuge tube, add 100 μL of elution buffer TE, let stand at room temperature for 3 minutes, and centrifuge at 12,000 rpm for 2 minutes. The resulting solution is the cell genomic DNA, which should be stored in a -20°C refrigerator for later use.

[0086] 6. Agarose gel electrophoresis

[0087] (1) Dilute 50× TAE solution with up water at a ratio of 1:49 to make 1× TAE; (2) Add 40 mg of agarose powder to 20 mL of 1× TAE solution to prepare a 2% agarose gel solution, shake well, and heat it in a microwave oven on medium heat to fully dissolve it. The solution should be transparent at this time, and add 1 μL of nucleic acid dye EB; (3) Fix the gel plate, insert the comb, pour the prepared solution into the agarose gel electrophoresis tank, let it stand for 20 minutes to allow it to fully solidify, and pull out the comb; (4) Fill the tank with 1× TAE solution; (5) Add the sample to the spotting well and perform electrophoresis at 150 V for about 20 minutes; (6) After the electrophoresis is completed, place the gel on an exposure instrument for exposure to obtain the electrophoresis results.

[0088] VII. Nuclear and Cytoplasmic RNA Isolation

[0089] (1) Collect 10 7(1) Place freshly cultured HTR-8 / SVneo cells on ice and wash once with pre-cooled PBS; (2) Add 1 mL of trypsin to digest the HTR-8 / SVneo cells, blow evenly with culture medium and transfer to a 1.5 mL enzyme-free centrifuge tube; (3) Turn on the centrifuge to 4°C in advance, centrifuge at 1000 rpm to precipitate the cells, discard the culture medium, wash once with PBS and centrifuge on ice; (4) Discard PBS, add 500 μL of ice-cold cell separation buffer, and gently flick the tube wall to loosen the cells; (5) Incubate on ice for 10 min, centrifuge at 4°C and 500 g for 5 min n, pipette the supernatant containing cytoplasmic components into an RNase-free tube and place it at -20°C for later use; (6) add 500 μL of ice-cold cell disruption buffer to the nuclear pellet, use a vortexer to vigorously shake and mix to lyse the cell nuclei, and place it on ice for later use; (7) add an equal volume of 2×Lysis / Binding Solution to the supernatant and cell disruption buffer, the supernatant contains cytoplasm, and the cell disruption buffer contains nuclei, invert and mix, and this process is carried out at room temperature; (8) add an equal volume of anhydrous ethanol to the above mixture, invert and mix; (9) Filter The cartridge filter was placed in a collection tube, the mixture was transferred to the filter, centrifuged for 1 min, and the waste liquid was discarded; (10) 700 μL of Wash Solution I was added, centrifuged for 1 min, and the waste liquid was discarded; (11) 500 μL of Wash Solution II / III was added, centrifuged for 1 min, and the waste liquid was discarded, and repeated once; (12) Empty centrifugation was performed once to completely remove Wash Solution II / III; (13) The Elution Solution was placed in a water bath and heated to 95°C in advance; (14) The Elution Solution was preheated to 95°C in advance, the filter was placed in a new centrifuge tube, 60 μL of Elution Solution was added, centrifuged for 1 min, and RNA was recovered; (15) 60 μL of Elution Solution was added again, centrifuged for 1 min, and RNA was recovered; (16) The obtained RNA was stored in a -80°C refrigerator for subsequent experiments. Wash Solution I, Wash Solution II / III, and Elution Solution are all reagents in the Invitrogen nuclear cytoplasmic separation kit.

[0090] 8. RNase R digestion experiment

[0091] (1) Extract RNA from HTR-8 / SVneo cells; (2) Divide the extracted RNA into two equal parts, one part is digested with RNase R, and the other part is left untreated; (3) Prepare the reaction system according to Table 8; (4) Digest in a gradient thermal cycler at 37°C for 30 min, and then keep at 70°C for 10 min; (5) Perform reverse transcription reaction as in Experiment 2; (6) Perform qRT-PCR reaction as in Experiment 2, and analyze the experimental results.

[0092] Table 8 Reaction system

[0093] Reagents Dosage RNA 3μg 10×ReactionBuffer 2μL RNaseR (20U / μL) (not added in the control group) 3U / μgRNA~4U / μgRNA RNase-FreeWater Up to 20 μL

[0094] IX. Actinomycin D Experiment

[0095] (1) Inoculate cells in a six-well plate in advance; (2) When the cell density reaches about 60%, add 2 μg / mL actinomycin D and collect cells at 0 h, 4 h, 8 h, 12 h, and 24 h of action; (3) Extract cellular RNA after actinomycin D action for different time periods; (4) Detect the expression level of target circular RNA by qRT-PCR; (5) Analyze the attenuation effect of target gene mRNA over time.

[0096] 10. Enzyme-linked immunosorbent assay, abbreviated as ELISA

[0097] Process such as Fig.10 .

[0098] 11. RNA binding protein immunoprecipitation experiment, abbreviated as RIP

[0099] 1. Preparation of cell lysate

[0100] (1) Prepare RIP cell lysis buffer according to Table 9 based on the cell quantity; (2) Take out 3 bottles of cells, add 1 mL of cold PBS to each bottle, and wash the culture bottles twice; (3) Add 1 mL of PBS to each bottle of cells, scrape the cells and transfer them to a 1.5 mL centrifuge tube; (4) Turn on the centrifuge in advance, adjust the temperature to 4°C, centrifuge the cells at 1500 rpm for 5 minutes, discard the supernatant and collect the cell pellet. At this time, the 3 bottles of cells are combined into 1 tube; (5) Add 300 μL RIP cell lysis buffer to the cell pellet, vortex and mix well, and let it stand on the pre-cooling module for 5 minutes; (6) The obtained lysate is stored in a -80°C refrigerator for later use. Each group requires 2 tubes, namely the target and IgG.

[0101] Table 9 RIP cell lysate

[0102]

[0103]

[0104] 2. Prepare magnetic beads for RIP experiments

[0105] (1) Invert and mix the magnetic beads until they are completely dispersed; (2) Pipette 50 μL of the magnetic bead suspension into a centrifuge tube, add 500 μL of RIP Wash Buffer, vortex and mix, place on a magnetic rack, aspirate the supernatant, and repeat this step once; (3) Add 100 μL of RIP Wash Buffer and 5 μg of antibody, and incubate on a shaker at 4°C for 4 h; (4) Aspirate the supernatant, add 500 μL of RIP Wash Buffer to each tube, vortex and mix, then discard the supernatant, and repeat this step once (5) Add 500 μL of RIP Wash Buffer to each tube, vortex and mix, then place on ice for later use.

[0106] 3. Immunoprecipitation

[0107] (1) Prepare RIP immunoprecipitation buffer in advance according to Table 10; (2) Place the centrifuge tube from the previous step on a magnetic rack, discard the supernatant, and add 900 μL RIP immunoprecipitation buffer to each tube; (3) Take out the cell lysate prepared in the first step, thaw it, and centrifuge it at 14,000 rpm and 4°C for 10 min; aspirate 100 μL of the supernatant into the magnetic bead-antibody complex to make the total volume 1 mL; (4) Incubate at 4°C overnight. At the same time, take out 30 μL of the supernatant of the RIP lysate, put it into a new tube as input, and store it at -80°C until the RNA purification step begins; (5) Centrifuge briefly, discard the supernatant, add 500 μL RIP Wash Buffer, vortex and mix well, place the EP tube on a magnetic rack, discard the supernatant, and repeat the washing 6 times.

[0108] Table 10 RIP immunoprecipitation buffer

[0109] RIP reagent ×1 ×N RIP Wash Buffer 860μL 860μL×N 0.5M EDTA 35μL 35μL×N RNase inhibitors 5μL 5μL×N total 900μL 900μL×N

[0110] Note: Label the prepared RIP immunoprecipitation buffer and store it on ice.

[0111] 4. RNA Purification

[0112] (1) Prepare Proteinase K Buffer according to Table 11 in advance; (2) Add 150 μL Proteinase K Buffer solution to each tube to resuspend the above complex, and incubate all tubes at 55°C for 30 min to digest the protein; (3) Centrifuge briefly and transfer the supernatant to another new centrifuge tube; (4) Add 250 μL RIP Wash to the supernatant in each tube. Buffer; (5) During the shaking incubation, prepare 400 μL of a mixed solution of phenol: chloroform: isoamyl alcohol in a ratio of 25:24:1 for each tube in advance, add 400 μL of this mixed solution to the solution in the previous step, vortex and mix for 15 seconds, and centrifuge at room temperature and 14000 rpm for 10 minutes; (6) Pipette 350 μL of the upper aqueous phase into a new centrifuge tube, add 400 μL of chloroform, vortex and mix for 15 seconds, and centrifuge at 14000 rpm for 10 minutes; (7) Pipette 300 μL of the upper aqueous phase into a new tube, add 50 μL of Salt SolutionⅠ, 15 μL of Salt SolutionⅡ, and 5 μL of Precipitate to each tube respectively. Enhancer, 850 μL of anhydrous ethanol, mix well, and place at -80℃ for 30 hours; (8) Centrifuge at 14000rpm, 4℃ for 30 minutes, and remove the supernatant; (9) Rinse once with 80% ethanol, centrifuge at 14000rpm, 4℃ for 15 minutes, remove the supernatant, and dry; (10) Add 15 μL of DEPC water or RNase-free water to dissolve, and store at -80℃. (11) Perform reverse transcription, and reverse transcribe the obtained RNA into CDNA; (12) Amplify by PCR and calculate the results.

[0113] Table 11 Preparation of Proteinase K Buffer

[0114] RIP reagent ×1 ×N RIPWashBuffer 117μL 117μL×N 10% SDS 15μL 15μL×N Proteinase K 18μL 18μL×N total 150μL 150μL×N

[0115] 12. RNA pull down experiment

[0116] (1) Sample processing: After collecting the cells, transfer them to a 1.5 mL EP tube, add 500 μL of lysis buffer, protease inhibitors and RNase inhibitors, alternately shake and keep still for 3 times, centrifuge to obtain the supernatant, and store at -80°C; (2) Take 100 μL of protein A+G magnetic beads in a 1.5 mL centrifuge tube, add 1 mL of binding buffer to resuspend the magnetic beads, place the centrifuge tube on a magnetic rack, repeat washing 3 times, add 1 mL of reaction solution to resuspend the magnetic beads, add 5 μg of antibody, and incubate on a shaker at 4°C for 1.5 h. After the reaction is complete, add 1 mL of binding buffer, vortex and mix, place the EP tube on a magnetic rack, centrifuge and discard the supernatant, and repeat this step 3 times; (3) Add 400 μL of binding buffer and 400 μL of cell lysis buffer to the above-mentioned magnetic bead-antibody complex, and react on a shaker at 4°C for 2 h. (4) After the reaction is completed, add 1 mL of washing solution and vortex for 15 times. After washing, centrifuge and discard the supernatant; (5) Extract protein and RNA. Fig.11 .

[0117] 13. Mass spectrometry analysis technology

[0118] 1. Protease cleavage: (1) Add 4 μL of 0.05M TCEP solution to the protein solution and keep the reaction at 60°C for 1 hour; (2) After the reaction, add 2 μL of 55mM MMTS solution and react at room temperature in the dark for 45 minutes; (3) Add the protein solution to a 10KDa ultrafiltration tube and centrifuge at 12000g for 20 minutes; (4) Add 100 μL of urea (urea concentration is 8 mol / L, pH is 8.5) solution and centrifuge at 12000g for 20 minutes, centrifuge twice; (5) Add 100 μL of 0.25M TEAB and centrifuge at 12000g for 20 minutes, repeat 3 times; (6) Add 50 μL of 0.5M TEAB, add 2% pancreatic enzyme, the ratio of pancreatic enzyme to protein is 1:50, and incubate at 37°C overnight, i.e. 12 h; (7) the next day, add 1% pancreatic enzyme, the ratio of pancreatic enzyme to protein is 1:100, and incubate at 37°C for 4 h; (8) replace a new collection tube, collect the filtrate by centrifugation, and dry it under low temperature vacuum.

[0119] 2. Mass spectrometry detection

[0120] (1) The peptide fragments were dissolved in a sample dissolving solution containing 0.1% formic acid and 2% acetonitrile, and centrifuged at 13200 rpm and 4°C for 20 min. The supernatant was collected and subjected to mass spectrometry identification.

[0121] (2) Liquid phase parameters

[0122] Column Information:

[0123] 300um idx 5mm, Acclaim PepMap RSLC C18, 5um, (Thermo,160454)

[0124] Acclaim PepMap 75um X 150mm, C18, 3um, (Thermo,160321)

[0125] Mobile phase information: Mobile phase A: 0.1% formic acid, mobile phase B: 0.1% formic acid, 80% CAN; flow rate: 300nL / min; analysis time: 45min

[0126] The effective gradient is shown in Table 12: Phase B rises from 5% to 90%

[0127] Table 12 Effective gradient

[0128] time Phase B 0 5％ 5 5％ 25 50％ 30 50％ 35 90％ 45 5％

[0129] 3. Mass spectrometry detection

[0130] The separated peptides directly enter the mass spectrometer for online detection.

[0131] Statistical methods: All results were quantitative data, expressed as mean ± standard deviation (x ± s). The independent sample t test was used for comparison between the two groups, one-way analysis of variance was used for comparison between multiple groups, and Student-Newman-Keuls test was used for multiple comparisons between groups. P ≤ 0.05 was considered statistically significant.

[0132] result

[0133] 1. Expression of inflammatory-related factors in placental tissue of PE patients

[0134] In order to clarify the involvement of inflammatory response in the occurrence and development of PE, placental tissues of 30 PE and 30 PC patients were collected, total RNA was extracted, and qRT-PCR was used to detect the mRNA expression levels of pro-inflammatory factors IL-1β, IL-6, IL-8, TNF-α and anti-inflammatory factors IL-10. The results showed that the mRNA expression levels of pro-inflammatory factors IL-1β, IL-6, IL-8, and TNF-α in the placental tissues of PE patients were significantly increased, but the mRNA expression level of anti-inflammatory factor IL-10 did not change significantly, suggesting that over-activated inflammatory response is an important mechanism for the occurrence of PE. Figure 1 .

[0135] 2. Effects of hypoxia on the mRNA expression levels and concentrations of inflammatory-related factors in HTR-8 / SVneo cells

[0136] In order to further clarify the role of inflammatory response in PE, HTR-8 / SVneo cells were cultured in vitro. When the cell density reached about 60%, cells in good growth state were selected to be hypoxic for 6h, 12h, 18h, and 24h, respectively. qRT-PCR was used to detect the mRNA expression levels of inflammatory-related factors after hypoxia for different time periods; ELISA was used to detect the changes in the concentrations of inflammatory-related factors in the cell culture medium. The results showed that the mRNA expression levels of IL-1β, IL-6, IL-8, and TNF-α in HTR-8 / SVneo cells were significantly increased after hypoxia, and the concentrations of IL-1β, IL-6, and TNF-α were also significantly increased, and all reached the highest level at 12h, indicating that the inflammatory response of trophoblasts was activated when PE occurred, such as Figure 2 .

[0137] 3. CircRNA sequencing to screen for differentially expressed circRNAs in placental tissues of PE patients

[0138] The research team previously performed CircRNA sequencing on 10 pairs of placental tissues from PC and PE patients, and screened out CircRNAs related to inflammation and differentially expressed in placental tissues through GO functional analysis and KEGG pathway enrichment analysis. The results showed that there were 8 CircRNAs with significant differences, including 2 upregulated CircRNAs and 6 downregulated CircRNAs, such as Figure 3 .

[0139] 4. qRT-PCR detection of differentially expressed CircRNAs in placental tissue

[0140] qRT-PCR was used to further detect the expression of differentially expressed CircRNAs in the cluster heat map in placental tissues. The results showed that the expression of hsa_circ_0003247 and hsa_circ_0001360 was significantly increased in PE placental tissues, and the expression of hsa_circ_PHLDB2 was significantly decreased, which was consistent with the sequencing results. The expression of hsa_circ_0000657 and hsa_circ_AMOTL1 was upregulated in PE placental tissues, which was inconsistent with the sequencing results. Figure 4 Therefore, subsequent studies will focus on hsa_circ_0003247, hsa_circ_0001360, and hsa_circ_PHLDB2.

[0141] 5. qRT-PCR detection of differentially expressed CircRNAs in HTR-8 / SVneo cells

[0142] The differentially expressed circular RNA hsa_circ_0003247, hsa_circ_0001360, and hsa_circ_PHLDB2 screened in placental tissue were further screened and verified in HTR-8 / SVneo cells. The results of qRT-PCR showed that the expression of CircRNAs hsa_circ_0003247 and hsa_circ_0001360 increased significantly after hypoxia (P < 0.01), and the expression level of hsa_circ_PHLDB2 decreased significantly (P < 0.05). Among them, the expression change of hsa_circ_0001360 was the most obvious. Figure 5 Therefore, the role of hsa_circ_0001360 in the inflammatory response of PE placental trophoblasts was explored in the follow-up.

[0143] 6. Structure and stability of hsa_circ_0001360

[0144] By querying the circbase database, we know that the parent gene of hsa_circ_0001360 is PHC3, which is located on chromosome 3. It is a 258bp circRNA spliced ​​from exon 5 and exon 6. Sanger sequencing shows that its splicing site is GA, see Figure 6 A; After RNase treatment, the expression levels of hsa_circ_0001360 and the corresponding linear RNA PHC3 were detected. The results showed that hsa_circ_0001360 did not change significantly, while the corresponding linear RNA was obviously degraded. Figure 6 B. After HTR-8 / SVneo cells were treated with actinomycin D for 0h, 4h, 8h, 12h, and 24h, the expression of hsa_circ_0001360 and the corresponding linear RNA PHC3 were detected. The results showed that the expression of hsa_circ_0001360 did not change significantly, while the corresponding linear RNA was significantly degraded as the duration of actinomycin D increased. Figure 6 C; In order to further verify that hsa_circ_0001360 has the characteristics of circularization, divergent and convergent primers were designed, and after ordinary PCR amplification, agarose gel electrophoresis was performed. The results showed that hsa_circ_0001360 could only be amplified in cDNA but not in gDNA. The above results all indicate that hsa_circ_0001360 has the characteristics of circularization and has good stability. Figure 6 .

[0145] 7. Subcellular localization of hsa_circ_0001360 in HTR-8 / SVneo cells

[0146] In order to clarify the expression and localization of hsa_circ_0001360 in trophoblasts, nuclear RNA and cytoplasmic RNA of HTR-8 / SVneo cells were extracted using a nuclear RNA isolation kit, and the expression of hsa_circ_0001360 was detected by qRT-PCR. The results showed that hsa_circ_0001360 was mainly located in the cytoplasm. At the same time, the distribution of hsa_circ_0001360 in the nucleus and cytoplasm was observed by RNAFISH experiment. The results showed that hsa_circ_0001360 was mostly located in the cytoplasm of HTR-8 / SVneo cells. The above results all indicate that hsa_circ_0001360 is mainly located in the cytoplasm, such as Figure 7 .

[0147] 8. Construction of hsa_circ_0001360 overexpression and interference stable cell lines

[0148] The sequence of the interfering lentivirus of hsa_circ_0001360 is as follows in Table 13:

[0149] Table 13 Interfering sequences of lentivirus

[0150]

[0151] In order to detect the role of hsa_circ_0001360 in the inflammatory response of placental trophoblast cells, HTR-8 / SVneo cells were first infected with hsa_circ_0001360 overexpression and interference lentiviruses to construct hsa_circ_0001360 overexpression stable cell lines and interference stable cell lines. Overexpression of hsa_circ_0001360 was recorded as OE-hsa_circ_0001360. Interference lentiviruses were synthesized according to different sites of the hsa_circ_0001360 gene, namely Sh1-hsa_circ_0001360, Sh2-hsa_circ_0001360, and Sh3-hsa_circ_0001360. The medium was changed after 24 hours of lentiviral infection of the stable cell line, and the fluorescence transfection efficiency was observed after 24 hours of continuous culture. The results showed that when the MOI value was 40, the fluorescence transfection efficiency of each group of cells was more than 80%, indicating that the stable cell line overexpressing and interfering with hsa_circ_0001360 was successfully constructed. Figure 8qRT-PCR was used to detect the expression level of hsa_circ_0001360 after overexpression and interference. The results showed that the overexpression effect of hsa_circ_0001360 was significant; and the three interfering lentiviruses all had obvious interference effects, among which Sh2-hsa_circ_0001360 had the most obvious interference effect. Fig. 9 C, so Sh2-hsa_circ_0001360 was used as the hsa_circ_0001360 interference group in subsequent experiments, denoted as Sh-hsa_circ_0001360. The above results suggest that the stable cell line overexpressing and interfering with hsa_circ_0001360 was successfully constructed. Fig. 9 .

[0152] 9. Effect of hsa_circ_0001360 on inflammatory response in HTR-8 / SVneo cells

[0153] In order to verify the role of hsa_circ_0001360 in the inflammatory response of placental trophoblast cells, on the basis of constructing stable overexpression and interference hsa_circ_0001360 cell lines, qRT-PCR and ELISA were used to detect the mRNA expression levels and concentration changes of inflammation-related factors. The results showed that after overexpression of hsa_circ_0001360, the mRNA levels of IL-1β, IL-6, IL-8, and TNF-α were significantly increased, and the concentrations of IL-1β, IL-6, and TNF-α were also significantly increased; after interference with hsa_circ_0001360, the mRNA levels of IL-1β, IL-6, IL-8, and TNF-α were significantly reduced, and the concentrations of IL-1β, IL-6, and TNF-α were also significantly reduced. Fig. 9 The above results suggest that hsa_circ_0001360 can promote the inflammatory response of placental trophoblast cells.

[0154] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0155] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0156] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of reagents for inhibiting the expression of circular RNAhsa_circ_0001360 in the preparation of drugs for treating preeclampsia.

2. The use according to claim 1, characterized in that: The reagent for inhibiting circular RNA hsa_circ_0001360 includes an interfering lentivirus of the hsa_circ_0001360 gene.

3. The use according to claim 2, characterized in that: The interfering lentivirus has a nucleotide sequence as shown in SEQ ID NO.2-3.

4. The use according to claim 2, characterized in that: The interfering lentivirus has a nucleotide sequence as shown in SEQ ID NO.4-5.

5. The use according to claim 2, characterized in that: The interfering lentivirus has a nucleotide sequence as shown in SEQ ID NO.6-7.

6. The use according to claim 2, characterized in that: The reagents for inhibiting circular RNA hsa_circ_0001360 also include a transfection aid reagent and a screening reagent for screening successful infection of the lentivirus.

7. The use according to claim 6, characterized in that: The transfection-assisting reagent is Polybrene.

8. The use according to claim 6, characterized in that: The screening agent is 1.8-2.2 μg / mL of puromycin.

9. The use according to claim 1, characterized in that: The drug suppresses inflammation.

10. The use according to claim 9, characterized in that: The drug inhibits inflammation of trophoblastic cells.

Images