Lactobacillus plantarum ZR002, fermentation product, preparation method and application thereof

Abstract

The invention provides a plant lactobacillus ZR002, a fermentation product and a preparation method and application thereof, and relates to the field of microorganisms and fermentation technology. The invention screens and obtains a plant lactobacillus ZR002 by itself, and the preservation number is CGMCC No: 32813. The plant lactobacillus ZR002 is used to ferment Grasse rose alone, and the content of active ingredients in the fermentation product is significantly increased, and the fermentation product has excellent moisturizing and anti-oxidation effects.

Description

Technical Field

[0001] The invention relates to the field of microorganisms and fermentation technology, and in particular to a Lactobacillus plantarum ZR002, a fermentation product, and a preparation method and application thereof. Background Art

[0002] Lactobacillus plantarum is a Gram-positive lactic acid bacterium that is widely found in nature, especially in fermented foods such as vegetables, meat products, dairy products and wine. It is also an important probiotic group in the human gastrointestinal tract and plays an important role in maintaining human health. Modern research has found that Lactobacillus plantarum plays an important role in fermented foods.

[0003] Grasse Rose (Rosa Centifolia), also known as May Rose or Thousand-Leaf Rose, is a very precious and famous rose variety, mainly produced in the small town of Grasse in southern France. This small town is located between the Mediterranean Sea and the Alps, with unique climatic conditions that are very suitable for the growth of flowers. Grasse Rose is famous for its unique honey-sweet aroma and complex aroma layers, and is known as the "Queen of Flowers". Grasse Rose is not only widely used in perfumes, but can also be used to make scented teas, essential oils and skin care products, and is widely used for physical and mental healing and beauty skin care.

[0004] At present, plant lactobacillus is mostly used in the food fermentation industry, and is less used in the cosmetics industry. It is generally fermented with plant lactobacillus and other strains. For example, Chinese invention patent CN202211321940.1 discloses a rose fermentation filtrate and its fermentation process, using plant lactobacillus, thermophilic streptococcus, adolescent bifidobacterium, long bifidobacterium as a composite lactic acid bacteria liquid for fermentation, the culture medium is rose, carbon source, vitamin, water, the fermented filtrate has a certain skin care effect, but the fermentation adopts composite flora fermentation, and the fermentation medium is additionally added with carbon source and vitamin, which makes it impossible to clarify the fermentation effect of plant lactobacillus. Summary of the invention

[0005] The purpose of the present invention is to provide a Lactobacillus plantarum ZR002, a fermentation product and a preparation method and application thereof in view of the deficiencies in the prior art. The present invention obtains a strain of Lactobacillus plantarum by screening, and utilizes the strain to ferment Grasse rose alone, so that the content of active ingredients in the fermentation product is significantly increased, and the moisturizing and antioxidant effects of the fermentation product are improved.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] On the one hand, a Lactobacillus plantarum ZR002, with a preservation number of CGMCCNo: 32813. The Lactobacillus plantarum ZR002 was obtained by layer-by-layer screening and separation from the soil of the Grasse Rose Base (36°12'00.00"N, 117°42'00.00"E) in Banmu Huatian, Jinan City, Shandong Province, and was identified as Lactobacillus plantarum by 16S rDNA strain identification, and its sequence is shown in SEQ ID NO.1, and is currently stored in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a preservation date of November 27, 2024.

[0008] On the other hand, a method for fermenting Grasse rose by using the above-mentioned Lactobacillus plantarum ZR002 comprises the following steps:

[0009] (1) Carrying out seed culture of Lactobacillus plantarum ZR002;

[0010] (2) The cultured Lactobacillus plantarum seed liquid is inoculated at a 5% inoculation rate and inoculated into a fermentation tank filled with Grasse rose fermentation medium for closed culture;

[0011] (3) After the fermentation culture has lasted for 48 hours, the fermentation broth is centrifuged to remove the bacteria, and then filtered through a plate and frame filter and a 0.45 μm filter membrane to obtain the filtrate of the product of Lactobacillus plantarum fermentation of Rose Grasse.

[0012] Optionally, in step (1), the seed culture process includes:

[0013] Seed activation culture: inoculate the freeze-dried powder or glycerol tube of Lactobacillus plantarum ZR002 onto the surface of the seed solid culture medium and culture in a closed environment at 37°C for 18-24h;

[0014] Primary seed culture: a single colony of Lactobacillus plantarum ZR002 was inoculated into a test tube of seed liquid culture medium and cultured in a closed environment at 37°C for 18-24h;

[0015] Secondary seed culture: Inoculate 3% of the inoculum into a blue-capped bottle of seed liquid culture medium and culture in a sealed container at 37°C for 18-24 hours.

[0016] Optionally, the seed solid culture medium formula is: take 45-55 g of MRS broth medium and 15-20 g of agar, add them to 1.0 L of purified water, sterilize in an autoclave at 118° C. for 15 min, to obtain a seed solid culture medium.

[0017] Optionally, the seed liquid culture medium formula is: take 45-55g of MRS broth culture medium, add it to 1.0L of purified water, sterilize it in an autoclave at 118°C for 15min, and obtain the seed liquid culture medium.

[0018] Optionally, in step (2), the formula of the Grasse rose fermentation medium is as follows: 0.9-1.1 parts of Grasse rose powder is added to 10 parts of purified water, and the mixture is sterilized at 115° C. for 15 min to obtain the fermentation medium.

[0019] Optionally, in step (2), the fermentation conditions are: temperature 35-37° C., rotation speed 50-70 r / min.

[0020] Optionally, in step (3), the rotation speed during the centrifugation process is 14000-15000 r / min.

[0021] In another aspect, a Lactobacillus plantarum ZR002 fermentation product is prepared by the above-mentioned method of fermenting Grasse rose with Lactobacillus plantarum ZR002.

[0022] In another aspect, the above-mentioned Lactobacillus plantarum ZR002 or the fermentation product of Lactobacillus plantarum ZR002 is used in the preparation of moisturizing and antioxidant cosmetics.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] 1. The plant lactobacillus ZR002 isolated by screening of the present invention has a preservation number of CGMCC No: 32813; the plant lactobacillus ZR002 is obtained by screening and separation layer by layer from the soil of the Grasse rose base in Banmu Flower Field.

[0025] 2. The plant lactobacillus ZR002 screened and isolated by the present invention has a good fermentation ability. When the strain is used to ferment Grasse rose alone, and the substrate is a single Grasse rose, the content of active substances in the fermentation product is greatly improved, which is significantly higher than the fermentation products of other strains, solving the problem of low increase in the content of plant active substances in traditional plant lactobacillus fermentation.

[0026] 3. The product of fermenting Rose Grasse with Lactobacillus plantarum ZR002 screened and isolated by the present invention can be used to regulate skin microecology, has good moisturizing and antioxidant effects, and can be widely used in the fields of daily chemicals and medicine.

[0027] 4. The present invention is the first to use single Lactobacillus plantarum ZR002 to ferment Grasse rose and obtain a product with excellent skin care effect, which fills the experimental data on the skin care effect of products of Grasse rose fermented with single Lactobacillus plantarum, and promotes the large-scale application of Lactobacillus plantarum fermentation products in the field of daily chemicals. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a flow chart of the fermentation of Grasse Rose by Lactobacillus plantarum;

[0029] Figure 2 This is a typical diagram of moisturizing effect; the dotted line in the figure is the quantitative area;

[0030] Figure 3 This is a pixel map of the tail area in the moisturizing efficacy test; in the figure, * indicates p<0.05 compared with the model control group, and *** indicates p<0.01 compared with the model control group. DETAILED DESCRIPTION

[0031] The following non-limiting examples can enable those skilled in the art to more fully understand the present invention, but do not limit the present invention in any way. The following content is only an exemplary description of the scope of the present invention, and those skilled in the art can make various changes and modifications to the invention of the present invention based on the disclosed content, and they should also fall within the scope of the present invention.

[0032] The present invention is further described below by way of specific examples. Unless otherwise specified, the various chemical reagents used in the examples of the present invention are obtained through conventional commercial channels.

[0033] Example 1

[0034] The screening and separation method of Lactobacillus plantarum ZR002 comprises the following steps:

[0035] S1. Select 10 g of soil from a depth of 10-20 cm, add 100 mL of physiological saline and mix well to obtain a soil suspension.

[0036] S2. Dilute 1 mL of soil suspension 10 times with sterile water, then take 100 μL of the diluted soil suspension and drop it on the MRS solid medium, spread it evenly, invert and seal it at 37°C and culture it overnight;

[0037] The formula of MRS solid culture medium is as follows: trypticase 10 g / L, beef extract powder 5 g / L, yeast powder 4 g / L, glucose 20 g / L, sodium acetate 5 g / L, triammine citrate 2 g / L, Tween 80 1 g / L, dipotassium hydrogen phosphate 2 g / L, magnesium sulfate 0.2 g / L, and manganese sulfate 0.05 g / L.

[0038] S3. The morphology of individual colonies on the culture medium was observed, including the color, size, edge and surface roughness of the colonies. Five strains were screened and fermented with Rose Grasse respectively. The changes in the content of active substances before and after fermentation were detected. Finally, strain ZR002, which can significantly increase the content of plant active substances, was screened out. The strain was identified as Lactobacillus plantarum through 16S rDNA strain identification. Its sequence is shown in SEQ ID NO.1:

[0039] GTATTGATTGGTGCTTGCATCATGATTTACATTTGAGTGAGTGGCGAACTGGTGAGTAACACGTGGGAAACCTGCCCAGA

[0040] AGCGGGGGATAACACCTGGAAACAGATGCTAATACCGCATAACAACTTGGACCGCATGGTCCGAGYTTGAAAGATGGCTT

[0041] CGGCTATCACTTTTGGATGGTCCCGCGGCGTATTAGCTAGATGGTGRGGTAACGGCTCACCATGGCAATGATACGTAGCC

[0042] GACCTGAGAGGGTAATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCA

[0043] CAATGGACGAAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAACTCTGTTGTTAAAGAAGA

[0044] ACATATCTGAGAGTAACTGTTCAGGTATTGACGGTATTTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGT

[0045] AATACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGC

[0046] CTTCGGCTCAACCGAAGAAGTGCATCGGAAACTGGGARACTTGAGTGCAGAAGAGGACAGTGGAACTCCATGTGTAGCGG

[0047] TGAAATGCGTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTGTCTGGTCTGTAACTGACGCTGAGGCTCGAAAGTA

[0048] TGGGTAGCAAACAGGATTAGATACCCTGGTAGTCCATACCGTAAACGATGAATGCTAAGTGTTGGAGGGTTTCCGCCCTT

[0049] CAGTGCTGCAGCTAACGCATTAAGCATTCCGCCTGGGGAGTACGGCCGCAAGGCTGAAACTCAAAGGAATTGACGGGGGC

[0050] CCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCTACGCGAAGAACCTTACCAGGTCTTGACATACTATGCAAATCT

[0051] AAGAGATTAGACGTTCCCTTCGGGGACATGGATACAG.

[0052] The above five strains are C1, C2, C3, C4 and ZR002. The experimental steps of fermenting Grasse rose with five strains (the process of fermenting Grasse rose with Lactobacillus plantarum is as follows Figure 1 As shown) are as follows:

[0053] (1) Actual consumption of materials:

[0054] Put Grasse rose powder (fresh flowers are vacuum freeze-dried and then crushed) into the fermentation tank, add 1 part of powder to 10 parts of purified water, and sterilize at 115℃ for 15 minutes;

[0055] (2) Seed cultivation, including:

[0056] Seed activation culture: inoculate the lyophilized powder or glycerol tube of the strain onto the surface of the seed solid culture medium and culture in a closed environment at 37°C for 18-24h;

[0057] Primary seed culture: a single colony is inoculated into a test tube containing 5 mL of seed liquid culture medium and cultured in a sealed container at 37°C for 24 h;

[0058] Secondary seed culture: 3% inoculum was inoculated into a 500 mL blue-capped bottle containing 450 mL of seed liquid culture medium and cultured in a sealed container at 37°C for 24 h;

[0059] The formula of the seed solid culture medium is as follows: 49.3 g of MRS broth medium and 20.0 g of agar are added to 1.0 L of purified water, and sterilized in an autoclave at 118° C. for 15 min to obtain the seed solid culture medium.

[0060] The formula of seed liquid culture medium is as follows: take 49.3 g of MRS broth culture medium (Shanghai Bowei Biotechnology Co., Ltd.), add it to 1.0 liter of purified water, sterilize it in an autoclave at 118°C for 15 minutes, and obtain seed liquid culture medium.

[0061] (3) Fermentation culture

[0062] The cultured seed liquid was inoculated at 5% and inoculated into a fermentation tank filled with fermentation medium at a culture temperature of 37°C.

[0063] The fermentation medium formula is:

[0064] Formula of Grasse rose fermentation medium: 1 part of Grasse rose powder is added to 10 parts of purified water, and the fermentation medium is obtained after sterilization at 115℃ for 15 minutes;

[0065] Formula of Grasse rose peptone fermentation medium: 0.8 parts of Grasse rose powder and 0.2 parts of peptone are added to 10 parts of purified water, and the fermentation medium is obtained after sterilization at 115°C for 15 min.

[0066] (4) After the fermentation culture has lasted for 48 hours, the fermentation broth is centrifuged at 14,000 rpm / min using a tubular centrifuge to remove the bacteria, and then plate and frame filtration is performed, and then the filtrate of the product of Lactobacillus plantarum fermentation of Rose Grasse is obtained, which is the Lactobacillus plantarum fermentation product.

[0067] According to the above experimental steps of fermenting Grasse rose, the following experiments were carried out:

[0068] Experiment 1: strains C1, C2, C3, C4, and ZR002 were used to ferment Grasse rose respectively, and the fermentation medium was Grasse rose fermentation medium;

[0069] Experiment 2: Five strains C1, C2, C3, C4, and ZR002 were used to ferment Grasse rose using a composite bacterial agent. The fermentation medium was Grasse rose fermentation medium.

[0070] Experiment 3: strains C1, C2, C3, C4, and ZR002 fermented Rose Grasse and peptone, respectively, and the fermentation medium was Rose Grasse peptone fermentation medium;

[0071] Experiment 4: Five strains C1, C2, C3, C4, and ZR002 were used to form a composite fermentation agent of Rose Grasse and peptone, and the fermentation medium was Rose Grasse peptone fermentation medium;

[0072] Comparative experiment: Chinese invention patent CN202211321940.1 rose fermentation filtrate.

[0073] Test Example 1

[0074] Active ingredient testing

[0075] In each experiment of Test Example 1, the filtrate of the product of Lactobacillus plantarum fermentation of Rose Grasse (hereinafter referred to as fermentation filtrate) was obtained, the contents of flavonoids, polyphenols and reducing sugars in the fermentation medium and the fermentation filtrate were tested, and the increase rate of active ingredients in the fermentation filtrate was calculated; wherein,

[0076] Polyphenol content determination: Folin-Ciocalten method was used.

[0077] Flavonoids content determination: using spectrophotometry.

[0078] Polysaccharide content determination: anthrone-sulfuric acid method was used.

[0079] The results are shown in Tables 1-3 below.

[0080] Table 1. Increase rate of active ingredients in fermentation filtrate of Experiment 1

[0081]

[0082] Table 2. Increase rate of active ingredients in fermentation filtrate of Experiment 3

[0083]

[0084] Table 3. Increase rate of active ingredients in fermentation filtrate of Experiments 2, 4 and Comparative Experiments

[0085]

[0086] From the above results, it can be seen that compared with other strains, strain ZR002 can significantly increase the content of active substances by fermenting a single substrate, Grasse Rose, while the loss of polysaccharide content is small. As shown in Table 1, the flavonoids and polyphenols in the fermentation filtrate obtained by strain ZR002 fermenting a single substrate, Grasse Rose, increased by 41.6% and 139.8% compared with before fermentation, and the polysaccharide content only decreased by 5%; the content of anthocyanins and reducing sugars in the fermentation filtrate was detected and found to be increased by 24.4% and 2.04% respectively (not given in the table). However, the flavonoid content of rose after fermentation in Chinese invention patent CN202211321940.1 increased by 27.7%, which is significantly lower than the fermentation filtrate of strain ZR002 in this application (increased by 41.6%). Therefore, this application uses strain ZR002 to ferment a single substrate, Grasse Rose, which has obvious advantages over the existing plant lactobacillus.

[0087] The following tests were conducted using the filtrate obtained by fermenting Grasse rose with Lactobacillus plantarum ZR002 alone as a sample. The filtrate obtained by fermenting Grasse rose with Lactobacillus plantarum ZR002 was referred to as rose fermentation filtrate.

[0088] Test Example 2

[0089] Moisturizing efficacy test

[0090] The moisturizing performance test was carried out with reference to the zebrafish moisturizing efficacy experimental method.

[0091] Experimental principle: When zebrafish are treated with sodium chloride, the skin surface will lose water and shrink due to osmotic pressure, and the tail area will become smaller due to shrinkage. The moisturizing effect of cosmetics is evaluated by the impact on the tail area.

[0092] Experimental subjects: zebrafish (Albino) with melanin allele mutation, fish age: 2 days after fertilization (2dpf).

[0093] Sample: Rose fermentation filtrate was diluted with water to 0.1% and 0.01% as sample solution.

[0094] Feeding and breeding methods: follow the laboratory standard feeding and breeding methods, in line with the requirements of the international AAALAC certification (certification number: 001458).

[0095] Experimental steps:

[0096] 1. Randomly select zebrafish and place them in a 6-well plate, with 15 zebrafish in each well.

[0097] 2. Set up a normal control group (standard dilution water), a model control group, and a sample group, with a capacity of 3 mL per well; the model control group was given 0.9% sodium chloride solution, and the sample group was given sample solution.

[0098] Incubate at 28°C in the dark for 22 hours.

[0099] 4. In each experimental group, 10 zebrafish were randomly selected and photographed under a dissecting microscope. Advanced image processing software was used to analyze and collect data. The tail area (S) of the zebrafish was analyzed and the following formula was used to calculate and determine whether the sample had moisturizing effect.

[0100]

[0101] The test results are shown in Table 4 and Figure 2 , 3 shown.

[0102] Table 4. Moisturizing effect test results

[0103]

[0104] The results showed that the tail area of ​​the rose fermentation filtrate group was significantly increased compared with the model control group, indicating that the sample had a moisturizing effect, that is, the product filtrate obtained by fermenting Grasse rose using Lactobacillus plantarum ZR002 alone had a certain moisturizing effect.

[0105] Test Example 3

[0106] Antioxidant efficacy test

[0107] 1. DPPH

[0108] The experiment was conducted with reference to the antioxidant (DPPH) free radical scavenging experimental method.

[0109] Instruments and reagents: ELISA reader, analytical balance.

[0110] Experimental Materials:

[0111] Preparation of positive control: Dilute vitamin E with 95% ethanol to 0.08 mg / mL, 0.04 mg / mL, 0.02 mg / mL, and 0.015 mg / mL.

[0112] Sample: Rose fermentation filtrate was diluted with water to 40 mg / mL, 20 mg / mL, 10 mg / mL, 5 mg / mL, and 2.5 mg / mL as sample solutions.

[0113] Experimental steps:

[0114] Add 50 μL of sample solution of the same concentration to the sample well (T) and sample background well (T0), and add 50 μL of positive control solution of the same concentration to the positive control well (P) and positive control background well (P0).

[0115] Add 95% ethanol to all wells to make up to 150μL and mix. Add 50μL of DPPH ethanol solution to the sample well (T), DPPH well (C) and positive control well (P), and add 50μL of 95% ethanol to the sample background well (T0), solvent background well (C0) and positive control background well (P0). Shake gently and let stand at room temperature for 5 minutes.

[0116] The ELISA plate was transferred into an ELISA reader and the absorbance was measured at 517 nm.

[0117] The specific amount of sample added to each well is shown in Table 5 below:

[0118] Table 5. Sample volume

[0119]

[0120] The test results are shown in Table 6 below.

[0121] Table 6. Average absorbance and average clearance results

[0122]

[0123] The results showed that under the conditions of this test, the removal rate could reach 50.05% by diluting the sample concentration to 40 mg / mL, indicating that the filtrate of the product of Rose Grasse fermented by strain ZR002 has significant antioxidant effect.

[0124] 2. ABTS

[0125] The experiment was conducted with reference to the antioxidant (ABTS) free radical scavenging experimental method.

[0126] Instruments and reagents: ELISA reader, analytical balance.

[0127] Experimental Materials:

[0128] Positive control preparation: Vitamin C was diluted with water to 0.01 mg / mL to verify the test system.

[0129] Sample: Weigh rose fermentation filtrate and dilute it with 95% ethanol to make 0.6% (v / v), 0.3% (v / v), and 0.15% (v / v) sample solutions.

[0130] Experimental steps:

[0131] Add the test solution to the ELISA plate according to Table 7 below, move the ELISA plate into the ELISA reader, incubate for 10 minutes, and measure the absorbance at 734 nm.

[0132] Table 7. Test solution addition amount

[0133]

[0134] The test results are shown in Table 8 below.

[0135] Table 8. Absorbance and clearance of different samples

[0136]

[0137] The results showed that under the conditions of this test, the clearance rate of vitamin C was 62.83% (≥50%), and the test results of the positive control met the standard. And the SD values ​​of the clearance rates of all parallel tubes in this experiment were ≤5%, so the parallelism of this experiment was considered valid.

[0138] When the sample concentration was 0.6% (v / v), the scavenging rate of the sample was 95.99%, that is, the sample had the ability to scavenge ABTS free radicals at this concentration, indicating that the product filtrate obtained by fermenting Grasse rose with Lactobacillus plantarum ZR002 alone had significant antioxidant effect.

[0139] 3. ROS

[0140] The experiment was conducted with reference to the antioxidant (ROS) free radical scavenging experimental method.

[0141] Instruments and reagents: inverted microscope, cell counter, carbon dioxide incubator, centrifuge, fluorescence microscope.

[0142] Experimental Materials:

[0143] Complete culture medium: DMEM high glucose medium + 15% serum.

[0144] Sample: Rose fermentation filtrate was diluted into five concentration gradients of 10%, 5%, 1%, 0.5%, and 0.1% as sample solutions for cytotoxicity experiments. Positive control: L-ascorbic acid was used as a positive control.

[0145] Cells and passages: HSF cells were purchased from Fenghui Biotechnology, with cytotoxicity at passage 14 and efficacy at passage 09. (The cells used in the two tests were from different cryopreserved tubes of the same cell line).

[0146] Experimental steps:

[0147] (1) Cell subculture

[0148] Resuscitation and culture of cells.

[0149] (2) Determination of sample cytotoxicity

[0150] The cultured cells were inoculated in a 96-well plate and placed in an incubator for 18-24 h until the cells were 80% confluent. The original culture medium was removed, and 100 μL of sample solution of different concentrations was added to each well. The blank control group without adding sample solution was exposed in the incubator for 24±0.5 h. 20 μL of MTT solution was added to each well and incubated at 37°C for 3±0.5 h. Then the MTT solution was removed, 100 μL of DMSO was added to each well, and the absorbance value was measured at a wavelength of 570 nm after oscillation in the dark for 10-15 min. The experimental results are shown in Table 9.

[0151] According to the results of the cytotoxicity experiment, the sample solution had no obvious cytotoxicity when the concentration was below 5%. Combining the cytotoxicity results and experimental requirements, three concentrations of sample solutions, 5%, 1%, and 0.2%, were finally selected for subsequent efficacy testing.

[0152] Table 9. Cytotoxicity test results

[0153]

[0154] (3) Cell seeding plate

[0155] The cells in the logarithmic growth phase were digested and centrifuged, and a cell suspension of appropriate density was prepared with complete culture medium. The suspension was inoculated into a 6-well cell culture plate according to the experimental design and cultured in a 37°C, 5% CO2 incubator for 24±2h.

[0156] (4) Cell treatment

[0157] Cell UVB modeling: Discard the culture medium in the cell culture plate, add 1 mL of DPBS to each well, and perform UVB irradiation. The sample wells, positive control wells (PC), and model wells (M) all receive the same irradiation dose of UVB (15 mJ / cm 2 After irradiation, transfer the cell plate to a biosafety cabinet for sample loading.

[0158] Cell addition: Discard the DPBS in the 6-well plate and carry out the drug administration operation. Add complete culture medium containing samples of different concentrations to the sample group wells, add complete culture medium containing positive controls to the positive control wells, and add complete culture medium to the model wells, 2mL per well. After drug addition, place the 6-well plate in a CO2 incubator for 1h±15min.

[0159] Loading probes on cells: After incubation, discard the culture medium in the culture plate, wash once with DPBS, add 1 mL of DCFH-DA dye working solution to each well, and incubate in the dark for 20 minutes.

[0160] ROS content detection: After the incubation, the cells in each well were washed 3 times with DPBS, 300 μL DPBS and 3 μL nuclear dye Hoechst were added to each well, the cell plate was transferred to a dark room, and photographed with a fluorescence microscope. The collected photos were analyzed for image fluorescence intensity using ImageJ software.

[0161] The test results are shown in Table 10 below.

[0162] Table 10. Relative fluorescence intensity of ROS in cells and ROS inhibition rate

[0163]

[0164] Note: In the table, Indicates P < 0.01 compared with the model wells.

[0165] The results showed that the ROS inhibition rate of the sample solution at a test concentration of 0.2% was 52.57%. The sample at this concentration had a significant inhibitory effect on ROS in the cells, indicating that the product filtrate obtained by fermenting Grasse rose with Lactobacillus plantarum ZR002 alone has significant antioxidant effect.

[0166] In summary, the sample "the filtrate obtained by fermenting Grasse rose with Lactobacillus plantarum ZR002 alone" has a significant antioxidant effect under the DPPH, ABTS and ROS test indicators.

[0167] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A Lactobacillus plantarum ZR002, characterized in that The Lactobacillus plantarum ZR002 is stored in the General Microbiology Center of the China Microorganism Culture Collection Administration, with the storage number CGMCC No: 32813 and the storage date November 27, 2024.

2. A method for fermenting Grasse rose by using the plant lactobacillus ZR002 according to claim 1, characterized in that: The following steps are involved: (1) Carrying out seed culture of Lactobacillus plantarum ZR002; (2) The cultured Lactobacillus plantarum seed liquid is inoculated at a 5% inoculation rate and inoculated into a fermentation tank filled with Grasse rose fermentation medium for closed culture; (3) After the fermentation culture has lasted for 48 hours, the fermentation broth is centrifuged to remove the bacteria, and then filtered through a plate and frame filter and a 0.45 μm filter membrane to obtain the filtrate of the product of Lactobacillus plantarum fermentation of Rose Grasse.

3. The method according to claim 2, characterized in that In step (1), the seed cultivation process includes: Seed activation culture: inoculate the freeze-dried powder or glycerol tube of Lactobacillus plantarum ZR002 onto the surface of the seed solid culture medium and culture in a closed environment at 37°C for 18-24h; Primary seed culture: a single colony of Lactobacillus plantarum ZR002 was inoculated into a test tube of seed liquid culture medium and cultured in a closed environment at 37°C for 18-24h; Secondary seed culture: Inoculate 3% of the inoculum into a blue-capped bottle of seed liquid culture medium and culture in a sealed container at 37°C for 18-24 hours.

4. The method according to claim 3, characterized in that During the seed activation culture process, the seed solid culture medium is formulated as follows: 45-55 g of MRS broth culture medium and 15-20 g of agar are added to 1.0 L of purified water, and sterilized in an autoclave at 118° C. for 15 min to obtain a seed solid culture medium.

5. The method according to claim 3, characterized in that: During the primary seed culture and secondary seed culture processes, the seed liquid culture medium formula is: take 45-55g of MRS broth culture medium, add it to 1.0L of purified water, sterilize it in an autoclave at 118°C for 15min, and obtain the seed liquid culture medium.

6. The method according to claim 2, characterized in that In step (2), the formula of the Grasse rose fermentation medium is as follows: 0.9-1.1 parts of Grasse rose powder is added to 10 parts of purified water, and the fermentation medium is obtained after sterilization at 115°C for 15 minutes.

7. The method according to claim 2, characterized in that In step (2), the fermentation conditions are: temperature 35-37°C, rotation speed 50-70r / min.

8. The method according to claim 2, characterized in that: In step (3), the rotation speed during the centrifugation process is 14000-15000 r / min.

Images